First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Molecular characterization of a divergent genetic variant of wheat Eqlid mosaic virus from a Texas wheat field.

Investigations conducted during the spring 2020 season to diagnose the associated viral agent of a severe mosaic disease of wheat in a Texas Panhandle field revealed the presence of wheat Eqlid mosaic virus (WEqMV; genus Tritimovirus, family Potyviridae) in the analyzed samples. The complete genome sequences of two WEqMV isolates were determined, and each was found to be 9,634 nucleotides (nt) in length (excluding the polyA tail) and to contain 5' and 3' untranslated regions of 135 nt and 169 nt, respectively, based on rapid amplification of cDNA ends (RACE) assays. Both sequences contained an open reading frame (ORF) of 9,330 nt encoding a polyprotein of 3,109 amino acids (aa). The ORF sequences of the two isolates were 100% identical to each other, but only 74.7% identical to that of the exemplar WEqMV-Iran isolate, with 85.7% aa sequence identity in the encoded polyprotein. The Texas WEqMV isolates also diverged significantly from WEqMV-Iran in the individual proteins at the nt and aa levels. This is the first report of WEqMV in the United States and the first report of this virus outside of Iran, indicating an expansion of its geographical range.

Mitigation of Huanglongbing: Implications of a Biologically Enhanced Nutritional Program on Yield, Pathogen Localization, and Host Gene Expression Profiles.

Huanglongbing (HLB, citrus greening disease), the most destructive disease affecting citrus production, is primarily linked to the gram-negative, insect-vectored, phloem-inhabiting α-proteobacterium 'Candidatus Liberibacter asiaticus' (CLas). With no effective treatment available, management strategies have largely focused on the use of insecticides in addition to the destruction of infected trees, which are environmentally hazardous and cost-prohibitive for growers, respectively. A major limitation to combating HLB is the inability to isolate CLas in axenic culture, which hinders in vitro studies and creates a need for robust in situ CLas detection and visualization methods. The aim of this study was to investigate the efficacy of a nutritional program-based approach for HLB treatment, and to explore the effectiveness of an enhanced immunodetection method to detect CLas-infected tissues. To achieve this, four different biologically enhanced nutritional programs (bENPs; P1, P2, P3, and P4) were tested on CLas-infected citrus trees. Structured illumination microscopy preceded by a modified immunolabeling process and transmission electron microscopy were used to show treatment-dependent reduction of CLas cells in phloem tissues. No sieve pore plugging was seen in the leaves of P2 trees. This was accompanied by an 80% annual increase in fruit number per tree and 1,503 (611 upregulated and 892 downregulated) differentially expressed genes. These included an MLRQ subunit gene, UDP-glucose transferase, and genes associated with the alpha-amino linolenic acid metabolism pathway in P2 trees. Taken together, the results highlight a major role for bENPs as a viable, sustainable, and cost effective option for HLB management.

Identification of a Chromosomal Deletion Mutation and the Dynamics of Two Major Populations of 'Candidatus Liberibacter asiaticus' in Its Hosts.

'Candidatus Liberibacter asiaticus' (Las) is the prominent species of Liberibacter associated with huanglongbing, a devastating disease of citrus worldwide. In this study, we report the identification of an ∼8.3-kb DNA region of the Las genome containing eight putative open reading frames flanked by two inverted repeats, which was not present in the Las str. psy62 genome. Comparisons with other genome sequences established this region as a unique genetic element associated with genome plasticity/instability. Primers specific for both the presence (Las wild type) and absence (Las mutant) of this region were designed to study the population dynamics and host adaptation of the two strains. Las populations with and/or without the wild-type strain were detected and differentiated in >2,300 samples that included psyllids, periwinkle, and several species of citrus. In psyllids, although a mixed population of the wild type and mutant was observed in most samples (88%), the wild-type Las was detected alone at a rate of 11%. In contrast, none of the infected citrus plants were positive for the wild type alone, which harbored either the mutant strain alone (8%) or a mixed population of the mutant and wild type (92%). Furthermore, the dynamics of these two major Las populations varied with different citrus hosts, whereas an in-depth study on grapefruit that did not rapidly succumb to disease revealed that the population of mutant alone increased with time, indicating that the absence of this genetic element is associated with the fitness of Las in planta under the selection pressure of its host.

Survey for Virus Diversity in Common Bean (Phaseolus vulgaris) Fields and the Detection of a Novel Strain of Cowpea polerovirus 1 in Zambia.

The production of common bean (Phaseolus vulgaris L.) is adversely affected by virus-like diseases globally, but little is known about the occurrence, distribution, and diversity of common bean-infecting viruses in Zambia. Consequently, field surveys were conducted during the 2018 season in 128 fields across six provinces of Zambia and 640 common bean leaf tissue samples were collected with (n = 585) or without (n = 55) symptoms. The prevalence of symptomatic fields was 100%, but incidence of symptomatic plants ranged from 32 to 67.5%. Metagenomic analyses of nine composite samples and a single plant sample of interest revealed the occurrence of isolates of Bean common mosaic necrosis virus, Bean common mosaic virus, Cowpea aphid-borne mosaic virus, Peanut mottle virus, Southern bean mosaic virus (SBMV), Cucumber mosaic virus, Phaseolus vulgaris alphaendornavirus 1 (PvEV-1), PvEV-2, Ethiopian tobacco bushy top virus (ETBTV), and a novel strain of Cowpea polerovirus 1 (CPPV1-Pv) of 5,902 nt in length. While CPPV1-Pv was consistently detected in mixed infection with ETBTV and its satellite RNA molecule, based on results of mechanical transmission assays it does not appear to be involved in disease etiology, suggesting that its role may be limited to being a helper virus for the umbravirus. Screening of the survey samples by real-time PCR for the viruses detected by high-throughput sequencing revealed the prevalence of single (65.2% or 417/640) over mixed (1.9% or 12/640) infections in the samples. SBMV was the most frequently detected virus, occurring in ∼29.4% (188/640) of the samples and at a prevalence rate of 58.6% (75/128) across fields. The results showed that diverse virus species are present in Zambian common bean fields and the information will be useful for the management of common bean viral diseases.

Olea europaea geminivirus is present in a germplasm repository and in California and Texas olive (Olea europaea L.) groves.

Olea europaea geminivirus (OEGV) from olive accessions in Italy was characterized recently. OEGV was also detected during routine high-throughput sequencing screening of olive (cv. Leccino) material, and its complete bipartite genome segments were sequenced and shown to be 100% identical to those of the isolate from Italy. Using two pairs of newly designed primers targeting the AV1 and BV1 genes, OEGV was detected in randomly sampled olive trees from the U.S. Department of Agriculture National Clonal Germplasm Repository (USDA-NCGR) (21.4% or 6/28), commercial and residential settings in California (47.6% or 10/21), and an orchard in Texas (60% or 30/50). The cuttings for the USDA-NCGR-positive trees originated from the former Serbia and Montenegro, Spain, Italy, and Greece. Comparative analysis of the directly sequenced gene fragments from randomly selected samples showed that OEGV isolates from the different sources were 100% identical to each other. The results indicate that OEGV spread was likely facilitated by inadvertent movement of contaminated olive germplasm.

Characterization of a New Nepovirus Infecting Grapevine.

In 2012, dormant canes of a proprietary wine grape (Vitis vinifera L.) accession were included in the collection of the University of California-Davis Foundation Plant Services. No virus-like symptoms were elicited when bud chips from propagated own-rooted canes of the accession were graft-inoculated onto a panel of biological indicators. However, chlorotic ringspot symptoms were observed on sap-inoculated Chenopodium amaranticolor Coste & A. Rein and C. quinoa Willd. plants, indicating the presence of a mechanically transmissible virus. Transmission electron microscopy of virus preparations from symptomatic C. quinoa revealed spherical, nonenveloped virions about 27 nm in diameter. Nepovirus-like haplotypes of sequence contigs were detected in both the source grape accession and symptomatic C. quinoa plants via high-throughput sequencing. A novel bipartite nepovirus-like genome was assembled from these contigs, and the termini of each RNA segment were verified by rapid amplification of complementary DNA ends assays. The RNA1 (7,186-nt) of the virus encodes a large polyprotein 1 of 231.1 kDa, and the RNA2 (4,460-nt) encodes a large polyprotein 2 of 148.9 kDa. Each of the polyadenylated RNA segments is flanked by 5'- (RNA1 = 156-nt; RNA2 = 170-nt) and 3'- (RNA1 = 834-nt; RNA2 = 261-nt) untranslated region sequences with >90% identities. Maximum likelihood phylogenetic analyses of the conserved Pro-Pol amino acid sequences revealed the clustering of the new virus within the genus Nepovirus of the family Secoviridae. Considering its biological and molecular characteristics, and based on current taxonomic criteria, we propose that the novel virus, named grapevine nepovirus A, be assigned to the genus Nepovirus.

Complete genome sequence analysis of a genetic variant of grapevine virus L from the grapevine cultivar Blanc du Bois.

The complete genome sequences of two grapevine virus L (GVL) isolates collected from the wine grape cultivar Blanc du Bois (Vitis spp.: 'Florida D 6-148'×'Cardinal') in Texas were determined. The two genome sequences (excluding the polyA tail) were each 7594 nucleotide long and 99.7% identical to each other, but they shared only ~74% identity with those of previously published GVL isolates. Further analysis showed that the two Texas GVL isolates also diverged significantly from previously published isolates of the virus in each of the five ORFs at both the nucleotide and amino acid level, indicating that they represent a new phylogroup of this virus.

A Description of the Possible Etiology of the Cilantro Yellow Blotch Disease.

A virus-like disease characterized by foliar yellow blotch symptoms and resembling those described for cilantro yellow blotch disease in California was observed in a 4.05-ha cilantro (Coriandrum sativum) cv. Santo field in Hidalgo County, Texas during spring 2019. Disease incidence at harvest was estimated at ∼20%, and the affected plants were rendered unmarketable. Foliar systemic chlorosis symptoms were observed on sap-inoculated Nicotiana occidentalis plants (n = 3) using inocula from symptomatic cilantro. Total RNA aliquots from 11 randomly collected leaf tissue samples (symptomatic = 7, asymptomatic = 4) were pooled into a composite cilantro RNA sample which was analyzed by high throughput sequencing (HTS). Analyses of the obtained 15.7 million raw reads (76 nt each) yielded virus-specific contigs that mapped to the genomes of alfalfa mosaic virus (AMV), beet pseudoyellows virus (BPYV), and lettuce chlorosis virus (LCV). Virus-specific primers designed from the HTS-derived sequences were used to screen the samples in two-step RT-PCR assays, resulting in the detection of AMV+BPYV in 3 of 7 symptomatic cilantro samples, AMV+LCV in 4 of 7 symptomatic cilantro samples, and AMV alone in the 4 asymptomatic cilantro and sap-inoculated N. occidentalis samples. The results represent the first reports of the natural infection of cilantro by BPYV and LCV and implicate the mixed infection of a Crinivirus and AMV in cilantro yellow blotch disease.

Distribution of Candidatus Liberibacter asiaticus in Citrus and the Asian Citrus Psyllid in Texas Over a Decade.

Huanglongbing (HLB, citrus greening disease) in the major citrus-producing states of the United States is associated with Candidatus Liberibacter asiaticus (CLas), which is vectored by the Asian citrus psyllid (ACP). Surveys were conducted in Texas from 2007 to 2017 to assess the prevalence and titer of CLas in ACPs and citrus trees. ACP and citrus leaf tissue samples were collected from suspect trees in residential areas and commercial groves (orchards) and assayed for CLas by quantitative PCR. CLas detection in ACPs (2011) preceded that of citrus trees (2012) by several months. Annual incidences of CLas-positive ACPs and leaf tissue followed an exponential growth pattern over the survey period, varying from 0.03 to 28.7% in ACPs and 0.6 to 36.5% in citrus trees. There was a significant and positive relationship between the monthly incidences of CLas-positive ACP and leaf tissue samples. The proportion of HLB detection sites also increased with time, reaching 26 and 40% of commercial groves and residential sites, respectively, by 2017. Seasonal variations were observed in the incidences of CLas-positive ACPs and citrus trees such that significantly more CLas-positive ACPs and trees were recorded during the fall and winter of a given year relative to the hot summer. A temporal analysis of the class distribution of cycle threshold values revealed a trend of increased bacterial accumulation in ACPs and trees over time, with the trend more pronounced for the former than the latter host type. These findings provide a comprehensive insight into the ongoing CLas/HLB epidemic in Texas, with potential lessons for California and other citrus-producing areas where the disease is not yet established.

Incidence, Severity, and Characterization of Phytophthora Foot Rot of Citrus in Texas and Implications for Disease Management.

Phytophthora-induced foot rot, also known as gummosis, is an important disease affecting citrus production worldwide. In Texas, the third-largest citrus-producing state in the United States, limited information is available on the etiology and epidemiology of foot rot in commercial orchards. This study comprises a survey of foot rot incidence and severity in Texas and the characterization of Phytophthora isolates associated with the disease. Surveys in 2015 and 2017 of 30 orchards in the Lower Rio Grande Valley (LRGV) region where commercial citrus production is concentrated in the state revealed that foot rot occurred in 97% of the orchards assessed. Overall, foot rot symptoms were observed on 33.7% of the trees evaluated and the disease severity index in the region was rated at 14.2 and 16.5% in 2015 and 2017, respectively. Lesions were mostly present on the scion, while the rootstock (sour orange) was not affected. Phytophthora nicotianae was the only Phytophthora sp. isolated from the surveyed orchards and from five additional residential sites on the Texas Coastal Bend (TCB). Sporangia and chlamydospores from 34 representative LRGV isolates of P. nicotianae were larger than those of TCB isolates. In both LRGV and TCB, A1 and A2 mating types were present in the same location, albeit the A2 mating type was more prevalent. All isolates were sensitive to mefenoxam (50% inhibition in the presence of mefenoxam [EC50] < 0.5 µg/ml), except for one TCB isolate (EC50 = 143.6 µg/ml). Our research indicates that treatment for Phytophthora foot rot in the region is necessary and, although mefenoxam is still useful, alternating chemistries for resistance management are required.

Identification and genomic characterization of grapevine Kizil Sapak virus, a novel grapevine-infecting member of the family Betaflexiviridae.

A novel virus with a (+) single-stranded RNA genome was detected by high-throughput sequencing (HTS) in a sample of grapevine (Vitis vinifera) cv. Kizil Sapak (sample/isolate 127) that originated from Turkmenistan. The complete genome of the virus, tentatively named "grapevine Kizil Sapak virus" (GKSV), is 7,604 nucleotides in length, excluding the poly(A) tail. The genome organization of GKSV, encoded genes, and sequence domains are typical for members of the family Betaflexiviridae, specifically those belonging to the subfamily Trivirinae. Phylogenetic analysis placed GKSV within the subfamily Trivirinae, in the same clade as fig latent virus 1 (FLV-1) but distinct from the clades formed by members of other genera. A comparative analysis of GKSV-127 with the HTS-derived sequences obtained from two additional isolates showed that they are genetic variants of the same virus species. Based on current ICTV species and genus demarcation criteria, and the results of the sequence and phylogenetic analyses, we propose that GKSV and FLV-1 represent a new genus within the subfamily Trivirinae.

Grapevine virus M, a novel vitivirus discovered in the American hybrid bunch grape cultivar Blanc du Bois in Texas.

A novel ssRNA (+) virus with molecular properties typical of members of the genus Vitivirus (family Betaflexiviridae; subfamily Trivirinae) was discovered by high-throughput sequencing in samples of the American hybrid bunch grape cultivar Blanc du Bois in Texas. The results were independently confirmed by Sanger sequencing of the virus isolate, whose genome length is 7,387 nt, excluding the polyA tail. The genome sequence contains five ORFs that are homologous and phylogenetically related to ORFs of grapevine-infecting vitiviruses. The name "grapevine virus M" is proposed for this new virus, whose sequence divergence exceeds the current ICTV species demarcation threshold for the genus Vitivirus.

Prevalence and Genome Characterization of Field Isolates of Sugarcane Mosaic Virus (SCMV) in Nigeria.

Maize and sugarcane are two economically important crops often grown in adjacent fields or co-cultivated in the northern guinea savannah agroecological zone, a major cereal production region of Nigeria. This study was conducted to determine the prevalence of mosaic disease in sugarcane and maize fields in the northern guinea savannah agroecological zone and to molecularly characterize the associated sugarcane mosaic virus (SCMV, genus Potyvirus) isolates. Surveys were conducted from June to July 2015, and sugarcane mosaic disease (SCMD) incidence was assessed across 21 farmer's fields. Mean SCMD incidence varied across states with ∼82% (308/376), ∼66% (143/218), and ∼67% (36/54) recorded in Kaduna, Kano, and Katsina states, respectively. RT-PCR analysis of 415 field-collected samples using genus-specific primers confirmed potyvirus infection in 63.7% (156/245) of sugarcane, 29.7% (42/141) of maize crops, and 45% (13/29) of itch grass samples. Cloning and sequencing of gene-specific DNA amplicons from a subset of 45 samples (sugarcane = 33, maize = 9, itch grass = 3) confirmed their specificities to SCMV. Phylogenetic analysis of the partial gene sequences showed that they all belong to a single monophyletic clade of SCMV. These results were supported by analysis of complete polyprotein sequences of representative maize and sugarcane isolates from Nigeria. Both isolates shared 94.9%/97.3% complete polyprotein nucleotide (nt)/amino acid (aa) identities with each other and 75.2%/97.6% nt/aa identities with corresponding sequences of global SCMV isolates. The detection of identical populations of SCMV isolates in both crop species and a weed host suggests possible vector mediated interspecies spread within cereal landscapes in the study area with implications for the integrated and sustainable management of SCMD in cereal cropping systems in Nigeria.

Prunus geminivirus A: A Novel Grablovirus Infecting Prunus spp.

Increased use of metagenomics for routine virus diagnosis has led to the characterization of several genus level geminiviruses from tree fruit long thought to exclusively host RNA viruses. In this study, the identification and molecular characterization of a novel geminivirus is reported for the first time in Prunus spp. The virus, provisionally named Prunus geminivirus A (PrGVA), was identified by Illumina sequencing from an asymptomatic plum tree. PrGVA was subsequently confirmed by rolling cycle amplification, cloning, and Sanger sequencing of its complete genome (3,174 to 3,176 nucleotides) from an additional 18 (9 apricot and 9 plum) field isolates. Apart from the nonanucleotide motif TAATATT↓AC present in its virion strand origin of replication, other conserved motifs of PrGVA support its geminiviral origin. PrGVA shared highest complete genome (73 to 74%), coat protein amino acid (83 to 85%) and rep-associated amino acid (74%) identities with Grapevine red blotch virus (GRBV). PrGVA was graft but not mechanically transmissible. Quantitative polymerase chain reaction screening of Prunus spp. in the National Clonal Germplasm Repository collection using newly designed primers and probes revealed 69.4% (apricot), 55.8% (plum), and 8.3% (cherry) incidences of PrGVA. PrGVA is proposed as a novel member of the genus Grablovirus based on its close genome and phylogenetic relationship with GRBV.

Cassava Brown Streak Disease and Ugandan cassava brown streak virus Reported for the First Time in Zambia.

A diagnostic survey was conducted in July 2017 in two northern districts of Zambia to investigate presence or absence of cassava brown streak disease (CBSD) and its causal viruses. In total, 29 cassava fields were surveyed and cassava leaf samples were collected from 116 plants (92 symptomatic and 24 nonsymptomatic). CBSD prevalence was approximately 79% (23 of 29) across fields. Mean CBSD incidence varied across fields but averaged 32.3% while mean disease severity was 2.3 on a 1-to-5 rating scale. Reverse-transcription polymerase chain reaction screening of all 116 samples with one generic and two species-specific primer pairs yielded DNA bands of the expected sizes from all symptomatic plants with the generic (785 bp) and Ugandan cassava brown streak virus (UCBSV)-specific (440 bp) primers. All 24 nonsymptomatic samples were negative for UCBSV and all samples tested negative with primers targeting Cassava brown streak virus. The complete genome of a representative isolate of UCBSV (WP282) was determined to be 9,050 nucleotides in length, minus the poly A tail. A comparative analysis of this isolate with global virus isolates revealed its nature as a sequence variant of UCBSV sharing 94 and 96% maximum complete polyprotein nucleotide and amino acid identities, respectively, with isolates from Malawi (MF379362) and Tanzania (FJ039520). This is the first report of CBSD and UCBSV in Zambia, thus expanding the geographical distribution of the disease and its causal virus and further reinforcing the need to strengthen national and regional phytosanitary programs in Africa.

Identification and molecular characterization of a novel sugarcane streak mastrevirus and an isolate of the A-strain of maize streak virus from sugarcane in Nigeria.

Sugarcane and maize plants showing symptoms typical of those described for the so-called "African streak viruses" (AfSVs) were encountered during field surveys conducted from February to July 2015 to document viruses infecting both crops across the northern Guinea savannah region of Nigeria. As part of this study, two categories of complete mastrevirus-like genome sequences were obtained from nine samples (maize = 2; sugarcane = 7). In pairwise comparisons, the full-length genomes of the first sequence category (2,687 nt each; maize = 2; sugarcane = 2) shared 96 to 99% identity with global isolates of the A-strain of maize streak virus (MSV-A), indicating that sugarcane may also serve as a reservoir host to MSV-A. Analysis of the complete genomes belonging to the second sequence category (2,757 nt each; sugarcane = 5) showed that they shared 42 to 67% identity with their closest AfSV relatives, thus indicating that they represent sequences of a novel mastrevirus. Both sequence categories shared 61-62% sequence identity with each other. Further analysis revealed that the novel sugarcane-infecting virus, tentatively named as sugarcane chlorotic streak virus (SCSV), arose from a putative interspecific recombination event involving two grass-infecting mastreviruses, eragrostis streak virus and urochloa streak virus, as putative parental sequences. The results of this study add to the repertoire of diverse AfSVs present in cereal and sugarcane mixed cropping landscapes in the northern Guinea savannah region of Nigeria, with implications for disease epidemiology.

Description of a Novel Monopartite Geminivirus and Its Defective Subviral Genome in Grapevine.

A novel virus was detected in grapevines by Illumina sequencing during the screening of two table grape (Vitis vinifera) accessions, cultivars Black Beet and Nagano Purple, from South Korea. The monopartite circular ssDNA genome sequence was subsequently confirmed by rolling cycle amplification, cloning and Sanger sequencing. The complete viral genomic sequence from both accessions ranged from 2,903 to 2,907 nucleotides in length and contained the conserved nonanucleotide sequence TAATATT↓AC and other sequence features typical of the family Geminiviridae, including two predicted sense and four complementary-sense open reading frames. Phylogenetic analysis placed the novel virus in a unique taxon within the family Geminiviridae. A naturally occurring defective subviral DNA was also discovered. This defective DNA molecule carried a deletion of approximately 46% of the full-length genome. Both the genomic and defective DNA molecules were graft-transmissible although no disease is yet correlated with their occurrence in Vitis spp. The tentative names Grapevine geminivirus A (GGVA) and GGVA defective DNA (GGVA D-DNA) are proposed. PCR assays developed using primers designed in the coat protein gene led to the detection of GGVA in 1.74% of 1,262 vines derived from 15 grapevine cultivars from six countries across three continents.