MicroRNA-335-5p suppresses voltage-gated sodium channel expression and may be a target for seizure control.

There remains an urgent need for new therapies for treatment-resistant epilepsy. Sodium channel blockers are effective for seizure control in common forms of epilepsy, but loss of sodium channel function underlies some genetic forms of epilepsy. Approaches that provide bidirectional control of sodium channel expression are needed. MicroRNAs (miRNA) are small noncoding RNAs which negatively regulate gene expression. Here we show that genome-wide miRNA screening of hippocampal tissue from a rat epilepsy model, mice treated with the antiseizure medicine cannabidiol, and plasma from patients with treatment-resistant epilepsy, converge on a single target-miR-335-5p. Pathway analysis on predicted and validated miR-335-5p targets identified multiple voltage-gated sodium channels (VGSCs). Intracerebroventricular injection of antisense oligonucleotides against miR-335-5p resulted in upregulation of Scn1a, Scn2a, and Scn3a in the mouse brain and an increased action potential rising phase and greater excitability of hippocampal pyramidal neurons in brain slice recordings, consistent with VGSCs as functional targets of miR-335-5p. Blocking miR-335-5p also increased voltage-gated sodium currents and SCN1A, SCN2A, and SCN3A expression in human induced pluripotent stem cell-derived neurons. Inhibition of miR-335-5p increased susceptibility to tonic-clonic seizures in the pentylenetetrazol seizure model, whereas adeno-associated virus 9-mediated overexpression of miR-335-5p reduced seizure severity and improved survival. These studies suggest modulation of miR-335-5p may be a means to regulate VGSCs and affect neuronal excitability and seizures. Changes to miR-335-5p may reflect compensatory mechanisms to control excitability and could provide biomarker or therapeutic strategies for different types of treatment-resistant epilepsy.

miR-9a-5p expression is decreased in the hippocampus of rats resistant to lamotrigine: A behavioural, molecular and bioinformatics assessment.

The major obstacle in developing new treatment strategies for refractory epilepsy is the complexity and poor understanding of its mechanisms. Utilizing the model of lamotrigine-resistant seizures, we evaluated whether changes in the expression of sodium channel subunits are responsible for the diminished responsiveness to lamotrigine (LTG) and if miRNAs, may also be associated. Male rats were administered LTG (5 mg/kg) before each stimulation during kindling acquisition. Challenge stimulation following LTG exposure (30 mg/kg) was performed to confirm resistance in fully kindled rats. RT-PCR was used to measure the mRNA levels of sodium channel subunits (SCN1A, SCN2A, and SCN3A) and miRNAs (miR-155-5p, miR-30b-5p, miR-137-3p, miR-342-5p, miR-301a-3p, miR-212-3p, miR-9a-5p, and miR-133a-3p). Western blot analysis was utilized to measure Nav1.2 protein, and bioinformatics tools were used to perform target prediction and enrichment analysis for miR-9a-5p, the only affected miRNA according to the responsiveness to LTG. Amygdala kindling seizures downregulated Nav1.2, miR-137-3p, miR-342-5p, miR-155-5p, and miR-9a-5p as well as upregulated miR-212-3p. miR-9a-5p was the only molecule decreased in rats resistant to LTG. The bioinformatic assessment and disease enrichment analysis revealed that miR-9a-5p targets expressed with high confidence in the hippocampus are the most significantly associated with epilepsy. Due to the miR-9a-5p dysregulation, major pathways affected are neurotrophic processes, neurotransmission, inflammatory response, cell proliferation and apoptosis. Interaction network analysis identified LTG target SCN2A as interacting with highest number of genes regulated by miR-9-5p. Further studies are needed to propose specific genes and miRNAs responsible for diminished responsiveness to LTG. miR-9a-5p targets, like KCNA4, KCNA2, CACNB2, SCN4B, KCNC1, should receive special attention in them.

De novo SCN3A missense variant associated with self-limiting generalized epilepsy with fever sensitivity.

OBJECTIVE: Although the number of affected individuals is relatively low, pathogenic SCN3A variants have been reported in a range of phenotypes, from focal epilepsy to severe developmental and epileptic encephalopathy with polymicrogyria. METHODS: Case report and inclusion of current literature. RESULTS: Here, we report a normally developed boy with self-limiting generalized epilepsy with fever sensitivity due to a likely pathogenic SCN3A variant. He had febrile seizures from the age of one year, which were successfully treated with valproate. After tapering off medication, he only had rare breakthrough seizures, always associated with fever. At the age of 12 he continues to develop normally and have normal cognition. Reviewing the literature, there appears to be a correlation between functional outcome and phenotype. Gain of function SCN3A variants are seen in individuals with a severe epilepsy, cognitive impairment and brain malformations, while loss of function variants are seen in individuals with epilepsy, varying degrees of cognitive impairment, including normal cognition, but no brain malformations. SIGNIFICANCE: The genotype-phenotype correlations in SCN3A-related disorders presented here, will be important for families and clinicians alike, for diagnostic as well as possibly future treatment options.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Knockdown of rno_circRNA_009194 Improves Outcomes in Traumatic Brain Injury Rats through Inhibiting Voltage-Gated Sodium Channel Nav1.3.

Excessive activation of voltage-gated sodium channel Nav1.3 has been recently reported in secondary traumatic brain injury (TBI). However, the molecular mechanisms underlying regulating voltage-gated sodium channel (Nav1.3) have not been well understood. The present study used a TBI rat model induced by a fluid percussion device and performed a circular RNA (circRNA) microarray (n = 3) to profile the altered circRNAs in the hippocampus after TBI. After polymerase chain reaction (PCR) validation, certain circRNAs were selected to investigate the function and mechanism in regulating Nav1.3 in the TBI rat model by intracerebroventricular injection with lentivirus. The neurological outcome was evaluated by Morris water maze test, modified Neurological Severity Score (mNSS), brain water content measurement, and hematoxylin and eosin staining. The related molecular mechanisms were explored with PCR, Western blotting, luciferase reporter, chromatin immunoprecipitation assay, and electrophoretic mobility shift assay (EMSA). A total of 347 circRNAs were observed to be differentially expressed (fold change [FC] ≥ 1.2 and p < 0.05) after TBI, including 234 up-regulated and 113 down-regulated circRNAs. Among 10 validated circRNAs, we selected circRNA_009194 with the maximized up-regulated fold change (n = 5, FC = 4.45, p < 0.001) for the in vivo functional experiments. Down-regulation of circRNA_009194 resulted in a 27.5% reduced mNSS in rat brain (n = 6, p < 0.01) after TBI and regulated the expression levels of miR-145-3p, Sp1, and Nav1.3, which was reversed by sh-miR-145-3p or Sp1/Nav1.3 overexpression (n = 5, p < 0.05). Mechanistically, circRNA_009194 might act as a sponge for miR-145-3p to regulate Sp1-mediated Nav1.3. This study demonstrated that circRNA_009194 knockdown could improve neurological outcomes in TBI in vivo by inhibiting Nav1.3, directly or indirectly.

MiR-214-3p plays a protective role in diabetic neuropathic rats by regulating Nav1.3 and TLR4.

This study aimed to investigate the functions of miR-214-3p in diabetic neuropathic rodents. The diabetic neuropathy was induced by intraperitoneal injection of streptozotocin (STZ) in rats, and miR-214-3p was delivered via tail vein injection of lentivirus. Hot or cold stimulus tests demonstrated that STZ induced thermal hyperalgesia. Neurophysiological measurements revealed that motor and sensory nerve conduction velocity and nerve blood flow were decreased in diabetic neuropathic rats. However, the STZ-induced hyperalgesia, and reduced nerve conduction velocity and nerve blood flow were all significantly reversed by miR-214-3p administration. HE staining, TUNEL, ELISA, and immunoblotting demonstrated that STZ led to obvious pathological lesion, cell apoptosis, and inflammation in dorsal root ganglion (DRG), evidenced by altered levels of apoptosis-related protein molecules and inflammatory factors, and activation of Toll-like receptor 4 (TLR4)/myeloid differentiation primary response gene 88/nuclear factor kappa B signaling. The pathological alterations in diabetic neuropathic rats in DRG were significantly ameliorated by miR-214-3p application. In addition, sodium channel protein type 3 subunit alpha isoform 1 (Nav1.3) and TLR4 were identified as targets of miR-214-3p via dual-luciferase reporter assay. MiR-214-3p may play its roles by downregulating Nav1.3 and TLR4. In summary, miR-214-3p alleviated diabetes-induced nerve injury, and pathological lesion, cell apoptosis, and inflammation in DRG by regulating Nav1.3 and TLR4 in STZ-induced rats. These findings may provide novel therapeutic targets for clinical treatment of diabetic neuropathy.

Identification of a novel variant p.Ser606Gly in SCN3A associated with childhood absence epilepsy.

Sodium (Na+) channels are the basis for action potential generation and propagation, which play a key role in the regulation of neuronal excitability. SCN3A is a gene encoding for sodium channel protein type 3 subunit alpha (or known as Nav1.3). This study aimed to explore SCN3A genetic variants in a cohort of childhood absence epilepsy (CAE) via whole exome sequencing. A novel SCN3A missense variant (c.A1816G, p.Ser606Gly) was identified in a patient with CAE. This variant had not been reported in both 1000G and ExAC databases. Bioinformatics analysis revealed that this variant was pathogenic and could transform the protein structure of Nav1.3. The reported phenotypes of SCN3A-related central nerve system disorders included multiple seizure types, polymicrogyria and different degrees of developmental delay/intellectual disability. The patient with p.Ser606Gly variant exhibited typical absence seizures. The MRI and CT scan results were normal, and EEG showed that 3-Hz spike-slow wave discharges. In conclusion, our findings not only broaden the pathogenic spectrum of SCN3A, but also extend the clinical phenotypes of SCN3A-related CAE.

A Low-Frequency Pulsed Magnetic Field Reduces Neuropathic Pain by Regulating NaV1.8 and NaV1.9 Sodium Channels at the Transcriptional Level in Diabetic Rats.

Low-frequency pulsed magnetic field (LF-PMF) application is a non-invasive, easy, and inexpensive treatment method in pain management. However, the molecular mechanism underlying the effect of LF-PMF on pain is not fully understood. Considering the obvious dysregulations of gene expression observed in certain types of voltage-gated sodium channels (VGSCs) in pain conditions, the present study tested the hypothesis that LF-PMF shows its pain-relieving effect by regulating genes that code VGSCs proteins. Five experimental rat groups (Control, Streptozotocin-induced experimental painful diabetic neuropathy (PDN), PDN Sham, PDN 10 Hz PMF, and PDN 30 Hz PMF) were established. After the pain formation in PDN groups, the magnetic field groups were exposed to 10/30 Hz, 1.5 mT PMF for 4 weeks, an hour daily. Progression of pain was evaluated using behavioral pain tests during the entire experimental processes. After the end of PMF treatment, SCN9A (NaV1.7 ), SCN10A (NaV1.8 ), SCN11A (NaV1.9 ), and SCN3A (NaV1.3 ) gene expression level changes were determined by analyzing real-time polymerase chain reaction results. We found that 10 Hz PMF application was more effective than 30 Hz on pain management. In addition, NaV1.7 and NaV1.3 transcriptions were upregulated while NaV1.8 and NaV1.9 were downregulated in painful conditions. Notably, the downregulated expression of the genes encoding NaV1.8 and NaV1.9 were re-regulated and increased to control level by 10 Hz PMF application. Consequently, it may be deduced that 10 Hz PMF application reduces pain by modulating certain VGSCs at the transcriptional level. © 2021 Bioelectromagnetics Society.

Mutations in the sodium channel genes SCN1A, SCN3A, and SCN9A in children with epilepsy with febrile seizures plus(EFS+).

PURPOSE: To explore disease-causing gene mutations of epilepsy with febrile seizures plus (EFS+) in Southern Chinese Han population. METHODS: Blood samples and clinical data were collected from 49 Southern Han Chinese patients with EFS+. Gene screening was performed using whole-exome sequencing and panel sequencing for 485 epilepsy-related genes. The pathogenicity of variants was evaluated based on ACMG scoring and assessment of clinical concordance. RESULTS: We identified 10 putatively causative sodium channel gene variants in 49 patients with EFS+, including 8 variants in SCN1A (R500Q appeared twice), one in SCN3A and one in SCN9A. All these missense mutations were inherited from maternal or paternal and were evaluated to be of uncertain significance according to ACMG. The clinical features of patients were in concordance with the EFS+ phenotype of the mutated SCN1A, SCN3A and SCN9A gene. The clinical phenotypes of 11 probands with these gene variants included febrile seizures plus (FS+, n=7), Dravet Syndrome (n=3), FS+ with focal seizures (n=1). Three probands with SCN1A variants (R500Q located in the non-voltage areas, or G1711D in the pore-forming domain) developed severe Dravet syndrome. The affected individuals with the other 6 SCN1A variants located outside the pore-forming domain showed mild phenotypes. Novel SCN3A variant ((D1688Y) and SCN9A variant (R185H) were identified in two probands respectively and both of the probands had FS+. CONCLUSION: The SCN1A, SCN3A, and SCN9A gene mutations might be a pathogenic cause of EFS+ in Southern Chinese Han population.

Slow recovery from the inactivation of voltage-gated sodium channel Nav1.3 in mouse taste receptor cells.

Action potentials play an important role in neurotransmitter release in response to taste. Here, I have investigated voltage-gated Na+ channels, a primary component of action potentials, in respective cell types of mouse fungiform taste bud cells (TBCs) with in situ whole-cell clamping and single-cell RT-PCR techniques. The cell types of TBCs electrophysiologically examined were determined immunohistochemically using the type III inositol 1,4,5-triphoshate receptor as a type II cell marker and synaptosomal-associated protein 25 as a type III cell marker. I show that type II cells, type III cells, and TBCs not immunoreactive to these markers (likely type I cells) generate voltage-gated Na+ currents. The recovery following inactivation of these currents was well fitted with double exponential curves. The time constants in type III cells (~20 ms and ~ 1 s) were significantly slower than respective time constants in other cell types. RT-PCR analysis indicated the expression of Nav1.3, Nav1.5, Nav1.6, and ß1 subunit mRNAs in TBCs. Pharmacological inhibition and single-cell RT-PCR studies demonstrated that type II and type III cells principally express tetrodotoxin (TTX)-sensitive Nav1.3 channels and that ~ 30% of type I cells express TTX-resistant Nav1.5 channels. The auxiliary ß1 subunit that modulates gating kinetics was rarely detected in TBCs. As the ß1 subunit co-expressed with an α subunit is known to accelerate the recovery from inactivation, it is likely that voltage-gated Na+ channels in TBCs may function without ß subunits. Slow recovery from inactivation, especially in type III cells, may limit high-frequency firing in response to taste substances.

Nav1.3 and FGF14 are primary determinants of the TTX-sensitive sodium current in mouse adrenal chromaffin cells.

Adrenal chromaffin cells (CCs) in rodents express rapidly inactivating, tetrodotoxin (TTX)-sensitive sodium channels. The resulting current has generally been attributed to Nav1.7, although a possible role for Nav1.3 has also been suggested. Nav channels in rat CCs rapidly inactivate via two independent pathways which differ in their time course of recovery. One subpopulation recovers with time constants similar to traditional fast inactivation and the other ∼10-fold slower, but both pathways can act within a single homogenous population of channels. Here, we use Nav1.3 KO mice to probe the properties and molecular components of Nav current in CCs. We find that the absence of Nav1.3 abolishes all Nav current in about half of CCs examined, while a small, fast inactivating Nav current is still observed in the rest. To probe possible molecular components underlying slow recovery from inactivation, we used mice null for fibroblast growth factor homology factor 14 (FGF14). In these cells, the slow component of recovery from fast inactivation is completely absent in most CCs, with no change in the time constant of fast recovery. The use dependence of Nav current reduction during trains of stimuli in WT cells is completely abolished in FGF14 KO mice, directly demonstrating a role for slow recovery from inactivation in determining Nav current availability. Our results indicate that FGF14-mediated inactivation is the major determinant defining use-dependent changes in Nav availability in CCs. These results establish that Nav1.3, like other Nav isoforms, can also partner with FGF subunits, strongly regulating Nav channel function.

Discovery of a selective, state-independent inhibitor of NaV1.7 by modification of guanidinium toxins.

The voltage-gated sodium channel isoform NaV1.7 is highly expressed in dorsal root ganglion neurons and is obligatory for nociceptive signal transmission. Genetic gain-of-function and loss-of-function NaV1.7 mutations have been identified in select individuals, and are associated with episodic extreme pain disorders and insensitivity to pain, respectively. These findings implicate NaV1.7 as a key pharmacotherapeutic target for the treatment of pain. While several small molecules targeting NaV1.7 have been advanced to clinical development, no NaV1.7-selective compound has shown convincing efficacy in clinical pain applications. Here we describe the discovery and characterization of ST-2262, a NaV1.7 inhibitor that blocks the extracellular vestibule of the channel with an IC50 of 72 nM and greater than 200-fold selectivity over off-target sodium channel isoforms, NaV1.1-1.6 and NaV1.8. In contrast to other NaV1.7 inhibitors that preferentially inhibit the inactivated state of the channel, ST-2262 is equipotent in a protocol that favors the resting state of the channel, a protocol that favors the inactivated state, and a high frequency protocol. In a non-human primate study, animals treated with ST-2262 exhibited reduced sensitivity to noxious heat. These findings establish the extracellular vestibule of the sodium channel as a viable receptor site for the design of selective ligands targeting NaV1.7.

SCN3A-Related Neurodevelopmental Disorder: A Spectrum of Epilepsy and Brain Malformation.

OBJECTIVE: Pathogenic variants in SCN3A, encoding the voltage-gated sodium channel subunit Nav1.3, cause severe childhood onset epilepsy and malformation of cortical development. Here, we define the spectrum of clinical, genetic, and neuroimaging features of SCN3A-related neurodevelopmental disorder. METHODS: Patients were ascertained via an international collaborative network. We compared sodium channels containing wild-type versus variant Nav1.3 subunits coexpressed with ß1 and ß2 subunits using whole-cell voltage clamp electrophysiological recordings in a heterologous mammalian system (HEK-293T cells). RESULTS: Of 22 patients with pathogenic SCN3A variants, most had treatment-resistant epilepsy beginning in the first year of life (16/21, 76%; median onset, 2 weeks), with severe or profound developmental delay (15/20, 75%). Many, but not all (15/19, 79%), exhibited malformations of cortical development. Pathogenic variants clustered in transmembrane segments 4 to 6 of domains II to IV. Most pathogenic missense variants tested (10/11, 91%) displayed gain of channel function, with increased persistent current and/or a leftward shift in the voltage dependence of activation, and all variants associated with malformation of cortical development exhibited gain of channel function. One variant (p.Ile1468Arg) exhibited mixed effects, with gain and partial loss of function. Two variants demonstrated loss of channel function. INTERPRETATION: Our study defines SCN3A-related neurodevelopmental disorder along a spectrum of severity, but typically including epilepsy and severe or profound developmental delay/intellectual disability. Malformations of cortical development are a characteristic feature of this unusual channelopathy syndrome, present in >75% of affected individuals. Gain of function at the channel level in developing neurons is likely an important mechanism of disease pathogenesis. ANN NEUROL 2020;88:348-362.

IL-6 contributes to Nav1.3 up-regulation in trigeminal nerve following chronic constriction injury.

Background: To verify the hypothesis that the nature of trigeminal neuralgia (TN) is an ectopic impulse induced by sodium channel modulated by cytokines, we conducted an animal study using the infraorbital nerve chronic constriction injury (CCI) model in rats.Method: The expression of Nav1.3 or IL-6 in the infraorbital nerve (ION) and trigeminal ganglion (TG) were detected by western blot and immunocytochemistry after administration of antisense oligodeoxynucleotide sequence (AS), IL-6 or Anti-IL-6.Results: With intrathecal administration of AS or mismatch oligodeoxynucleotide sequence (MM) in the CCI rats, the Nav1.3-IR in ION and TG accounted for 2.2 ± 0.51% and 8.5 ± 3.1% in AS+CCI group vs. 6.9 ± 1.3% and 38.7 ± 4.8% in MM+CCI group (p < 0.05), respectively. While with local administration of IL-6 in those with sham operation, it accounted for 7.4 ± 2.1% and 45.5 ± 3.4% in IL-6+ sham group vs. 1.9 ± 0.67% and 8.1 ± 1.3% in vehicle+sham group (p < 0.05); with local administration of anti-IL-6 in CCI rats, 4.5 ± 0.78% and 32.1 ± 9.6% in Anti-IL-6+ CCI group vs 8.9 ± 2.1% and 61.4 ± 11.2% in vehicle+CCI group (p < 0.05).Discussion: We believe that the emergence of Nav1.3 from the compressed trigeminal nerve might be an important structural basis for the development of the ectopic excitability on the axon and IL-6 may play a role of necessary precondition.

Biological concepts in human sodium channel epilepsies and their relevance in clinical practice.

OBJECTIVE: Voltage-gated sodium channels (SCNs) share similar amino acid sequence, structure, and function. Genetic variants in the four human brain-expressed SCN genes SCN1A/2A/3A/8A have been associated with heterogeneous epilepsy phenotypes and neurodevelopmental disorders. To better understand the biology of seizure susceptibility in SCN-related epilepsies, our aim was to determine similarities and differences between sodium channel disorders, allowing us to develop a broader perspective on precision treatment than on an individual gene level alone. METHODS: We analyzed genotype-phenotype correlations in large SCN-patient cohorts and applied variant constraint analysis to identify severe sodium channel disease. We examined temporal patterns of human SCN expression and correlated functional data from in vitro studies with clinical phenotypes across different sodium channel disorders. RESULTS: Comparing 865 epilepsy patients (504 SCN1A, 140 SCN2A, 171 SCN8A, four SCN3A, 46 copy number variation [CNV] cases) and analysis of 114 functional studies allowed us to identify common patterns of presentation. All four epilepsy-associated SCN genes demonstrated significant constraint in both protein truncating and missense variation when compared to other SCN genes. We observed that age at seizure onset is related to SCN gene expression over time. Individuals with gain-of-function SCN2A/3A/8A missense variants or CNV duplications share similar characteristics, most frequently present with early onset epilepsy (<3 months), and demonstrate good response to sodium channel blockers (SCBs). Direct comparison of corresponding SCN variants across different SCN subtypes illustrates that the functional effects of variants in corresponding channel locations are similar; however, their clinical manifestation differs, depending on their role in different types of neurons in which they are expressed. SIGNIFICANCE: Variant function and location within one channel can serve as a surrogate for variant effects across related sodium channels. Taking a broader view on precision treatment suggests that in those patients with a suspected underlying genetic epilepsy presenting with neonatal or early onset seizures (<3 months), SCBs should be considered.

miR-384-5p ameliorates neuropathic pain by targeting SCN3A in a rat model of chronic constriction injury.

Objective: To explore the potential regulation mechanisms of miR-384-5p in Neuropathic pain (NP).Methods: Rat model of chronic constriction injury (CCI) was established to induce NP in vivo. NP levels were assessed using Withdrawal Threshold (PWT) and Paw Withdrawal Latency (PWL). qPCR and Western blotting were used to determine the relative expression of miR-384-5p and SCN3A. The inflammation response in spinal microglia cells was determined by ELISA assay. Immunofluorescence assay was used to demonstrate the co-localization of miR-384-5p with SCN3A in rat dorsal root ganglions (DRGs). The target genes of miR-384-5p were verified by dual-luciferase report assays.Results: In the current study, the miR-384-5p expression level was significantly downregulated in CCI rats when comparing to the sham group. In addition, miR-384-5p agomir significantly repressed mechanical allodynia and heat hyperalgesia in CCI rats. Meanwhile, the current study indicated miR-384-5p could decrease inflammation progress in spinal microglia cells incubated in lipopolysaccharide. Consistently, overexpression of miR-384-5p obviously depressed inflammation cytokine levels in CCI rats. Dual-luciferase reporter assays indicated that SCN3A is a target gene of miR-384-5p.Conclusion: miR-384-5p is a negative regulator in the development of neuropathic pain by regulating SCN3A, indicating that miR-384-5p might be a promising therapeutic target in the treatment of neuropathic pain.Abbreviations: CCI: Chronic constriction injury; ZEB1: Zinc finger E box binding protein-1; MAPK6: Mitogen-activated protein kinase 6; COX-2: cyclooxygenase-2.

Neurodevelopmental disorder associated with de novo SCN3A pathogenic variants: two new cases and review of the literature.

SCN3A was recently recognized as a gene associated with neurodevelopmental disorder and epilepsy. We present two additional patients with a novel de novo SCN3A pathogenic variant, and a review of all published cases of de novo variants. In one of our patients brain magnetic resonance imaging (MRI) disclosed a severe polymicrogyria and in the other it was normal. The clinical phenotype was characterized by a severe developmental delay and refractory epilepsy in the patient with polymicrogyria and intellectual disability with autistic features and pharmacoresponsive epilepsy in the subject with normal MRI. Polymicrogyria, a disorder of progenitor cells proliferation and migration, is an unanticipated finding for an ion channel dysfunction.

MicroRNA-212-3p Attenuates Neuropathic Pain via Targeting Sodium Voltage-gated Channel Alpha Subunit 3 (NaV 1.3).

PURPOSE: To explore the role and potential mechanism of miR-212-3p in neuropathic pain regulation. METHODS: Adult male rats were used to establish chronic constriction injury (CCI) model to mimic the neuropathic pain. Then, paw withdrawal threshold (PWT) and paw withdrawal thermal latency (PWL) were determined. The concentrations of interleukin 1 beta (IL-1ß), interleukin 6 (IL-6) and tumor necrosis factor-alpha (TNF-α) were measured with enzyme-linked immune sorbent assay (ELISA) kit and the expression of miR-212-3p was measured by real time quantitative PCR (RTqPCR). Besides, miR-212-3p agomir was intrathecally injected into CCI rats and the expression of key apoptotic proteins was determined by western blot. Furthermore, dual-luciferase reporter assay was used to determine the binding of miR-212-3p and 3' untranslated regions (3'UTR) of NaV1.3 and the expression levels of NaV1.3 were measured by western blot and RT-qPCR. RESULTS: In the CCI group, the PWT and PWL were significantly decreased and IL-1ß, IL-6 and TNF-α were increased. miR-212-3p was decreased in response to CCI. The intrathecal injection of miR-212-3p agomir into CCI rats improved the PWT and PWL, decreased the IL-1ß, IL-6 and TNF-α, decreased the expression levels of BCL2 associated X, apoptosis regulator (Bax), cleaved caspase-3 and increased the expression levels of BCL2 apoptosis regulator (Bcl-2). The results of dual--luciferase reporter assay showed that miR-212-3p could directly bind with 3'UTR of NaV1.3. The expression of NaV1.3 was up-regulated in CCI rats who were intrathecally injected with miRctrl, whereas it decreased in CCI rats intrathecally injected with miR-212-3p agomir. CONCLUSION: The expression of miR-212a-3p attenuates neuropathic pain by targeting NaV1.3.