RESUMO
RATIONALE: Epistaxis is one of the common emergencies in otolaryngology. There are many causes of epistaxis, but reports of epistaxis due to nasal foreign bodies like leeches are rare. PATIENT CONCERNS: A 55-year-old male presented with "repeated epistaxis for over 20 days." Nasal endoscopy revealed a live leech in the olfactory area of the left nostril. DIAGNOSES: The patient was diagnosed with epistaxis caused by a live leech in the nasal cavity. INTERVENTIONS: Under nasal endoscopy, the leech was grasped with a vascular clamp and removed from the nasal cavity. The leech measured 8 cm in length. Hemostasis was achieved using a gelatin sponge at the wound site, and the nasal cavity was packed with Vaseline gauze. OUTCOMES: The live leech was removed via nasal endoscopy. Two days later, the Vaseline gauze packing was removed, and the patient experienced no further nasal bleeding. CONCLUSION: Live leeches in the nasal cavity can cause epistaxis. Nasal endoscopic removal of the live leech is an effective treatment. LESSON: There are many causes of epistaxis, which are nonspecific and prone to missed or incorrect diagnosis. In patients with a history of fieldwork or direct contact with leeches who present with recurrent nasal bleeding, the possibility of epistaxis caused by a live leech should be considered, and timely and effective treatment should be provided.
Assuntos
Epistaxe , Sanguessugas , Masculino , Animais , Humanos , Pessoa de Meia-Idade , Epistaxe/etiologia , Epistaxe/terapia , Epistaxe/diagnóstico , Cavidade Nasal , Nariz , Endoscopia/efeitos adversos , VaselinaRESUMO
Based on a comparison of the 658 bp COI gene sequence and adult morphology, the intraspecific variability of Capila translucida (Leech, 1894) is clarified, and both C. hainana hainana Crowley, 1900 syn. n. and C. hainana sinorientalis Huang & Ding, 1994 syn. n., of which the males are still unknown so far, are considered as junior subjective synonyms of C. translucida. The taxonomic history of the involved taxa is reviewed. Adults and genitalia of both sexes of C. translucida are illustrated.
Assuntos
Borboletas , Sanguessugas , Feminino , Masculino , Animais , GenitáliaRESUMO
A quadrannulate species, Orobdella ganini sp. nov., is described from the Lazovsky Nature Reserve in Primorsky Krai, the Southern Russian Far East, Russia. Morphological features of O. ghilarovi Nakano & Prozorova, 2019 from the reserve are also provided leading to an amendment of the species diagnosis. Maximum likelihood and Bayesian inference phylogenetic analyses, which were performed using nuclear 18S rRNA, 28S rRNA, and histone H3, and mitochondrial cytochrome c oxidase subunit I, tRNACys, tRNAMet, 12S rRNA, tRNAVal, 16S rRNA, tRNALeu and NADH dehydrogenase subunit 1 markers, show that O. ganini sp. nov., O. ghilarovi and two species endemic to Hokkaido, Japan form a clade, with the new species sister to a lineage composed of the two Japanese species. A partial cytochrome c oxidase subunit I sequence obtained from a cocoon found in the Lazovsky Nature Reserve reveals that Orobdella leeches deposit cocoons somewhat similar to those deposited by terrestrial blood-sucking leeches of Haemadipsidae.
Assuntos
Sanguessugas , Animais , Sanguessugas/anatomia & histologia , Filogenia , RNA Ribossômico 16S , Complexo IV da Cadeia de Transporte de Elétrons/genética , Teorema de Bayes , Ásia Oriental , RNA Ribossômico 18S , Federação RussaRESUMO
Further information on the distribution of Aporia procris Leech, 1890 is provided. The population of A. procris from the upper Dadu River, W. Sichuan, previously recognized as ssp. yaozhui Huang, 2021, is treated as a new subspecies, viz., A. p. huangsiyaoi ssp. nov., based upon evidence from external features, with its genital and molecular characters given.
Assuntos
Borboletas , Sanguessugas , Lepidópteros , Animais , Genitália , China , RiosRESUMO
The questionable status of Branchiobdella tetrodonta Pierantoni, 1906 is resolved and the species is transferred to the correct genus. The original description was made from specimens removed from signal crayfish collected in California, USA, unfortunately, Pierantoni (1906c) did not designate any type specimens nor where the preparations were deposited; they are now presumed lost. Holt (1967) believed B. tetrodonta possessed unique penial hooks and a chitinous sheath which was due to his mistranslation of the original Italian description. As a result, Sathodrilus attenuatus Holt, 1981, was described even though specimens came from the same area and host and possessed very similar jaw characteristics to B. tetrodonta. In addition, the jaw characteristics of both endemic species are unique in the Pacific Ocean drainage of the USA. A reassessment of the literature and re-examination of Holts type specimens has resulted in the species name becoming a new combination, Sathodrilus tetrodonta (Pierantoni, 1906), with Sathodrilus attenuatus Holt, 1981, as its junior synonym.
Assuntos
Anelídeos , Sanguessugas , Animais , AstacoideaRESUMO
Surface-feeding aquatic animals navigate towards the source of water disturbances and must differentiate prey from other environmental stimuli. Medicinal leeches locate prey, in part, using a distribution of mechanosensory hairs along their body that deflect under fluid flow. Leech's behavioral responses to surface wave temporal frequency are well documented. However, a surface wave's temporal frequency depends on many underlying environmental and fluid properties that vary substantially in natural habitats (e.g., water depth, temperature). The impact of these variables on neural response and behavior is unknown. Here, we developed a physics-based leech mechanosensor model to examine the impact of environmental and fluid properties on neural response. Our model used the physical properties of a leech cilium and was verified against existing behavioral and electrophysiological data. The model's peak response occurred with waves where the effects of gravity and surface tension were nearly equal (i.e., the phase velocity minimum). This suggests that preferred stimuli are related to the interaction between fundamental properties of the surrounding medium and the mechanical properties of the sensor. This interaction likely tunes the sensor to detect the nondispersive components of the signal, filtering out irrelevant ambient stimuli, and may be a general property of cilia across the animal kingdom.
Assuntos
Organismos Aquáticos , Sanguessugas , Animais , Fenômenos Biomecânicos , Cílios , Sanguessugas/fisiologia , ÁguaRESUMO
This article studies the impact caused by the success and dissemination of Broussais' theories on the use of leeches as a medical supply on Spanish-French trade relations, as well as its consequences for the Spanish market between 1821 and the 1860s. Analysing the documents produced by the different public administrations, together with newspaper and archival sources in both Spain and France and the literature and legislation of that period, allows us to understand the evolution of this trade and the heavy impact it had on the autochthonous population of this animal resource. The article reveals how, at the beginning of the 1820s, leeches became an important medical supply and how the demand for them increased significantly. This gave rise to a trade relation between Spain and France that led to the overexploitation of the resource, the issuing of regulations on the matter, and the search for technological solutions to increase the production of leeches.
Assuntos
Hirudo medicinalis , Sanguessugas , Animais , Humanos , França , EspanhaRESUMO
Chemical cues play important roles in mediating ecological interactions. Oxylipins, oxygenated metabolites of fatty acids, are one signalling molecule type that influences the physiology and function of species, suggesting their broader significance in chemical communication within aquatic systems. Yet, our current understanding of their function is restricted taxonomically and contextually making it difficult to infer their ecological significance. Snails and leeches are ubiquitous in freshwater ecosystems worldwide, yet little is known about their oxylipin profiles and the factors that cause their profiles to change. As snails and leeches differ taxonomically and represent different trophic groups, we postulated oxylipin profile differences. For snails, we hypothesized that ontogeny (non-reproductive vs reproductive) and predation (non-infested vs leech-infested) would affect oxylipin profiles. Oxylipins were characterized from water conditioned with the snail Planorbella duryi and leech Helobdella lineata, and included three treatment types (snails, leeches, and leech-infested snails) with the snails consisting of three size classes: small (5-6 mm, non-reproductive) and medium and large (13-14 and 19-20 mm, reproductive). The two species differed in the composition of their oxylipin profiles both in diversity and amounts. Further, ontogeny and predation affected the diversity of oxylipins emitted by snails. Our experimental profiles of oxylipins show that chemical cues within freshwater systems vary depending upon the species emitting the signals, the developmental stage of the species, as well as from ecological interactions such as predation. We also identified some candidates, like 9-HETE and PGE2, that could be explored more directly for their physiological and ecological roles in freshwater systems.
Assuntos
Sanguessugas , Oxilipinas , Animais , Ecossistema , Comportamento Predatório , Caramujos/fisiologia , Água DoceRESUMO
Diabetic nephropathy (DN) is a major microvascular complication of diabetes and a common cause of chronic kidney disease. There is currently a lack of effective treatments for DN, and the prognosis for patients remains poor. Hirudin, one of the primary active components derived from leeches, demonstrates anti-coagulant, anti-fibrotic, anti-thrombotic, and anti-inflammatory properties, exhibiting significant protective effects on the kidneys. In recent years, there has been a surge of interest in studying the potential benefits of hirudin, especially in its role in the management of DN. This article delves into the mechanisms by which hirudin contributes to the treatment of DN and its clinical efficacy.
Assuntos
Diabetes Mellitus , Nefropatias Diabéticas , Sanguessugas , Animais , Humanos , Nefropatias Diabéticas/tratamento farmacológico , Hirudinas , Rim , Medicina Tradicional ChinesaRESUMO
Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.
Assuntos
Hirudo medicinalis , Sanguessugas , Animais , Hirudo medicinalis/genética , DNA Ribossômico/genética , Lagoas , Sanguessugas/genética , Primers do DNARESUMO
Despite being a non-hematophagous leech, Whitmania pigra is widely used in traditional Chinese medicine for the treatment of antithrombotic diseases. In this study, we provide a high quality genome of W. pigra and based on which, we performed a systematic identification of the potential antithrombotic genes and their corresponding proteins. We identified twenty antithrombotic gene families including thirteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. Unexpectedly, a total of 79 antithrombotic genes were identified, more than a typical blood-feeding Hirudinaria manillensis, which had only 72 antithrombotic genes. In addition, combining with the RNA-seq data of W. pigra and H. manillensis, we calculated the expression levels of antithrombotic genes of the two species. Five and four gene families had significantly higher and lower expression levels in W. pigra than in H. manillensis, respectively. These results showed that the number and expression level of antithrombotic genes of a non-hematophagous leech are not always less than those of a hematophagous leech. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a non-hematophagous leech to date and will significantly enhance the investigation and utilization of leech derivatives in thrombosis therapy research and pharmaceutical applications.
Assuntos
Sanguessugas , Trombose , Animais , Humanos , Fibrinolíticos , Sanguessugas/genética , Trombose/genética , Inibidores da Agregação Plaquetária , CromossomosRESUMO
Hirudo nipponia, a blood-sucking leech native to East Asia, possesses a rich repertoire of active ingredients in its saliva, showcasing significant medical potential due to its anticoagulant, anti-inflammatory, and antibacterial effects against human diseases. Despite previous studies on the transcriptomic and proteomic characteristics of leech saliva, which have identified medicinal compounds, our knowledge of tissue-specific transcriptomes and their spatial expression patterns remains incomplete. In this study, we conducted an extensive transcriptomic profiling of the salivary gland tissue in H. nipponia based on de novo assemblies of tissue-specific transcriptomes from the salivary gland, teeth, and general head region. Through gene ontology (GO) analysis and hierarchical clustering, we discovered a novel set of anti-coagulant factors-i.e., Hni-Antistasin, Hni-Ghilanten, Hni-Bdellin, Hni-Hirudin-as well as a previously unrecognized immune-related gene, Hni-GLIPR1 and uncharacterized salivary gland specific transcripts. By employing in situ hybridization, we provided the first visualization of gene expression sites within the salivary gland of H. nipponia. Our findings expand on our understanding of transcripts specifically expressed in the salivary gland of blood-sucking leeches, offering valuable resources for the exploration of previously unidentified substances with medicinal applications.
Assuntos
Hirudo medicinalis , Sanguessugas , Animais , Perfilação da Expressão Gênica , Hirudo medicinalis/genética , Hirudo medicinalis/metabolismo , Sanguessugas/genética , Sanguessugas/metabolismo , Proteínas de Membrana/genética , Proteínas de Neoplasias/genética , Proteínas do Tecido Nervoso/genética , Proteômica , Glândulas Salivares/metabolismoRESUMO
HSP90 is a widely distributed molecular chaperone that participates in a variety of cellular processes and plays an important role in the meiosis of germ cells. However, its role in the gonadal development of hermaphroditic Whitmania pigra is not yet clear. To explore the effect of HSP90 on the germ cell development of Wh. Pigra, this study cloned the wpHSP90 gene, performed bioinformatics analysis, and measured its expression levels. The results showed that the cloned wpHSP90 was 2 592 bp in length, with an open reading frame(ORF) of 2 373 bp, encoding 790 amino acids. Prediction analysis revealed 85 phosphorylation modification sites on serine, threonine, and tyrosine residues of the wpHSP90 protein. Structural domain prediction and multiple sequence alignment results showed that wpHSP90 contained two conserved domains of HSP90 and exhibited the highest homology with Helobdella robusta, with a sequence similarity of 80.72%. RT-qPCR results showed that the relative expression level of wpHSP90 in the gonads of 5-month-old Wh. pigra was positively correlated with temperature within the range of 12 â to 28 â. The expression level in the female gonads was significantly higher than in the male gonads and correlated with the trend of germ cell development in the ovaries and testes. In conclusion, wpHSP90 may be involved in regulating the development of germ cells, particularly oocytes, in Wh. pigra. This study provides a reference for further research on the gonadal development mechanism in Wh. pigra.
Assuntos
Sanguessugas , Ovário , Animais , Feminino , Masculino , Temperatura , Gônadas , Testículo , Clonagem MolecularRESUMO
BACKGROUND: Leeches are an integral component of aquatic biocenosis and can be found in a wide range of ecosystems such as freshwater, saltwater, flowing, and still-water ecosystems. It especially plays an important role in the freshwater benthic community and is an important part of the food web. In this study, a leech species was found in the mantle cavity of wild freshwater mussels in Zigong City, Sichuan Province, China, and its identity was determined through morphological analysis and molecular biological analysis. RESULTS: The leech is Hemiclepsis khankiana, a new species of Hemiclepsis that has been discovered in Russia in recent years. Through morphological analysis, the current survey observed that the morphological characteristics of Hemiclepsis khankiana eyespots were significantly different from the first reported description. The first pair of eyespots on the leech were separated and clear, while it had been reduced to unclear shadows in the previous report. The phylogenetic tree based on the COI gene showed that the COI gene sequence obtained in this study was in the same evolutionary branch as Hemiclepsis khankiana (MN295420, MN295421). Genetically, it was most closely related to Hemiclepsis kasmiana (mean COI p-distance = 3.98%). CONCLUSIONS: The current study reported on the new distribution range of Hemiclepsis khankiana, which was initially discovered in China. This study indicates that the distribution range of the leech species has expanded, laying a foundation for further studies in China.
Assuntos
Ecossistema , Sanguessugas , Animais , Filogenia , Sanguessugas/genética , Evolução Biológica , ChinaRESUMO
In the experiment, 160 medicinal leeches of the species Hirudo verbana Carena, 1820 were studied. Medicinal leeches were fed on the blood of animals and people (conditionally healthy and diseased). Four leeches were taken from each animal/person. The animals were studied for 3 weeks. Mortality was mostly observed in the first days after feeding on the blood of the host. We noted mortality, the appearance of constrictions on the leeches' body, the intensity of the host blood spitting from their body. The host's blood was taken from their stomach on the first day after feeding. Hematological and immunological indicators of blood were determined in the taken blood of the host. As a result of the study of the blood of the sick, significant changes were found, compared to conditionally healthy ones. It was manifested by an increase in erythrocytes and leukocytes. The leukocyte formula looked like in most pathological conditions of the inflammatory process. The obtained indicators of the experiment make it possible to quickly assess the presence of physiological disorders in the early stages of the disease.
Assuntos
Sanguessugas , Animais , Humanos , Sangue , Eritrócitos/patologia , Leucócitos/patologiaRESUMO
Leeches are well-known annelids due to their obligate blood-feeding habits. Some leech species secrete various biologically active substances which have important medical and pharmaceutical value in antithrombotic treatments. In this study, we provided a high-quality genome of the Asian buffalo leech (Hirudinaria manillensis), based on which we performed a systematic identification of potential antithrombotic genes and their corresponding proteins. Combining automatic and manual prediction, we identified 21 antithrombotic gene families including fourteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. A total of 72 antithrombotic genes, including two pseudogenes, were identified, including most of their corresponding proteins forming three or more disulfide bonds. Three protein families (LDTI, antistasin, and granulin) had internal tandem repeats containing 6, 10, and 12 conserved cysteines, respectively. We also measured the anticoagulant activities of the five identified hirudins (hirudin_Hman1 ~ hirudin_Hman5). The results showed that three (hirudin_Hman1, hirudin_Hman2, and hirudin_Hman5), but not the remaining two, exhibited anticoagulant activities. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a leech to date. These results will greatly facilitate the research and application of leech derivatives for medical and pharmaceutical purposes in the treatment of thrombotic diseases.
Assuntos
Hirudinas , Sanguessugas , Animais , Sequência de Aminoácidos , Anticoagulantes/farmacologia , Anticoagulantes/uso terapêutico , Fibrinolíticos/farmacologia , Fibrinolíticos/metabolismo , Hirudinas/metabolismo , Sanguessugas/genética , Sanguessugas/química , Sanguessugas/metabolismo , Preparações Farmacêuticas/metabolismoRESUMO
Strict blood-feeding animals are confronted with a strong B-vitamin deficiency. Blood-feeding leeches from the Glossiphoniidae family, similarly to hematophagous insects, have evolved specialized organs called bacteriomes to harbor symbiotic bacteria. Leeches of the Haementeria genus have two pairs of globular bacteriomes attached to the esophagus which house intracellular "Candidatus Providencia siddallii" bacteria. Previous work analyzing a draft genome of the Providencia symbiont of the Mexican leech Haementeria officinalis showed that, in this species, the bacteria hold a reduced genome capable of synthesizing B vitamins. In this work, we aimed to expand our knowledge on the diversity and evolution of Providencia symbionts of Haementeria. For this purpose, we sequenced the symbiont genomes of three selected leech species. We found that all genomes are highly syntenic and have kept a stable genetic repertoire, mirroring ancient insect endosymbionts. Additionally, we found B-vitamin pathways to be conserved among these symbionts, pointing to a conserved symbiotic role. Lastly and most notably, we found that the symbiont of H. acuecueyetzin has evolved an alternative genetic code, affecting a portion of its proteome and showing evidence of a lineage-specific and likely intermediate stage of genetic code reassignment.
Assuntos
Sanguessugas , Providencia , Animais , Providencia/genética , Filogenia , Sanguessugas/genética , Bactérias/genética , Insetos/genética , Vitaminas , Código Genético , Simbiose/genéticaRESUMO
Staphylococcus aureus (S. aureus) infections are a leading cause of morbidity and mortality, which are compounded by drug resistance. By manipulating the coagulation system, S. aureus gains a significant advantage over host defense mechanisms, with hypercoagulation induced by S. aureus potentially aggravating infectious diseases. Recently, we and other researchers identified that a higher level of LL-37, one endogenous antimicrobial peptide with a significant killing effect on S. aureus infection, resulted in thrombosis formation through the induction of platelet activation and potentiation of the coagulation factor enzymatic activity. In the current study, we identified a novel antimicrobial peptide (RK22) from the salivary gland transcriptome of Hirudinaria manillensis (H. manillensis) through bioinformatic analysis, and then synthesized it, which exhibited good antimicrobial activity against S. aureus, including a clinically resistant strain with a minimal inhibitory concentration (MIC) of 6.25 µg/mL. The RK22 peptide rapidly killed S. aureus by inhibiting biofilm formation and promoting biofilm eradication, with good plasma stability, negligible cytotoxicity, minimal hemolytic activity, and no significant promotion of the coagulation system. Notably, administration of RK22 significantly inhibited S. aureus infection and the clinically resistant strain in vivo. Thus, these findings highlight the potential of RK22 as an ideal treatment candidate against S. aureus infection.
Assuntos
Sanguessugas , Staphylococcus aureus Resistente à Meticilina , Infecções Estafilocócicas , Animais , Staphylococcus aureus , Peptídeos Antimicrobianos , Infecções Estafilocócicas/tratamento farmacológicoRESUMO
Medicinal leeches are used for therapeutic purposes in the prevention and treatment of many diseases. Because they have a large amount of biologically active substances in their body. Each of these substances has many therapeutic effects. In natural conditions, they are mostly are fed of blood by wild animals. In laboratory conditions, the blood of domestic animals is mostly used. Currently, medicinal leeches are mostly bred in laboratory conditions. Because there are very few of them in nature. They are listed in the Red Book. Scientists of various specialties are looking for optimal conditions for their life and breeding. That became our research goal. To identify the influence of blood human, domestic animals (pigs and chickens) and small laboratory animals (rats) on the viability and behavior of medicinal leeches Hirudo verbana Carena, 1820 and Hirudo orientalis Utevsky & Trontelj, 2005. According to this, 8 groups of sexually mature animals were formed: 1 and 2 - human blood; 3, 4 - blood of a domestic pig; 5, 6 - blood of domestic chickens; 7, 8 - blood of a non-linear laboratory rat. As a result of the study, it was found that the blood of pigs and chickens is the most suitable for feeding the medical leech for normal life and behavior. Mortality of leeches was observed when feeding on rat and human blood. It should be noted that at the beginning of feeding animals with blood human. The percentage of cannibalism in animals increased.
Assuntos
Hirudo medicinalis , Sanguessugas , Humanos , Animais , Suínos , Ratos , Galinhas , Animais de Laboratório , Animais Domésticos , Sus scrofaRESUMO
BACKGROUND: Dinobdella ferox is the most frequently reported leech species parasitizing the mammalian nasal cavity. However, the molecular mechanism of this special parasitic behavior has remained largely unknown. METHODS: PacBio long-read sequencing, next-generation sequencing (NGS), and Hi-C sequencing were employed in this study to generate a novel genome of D. ferox, which was annotated with strong certainty using bioinformatics methods. The phylogenetic and genomic alterations of D. ferox were then studied extensively alongside the genomes of other closely related species. The obligatory parasitism mechanism of D. ferox was investigated using RNA-seq and proteomics data. RESULTS: PacBio long-read sequencing and NGS yielded an assembly of 228 Mb and contig N50 of 2.16 Mb. Along Hi-C sequencing, 96% of the sequences were anchored to nine linkage groups and a high-quality chromosome-level genome was generated. The completed genome included 19,242 protein-coding genes. For elucidating the molecular mechanism of nasal parasitism, transcriptome data were acquired from the digestive tract and front/rear ends of D. ferox. Examining secretory proteins in D. ferox saliva helped to identify intimate connections between these proteins and membrane proteins in nasal epithelial cells. These interacting proteins played important roles in extracellular matrix (ECM)-receptor interaction, tight junction, focal adhesion, and adherens junction. The interaction between D. ferox and mammalian nasal epithelial cells included three major steps of pattern recognition, mucin connection and breakdown, and repair of ECM. The remodeling of ECM between epithelial cells of the nasal mucosa and epithelial cells of D. ferox may produce a stable adhesion environment for parasitism. CONCLUSIONS: Our study represents the first-ever attempt to propose a molecular model for specific parasitism. This molecular model may serve as a practical reference for parasitism models of other species and a theoretical foundation for a molecular process of parasitism.