Exosomes secreted by Fusobacterium nucleatum-infected colon cancer cells transmit resistance to oxaliplatin and 5-FU by delivering hsa_circ_0004085.

BACKGROUND: A large number of Fusobacterium nucleatum (Fn) are present in colorectal cancer (CRC) tissues of patients who relapse after chemotherapy, and Fn has been reported to promote oxaliplatin and 5-FU chemoresistance in CRC. Pathogens such as bacteria and parasites stimulate exosome production in tumor cells, and the regulatory mechanism of exosomal circRNA in the transmission of oxaliplatin and 5-FU chemotherapy resistance in Fn-infected CRC remains unclear. METHODS: Hsa_circ_0004085 was screened by second-generation sequencing of CRC tissues. The correlation between hsa_circ_0004085 and patient clinical response to oxaliplatin/5-FU was analyzed. Exosome tracing experiments and live imaging systems were used to test the effect of Fn infection in CRC on the distribution of hsa_circ_0004085. Colony formation, ER tracking analysis and immunofluorescence were carried out to verify the regulatory effect of exosomes produced by Fn-infected CRC cells on chemotherapeutic resistance and ER stress. RNA pulldown, LC-MS/MS analysis and RIP were used to explore the regulatory mechanism of downstream target genes by hsa_circ_0004085. RESULTS: First, we screened out hsa_circ_0004085 with abnormally high expression in CRC clinical samples infected with Fn and found that patients with high expression of hsa_circ_0004085 in plasma had a poor clinical response to oxaliplatin/5-FU. Subsequently, the circular structure of hsa_circ_0004085 was identified. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes produced by Fn-infected CRC cells transferred hsa_circ_0004085 between cells and delivered oxaliplatin/5-FU resistance to recipient cells by relieving ER stress. Hsa_circ_0004085 enhanced the stability of GRP78 mRNA by binding to RRBP1 and promoted the nuclear translocation of ATF6p50 to relieve ER stress. CONCLUSIONS: Plasma levels of hsa_circ_0004085 are increased in colon cancer patients with intracellular Fn and are associated with a poor response to oxaliplatin/5-FU. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes secreted by Fn-infected CRC cells deliver hsa_circ_0004085 between cells. Hsa_circ_0004085 relieves ER stress in recipient cells by regulating GRP78 and ATF6p50, thereby delivering resistance to oxaliplatin and 5-FU.

Phosphorylation of hnRNP A1-Serine 199 Is Not Required for T Cell Differentiation and Function.

hnRNP A1 is an important RNA-binding protein that influences many stages of RNA processing, including transcription, alternative splicing, mRNA nuclear export, and RNA stability. However, the role of hnRNP A1 in immune cells, specifically CD4+ T cells, remains unclear. We previously showed that Akt phosphorylation of hnRNP A1 was dependent on TCR signal strength and was associated with Treg differentiation. To explore the impact of hnRNP A1 phosphorylation by Akt on CD4+ T cell differentiation, our laboratory generated a mutant mouse model, hnRNP A1-S199A (A1-MUT) in which the major Akt phosphorylation site on hnRNP A1 was mutated to alanine using CRISPR Cas9 technology. Immune profiling of A1-MUT mice revealed changes in the numbers of Tregs in the mesenteric lymph node. We found no significant differences in naive CD4+ T cell differentiation into Th1, Th2, Th17, or T regulatory cells (Tregs) in vitro. In vivo, Treg differentiation assays using OTII-A1-Mut CD4+ T cells exposed to OVA food revealed migration and homing defects in the A1-MUT but no change in Treg induction. A1-MUT mice were immunized with NP- keyhole limpet hemocyanin, and normal germinal center development, normal numbers of NP-specific B cells, and no change in Tfh numbers were observed. In conclusion, Akt phosphorylation of hnRNP A1 S199 does not play a role in CD4+ T cell fate or function in the models tested. This hnRNP A1-S199A mouse model should be a valuable tool to study the role of Akt phosphorylation of hnRNP A1-S199 in different cell types or other mouse models of human disease.

hnRNP A1 dysfunction alters RNA splicing and drives neurodegeneration in multiple sclerosis (MS).

Neurodegeneration is the primary driver of disease progression in multiple sclerosis (MS) resulting in permanent disability, creating an urgent need to discover its underlying mechanisms. Herein, we establish that dysfunction of the RNA binding protein heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) results in differential of binding to RNA targets causing alternative RNA splicing, which contributes to neurodegeneration in MS and its models. Using RNAseq of MS brains, we discovered differential expression and aberrant splicing of hnRNP A1 target RNAs involved in neuronal function and RNA homeostasis. We confirmed this in vivo in experimental autoimmune encephalomyelitis employing CLIPseq specific for hnRNP A1, where hnRNP A1 differentially binds and regulates RNA, including aberrantly spliced targets identified in human samples. Additionally, dysfunctional hnRNP A1 expression in neurons caused neurite loss and identical changes in splicing, corroborating hnRNP A1 dysfunction as a cause of neurodegeneration. Collectively, these data indicate hnRNP A1 dysfunction causes altered neuronal RNA splicing, resulting in neurodegeneration in MS.

The microRNA-195-5p/hnRNP A1 axis contributes to the progression of hepatocellular carcinoma by regulating the migration of cancer cells.

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

M2 Macrophage-Derived Exosomal lncRNA MIR4435-2HG Promotes Progression of Infantile Hemangiomas by Targeting HNRNPA1.

Purpose: Infantile hemangiomas (IHs) are commonly observed benign tumors that can cause serious complications. M2-polarized macrophages in IHs promote disease progression. In this study, we investigated the role of M2 macrophage-derived exosomal lncRNA MIR4435-2HG in IHs. Patients and Methods: Exosomes derived from M2 polarized macrophages were extracted. Next, using cell co-culture or transfection, we investigated whether M2 polarized macrophage-derived exosomes (M2-exos) can transport MIR4435-2HG to regulate the proliferation, migration, invasion, and angiogenesis of hemangioma-derived endothelial cells (HemECs). RNA-seq and RNA pull-down assays were performed to identify targets and regulatory pathways of MIR4435-2HG. We explored the possible mechanisms through which MIR4435-2HG regulates the biological function of HemECs. Results: M2-exos significantly enhanced the proliferation, migration, invasion, and angiogenesis of HemECs. Thus, HemECs uptake M2-exos and promote biological functions through the inclusion of MIR4435-2HG. RNA-seq and RNA pull-down experiments confirmed that MIR4435-2HG regulates of HNRNPA1 expression and directly binds to HNRNPA1, consequently affecting the NF-κB signal pathway. Conclusion: MIR4435-2HG of M2-exos promotes the progression of IHs and enhances the proliferation, migration, invasion, and angiogenesis of HemECs by directly binding to HNRNPA1. This study not only reveals the mechanism of interaction between M2 macrophages and HemECs, but also provides a promising therapeutic target for IHs.

The mechanism of UP1 binding and unfolding of human telomeric DNA G-quadruplex.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

HnRNP A1 Suppresses the Odontogenic Differentiation and the Inclusion of RUNX2 Exon 5 of Dental Mesenchymal Cells.

BACKGROUND: RUNX2 (Runt-related transcription factor 2) acts as a key regulator in the odontogenic differentiation of human dental pulp stem cells (hDPSCs). Moreover, the inclusion of exon 5 is important for RUNX2 function. Our previous study showed that Y-Box Binding Protein 1 (YBX1) promoted RUNX2 exon 5 inclusion and mineralization of hDPSCs. However, the regulatory mechanism of RUNX2 exon 5 alternative splicing needed further exploration. METHODS: The expression level of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) during the odontogenic differentiation of hDPSCs was analyzed by RT-PCR and Western blot. The roles of hnRNP A1 in the alternative splicing of RUNX2 exon 5 and the odontogenic differentiation of dental mesenchymal cells were analyzed by gain- and loss-of-function experiments. RESULTS: Surprisingly, we found an alternative splicing factor, hnRNP A1, which had an opposite role to YBX1 in regulating RUNX2 exon 5 inclusion and odontogenic differentiation of hDPSCs. Through gain- and loss-of-function assay, we found that hnRNP A1 suppressed the inclusion of RUNX2 exon 5, resulting in the inhibition of odontoblastic differentiation. The overexpression of hnRNP A1 can inhibit the expression of ALP (alkaline phosphatase) and OCN (osteocalcin), and the formation of mineralized nodules during the odontogenic differentiation of both hDPSCs and mouse dental papilla cells (mDPCs), whereas the opposite results were obtained with an hnRNP A1 knockdown preparation. CONCLUSIONS: The present study indicated that hnRNP A1 suppressed RUNX2 exon 5 inclusion and reduced the odontogenic differentiation ability of hDPSCs and mDPCs.

Inhibiting mechanism of Alpiniae oxyphyllae fructus polysaccharide 3 against the replication of porcine epidemic diarrhea virus.

Porcine epidemic diarrhea virus (PEDV) causes diarrhea, vomiting, and death in piglets. Our previous study has revealed the anti-PEDV activity of Alpiniae oxyphyllae fructus polysaccharide 3 (AOFP3). However, it is still unknown whether AOFP3 can inhibit the replication of PEDV. Therefore, the effect of AOFP3 on PEDV replication was investigated in the present study, along with analysis of viral RdRp activity and expression of hnRNP A1 by RNA polymerase activity assay in vitro, RIP assay, and Western blotting. The results showed that both the PEDV gene and protein levels in IPEC-J2 cells decreased with AOFP3 treatment. In addition, AOFP3 significantly reduced PEDV's replication by down-regulating the activity of PEDV RdRp and reducing the expression of hnRNP A1, whereas only the bind of RdRp to PEDV 3'UTR was inhibited in AOFP3 treated cells.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Cryo-EM Structure of the Full-length hnRNPA1 Amyloid Fibril.

Heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) is a multifunctional RNA-binding protein that is associated with neurodegenerative diseases, such as amyotrophic lateral sclerosis and multisystem proteinopathy. In this study, we have used cryo-electron microscopy to investigate the three-dimensional structure of amyloid fibrils from full-length hnRNPA1 protein. We find that the fibril core is formed by a 45-residue segment of the prion-like low-complexity domain of the protein, whereas the remaining parts of the protein (275 residues) form a fuzzy coat around the fibril core. The fibril consists of two fibril protein stacks that are arranged into a pseudo-21 screw symmetry. The ordered core harbors several of the positions that are known to be affected by disease-associated mutations, but does not encompass the most aggregation-prone segments of the protein. These data indicate that the structures of amyloid fibrils from full-length proteins may be more complex than anticipated by current theories on protein misfolding.

Serum/glucose starvation strikingly reduces heterogeneous nuclear ribonucleoprotein A1 protein and its target, cyclin D1.

Our investigation to explore cellular alterations related to undernutrition in cancer cells revealed that the protein level of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1) is drastically decreased by serum/glucose starvation. Its loss was reversible, serum/glucose starvation-specific and universal throughout cell types and species. The hnRNP A1 mRNA level and hnRNP A1 mRNA/protein stability were not altered under this condition. CCND1 mRNA, which we newly identified as the binding target of hnRNP A1, was decreased by serum/glucose starvation. Under similar conditions, CCND1 protein was reduced in vitro and in vivo, whereas hnRNP A1 mRNA level and CCND1 mRNA level revealed no correlation in most clinical samples. Functional analyses revealed that CCND1 mRNA stability is certainly dependent on hnRNP A1 protein level and that RNA recognition motif-1 (RRM1) in hnRNP A1 plays a central role in maintaining CCND1 mRNA stability and subsequent protein expression. The injection of RRM1-deleted hnRNP A1-expressing cancer cells in the mouse xenograft model did not form any tumours, and that of hnRNP A1-expressing cancer cells retained CCND1 expression at the lesion adjacent to necrosis with a slight increase in tumour volume. Furthermore, RRM1 deletion caused growth suppression with the induction of apoptosis and autophagy, whereas CCND1 restoration completely recovered it. Our results indicate that serum/glucose starvation triggers entire hnRNP A1 protein loss, and its loss may play a role in CCND1 mRNA destabilization and CCND1-mediated cellular event inhibition, i.e. growth promotion, apoptosis induction and autophagosome formation.

hnRNPA1 impedes snakehead vesiculovirus replication via competitively disrupting viral phosphoprotein-nucleoprotein interaction and degrading viral phosphoprotein.

Heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) plays an important role in regulating the replication of many viruses. However, it remains elusive whether and how hnRNPA1 regulates fish virus replication. In this study, the effects of twelve hnRNPs on the replication of snakehead vesiculovirus (SHVV) were screened. Three hnRNPs, one of which was hnRNPA1, were identified as anti-SHVV factors. Further verification showed that knockdown of hnRNPA1 promoted, while overexpression of hnRNPA1 inhibited, SHVV replication. SHVV infection reduced the expression level of hnRNPA1 and induced the nucleocytoplasmic shuttling of hnRNPA1. Besides, we found that hnRNPA1 interacted with the viral phosphoprotein (P) via its glycine-rich domain, but not with the viral nucleoprotein (N) or large protein (L). The hnRNPA1-P interaction competitively disrupted the viral P-N interaction. Moreover, we found that overexpression of hnRNPA1 enhanced the polyubiquitination of the P protein and degraded it through proteasomal and lysosomal pathways. This study will help understanding the function of hnRNPA1 in the replication of single-stranded negative-sense RNA viruses and providing a novel antiviral target against fish rhabdoviruses.

m6A-modification of cyclin D1 and c-myc IRESs in glioblastoma controls ITAF activity and resistance to mTOR inhibition.

A major mechanism conferring resistance to mTOR inhibitors is activation of a salvage pathway stimulating internal ribosome entry site (IRES)-mediated mRNA translation, driving the synthesis of proteins promoting resistance of glioblastoma (GBM). Previously, we found this pathway is stimulated by the requisite IRES-trans-acting factor (ITAF) hnRNP A1, which itself is subject to phosphorylation and methylation events regulating cyclin D1 and c-myc IRES activity. Here we describe the requirement for m6A-modification of IRES RNAs for efficient translation and resistance to mTOR inhibition. DRACH-motifs within these IRES RNAs upon m6A modification resulted in enhanced IRES activity via increased hnRNP A1-binding following mTOR inhibitor exposure. Inhibitor exposure stimulated the expression of m6A-methylosome components resulting in increased activity in GBM. Silencing of METTL3-14 complexes reduced IRES activity upon inhibitor exposure and sensitized resistant GBM lines. YTHDF3 associates with m6A-modified cyclin D1 or c-myc IRESs, regulating IRES activity, and mTOR inhibitor sensitivity in vitro and in xenograft experiments. YTHDF3 interacted directly with hnRNP A1 and together stimulated hnRNP A1-dependent nucleic acid strand annealing activity. These data demonstrate that m6A-methylation of IRES RNAs regulate GBM responses to this class of inhibitors.

ß-Hydroxybutyrate alleviates cartilage senescence through hnRNP A1-mediated up-regulation of PTEN.

Senescence chondrocytes play an important role in Osteoarthritis (OA) progression. However, alleviating OA progression through senescent chondrocyte intervention still faces great challenges. ß-Hydroxybutyrate (BHB) exhibits anti-senescence effects in a variety of age-related dis-eases, but its role in osteoarthritis remains poorly understood. To explore the molecular mechanisms, gene sequencing was used to identify critical genes and potential cellular signaling pathways and male SD rats were used to generate an osteoarthritis model. Results showed that BHB attenuated the senescence of Osteoarthritis chondrocytes (OA-Chos) and alleviated OA progression. Gene ontology (GO) enrichment analysis revealed significant changes in cell cycle genes, with PTEN being the most significant differentially expressed gene. BHB up-regulated the expression of PTEN in OA-Chos, thereby alleviating chondrocyte senescence. Furthermore, BHB facilitated the expression of PTEN by binding to hnRNP A1 and inhibiting the phosphorylation of Akt. This study provided evidence that BHB mitigated chondrocyte senescence and delayed OA, and could thus be used as a novel therapeutic approach for osteoarthritis treatment.

Role of Heterogeneous Nuclear Ribonucleoproteins in the Cancer-Immune Landscape.

Cancer remains the second leading cause of death, accounting for approximately 20% of all fatalities. Evolving cancer cells and a dysregulated immune system create complex tumor environments that fuel tumor growth, metastasis, and resistance. Over the past decades, significant progress in deciphering cancer cell behavior and recognizing the immune system as a hallmark of tumorigenesis has been achieved. However, the underlying mechanisms controlling the evolving cancer-immune landscape remain mostly unexplored. Heterogeneous nuclear ribonuclear proteins (hnRNP), a highly conserved family of RNA-binding proteins, have vital roles in critical cellular processes, including transcription, post-transcriptional modifications, and translation. Dysregulation of hnRNP is a critical contributor to cancer development and resistance. HnRNP contribute to the diversity of tumor and immune-associated aberrant proteomes by controlling alternative splicing and translation. They can also promote cancer-associated gene expression by regulating transcription factors, binding to DNA directly, or promoting chromatin remodeling. HnRNP are emerging as newly recognized mRNA readers. Here, we review the roles of hnRNP as regulators of the cancer-immune landscape. Dissecting the molecular functions of hnRNP will provide a better understanding of cancer-immune biology and will impact the development of new approaches to control and treat cancer.

A splicing silencer in SMN2 intron 6 is critical in spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a fatal neuromuscular disease caused by homozygous deletions or mutations of the SMN1 gene. SMN2 is a paralogous gene of SMN1 and a modifying gene of SMA. A better understanding of how SMN2 exon 7 splicing is regulated helps discover new therapeutic targets for SMA therapy. Based on an antisense walk method to map exonic and intronic splicing silencers (ESSs and ISSs) in SMN2 exon 7 and the proximal regions of its flanking introns, we identified one ISS (ISS6-KH) at upstream of the branch point site in intron 6. By using mutagenesis-coupled RT-PCR with SMN1/2 minigenes, immunochromatography, overexpression and siRNA-knockdown, we found this ISS consists of a bipartite hnRNP A1 binding cis-element and a poly-U sequence located between the proximal hnRNP A1 binding site (UAGCUA) and the branch site. Both HuR and hnRNP C1 proteins promote exon 7 skipping through the poly-U stretch. Mutations or deletions of these motifs lead to efficient SMN2 exon 7 inclusion comparable to SMN1 gene. Furthermore, we identified an optimal antisense oligonucleotide that binds the intron six ISS and causes striking exon 7 inclusion in the SMN2 gene in patient fibroblasts and SMA mouse model. Our findings demonstrate that this novel ISS plays an important role in SMN2 exon 7 skipping and highlight a new therapeutic target for SMA therapy.

Structure and function analysis of Sam68 and hnRNP A1 synergy in the exclusion of exon 7 from SMN2 transcripts.

Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by the absence of a functional copy of the Survival of Motor Neuron 1 gene (SMN1). The nearly identical paralog, SMN2, cannot compensate for the loss of SMN1 because exon 7 is aberrantly skipped from most SMN2 transcripts, a process mediated by synergistic activities of Src-associated during mitosis, 68 kDa (Sam68/KHDRBS1) and heterogeneous nuclear ribonucleoprotein (hnRNP) A1. This results in the production of a truncated, nonfunctional protein that is rapidly degraded. Here, we present several crystal structures of Sam68 RNA-binding domain (RBD). Sam68-RBD forms stable symmetric homodimers by antiparallel association of helices α3 from two monomers. However, the details of domain organization and the dimerization interface differ significantly from previously characterized homologs. We demonstrate that Sam68 and hnRNP A1 can simultaneously bind proximal motifs within the central region of SMN2 (ex7). Furthermore, we show that the RNA-binding pockets of the two proteins are close to each other in their heterodimeric complex and identify contact residues using crosslinking-mass spectrometry. We present a model of the ternary Sam68·SMN2 (ex7)·hnRNP A1 complex that reconciles all available information on SMN1/2 splicing. Our findings have important implications for the etiology of SMA and open new avenues for the design of novel therapeutics to treat splicing diseases.

A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.

hnRNP A1 dysfunction in oligodendrocytes contributes to the pathogenesis of multiple sclerosis.

Oligodendrocyte (OL) damage and death are prominent features of multiple sclerosis (MS) pathology, yet mechanisms contributing to OL loss are incompletely understood. Dysfunctional RNA binding proteins (RBPs), hallmarked by nucleocytoplasmic mislocalization and altered expression, have been shown to result in cell loss in neurologic diseases, including in MS. Since we previously observed that the RBP heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was dysfunctional in neurons in MS, we hypothesized that it might also contribute to OL pathology in MS and relevant models. We discovered that hnRNP A1 dysfunction is characteristic of OLs in MS brains. These findings were recapitulated in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, where hnRNP A1 dysfunction was characteristic of OLs, including oligodendrocyte precursor cells and mature OLs in which hnRNP A1 dysfunction correlated with demyelination. We also found that hnRNP A1 dysfunction was induced by IFNγ, indicating that inflammation influences hnRNP A1 function. To fully understand the effects of hnRNP A1 dysfunction on OLs, we performed siRNA knockdown of hnRNP A1, followed by RNA sequencing. RNA sequencing detected over 4000 differentially expressed transcripts revealing alterations to RNA metabolism, cell morphology, and programmed cell death pathways. We confirmed that hnRNP A1 knockdown was detrimental to OLs and induced apoptosis and necroptosis. Together, these data demonstrate a critical role for hnRNP A1 in proper OL functioning and survival and suggest a potential mechanism of OL damage and death in MS that involves hnRNP A1 dysfunction.

Clinical heterogeneity in a family with flail arm syndrome and review of hnRNPA1-related spectrum.

OBJECTIVE: Flail arm syndrome (FAS) is one of the atypical subtypes of amyotrophic lateral sclerosis (ALS). Mutations in hnRNPA1 encoding heterogeneous nuclear ribonucleoprotein (hnRNP) A1 are a rare genetic cause of ALS. Herein, marked clinical heterogeneity of FAS in a pedigree with a known hnRNPA1 variant was described to raise early awareness of the ALS variant. Furtherly, a literature review of the hnRNPA1-related spectrum was made to summarize the clinical and genetic characteristics. METHODS: Detailed clinical evaluation, muscle pathology, and whole-exome sequencing were performed. The sequence and co-segregation of the mutation among the family members were confirmed by Sanger sequencing. RESULTS: The great clinical variability was found in a FAS pedigree. Muscle pathology revealed a cluster distribution of angulated or rounded atrophic fibers, accompanied by significant multi-nucleus aggregation. Immunohistochemical staining showed that mutant hnRNPA1 proteins accumulated in muscle fiber cytoplasm. Exome sequencing identified a documented variant in hnRNPA1 gene c.1018C > T (p.P340S), which co-segregated with disease in the family. Besides, highly phenotypic heterogeneity was also found in other hnRNPA1-related diseases. INTERPRETATION: We described a Chinese pedigree with hnRNPA1-related FAS, which showed significant clinical variability among the intrafamilial members. FAS is a relatively milder variant of ALS, due to the highly heterogeneous clinical spectrum, early observation is of paramount importance. In addition, the highly phenotypic heterogeneity and molecular genetic mechanism of the hnRNPA1-related spectrum are still beyond fully understood. Further, the detailed molecular mechanism underlying the clinical diversity is warranted to be explored.