Ratiometric Fluorescence Aptasensor of Allergen Protein Based on Multivalent Aptamer-Encoded DNA Flowers as Fluorescence Resonance Energy Transfer Platform.

Life-threatening allergic reactions to food allergens, particularly peanut protein Ara h1, are a growing public health concern affecting millions of people worldwide. Thus, accurate and rapid detection is necessary for allergen labeling and dietary guidance and ultimately preventing allergic incidents. Herein, we present a novel ratiometric fluorescence aptasensor based on multivalent aptamer-encoded DNA flowers (Mul-DNFs) for the high-stability and sensitive detection of allergen Ara h1. The flower-shaped Mul-DNFs were spontaneously packaged using ultralong polymeric DNA amplicons driven by a rolling circle amplification reaction, which contains a large number of Ara h1 specific recognition units and has excellent binding properties. Furthermore, dual-color fluorescence-labeled Mul-DNFs probes were developed by hybridizing them with Cy3- and Cy5-labeled complementary DNA (cDNA) to serve as a ratiometric fluorescence aptasensor platform based on fluorescence resonance energy transfer. Benefiting from the combined merits of the extraordinary synergistic multivalent binding ability of Mul-DNFs, the excellent specificity of the aptamer, and the sensitivity of the ratiometric sensor to avoid exogenous interference. The developed ratiometric aptasensor showed excellent linearity (0.05-2000 ng mL-1) with a limit of detection of 0.02 ng mL-1. Additionally, the developed ratiometric fluorescence aptasensor was utilized for quantifying the presence of Ara h1 in milk, infant milk powder, cookies, bread, and chocolate with recoveries of 95.7-106.3%. The proposed ratiometric aptasensor is expected to be a prospective universal aptasensor platform for the rapid, sensitive, and accurate determination of food and environmental hazards.

A novel ternary Y-DNA walker amplification strategy designed fluorescence aptasensor based on Au@SiO2@Fe3O4 nanomaterials for ochratoxin A detection.

A novel ternary Y-DNA walker amplification strategy designed fluorescence aptasensor based on Au@SiO2@Fe3O4 nanomaterials for ultrasensitive and specific ochratoxin A detection in food samples is presented. Au@SiO2@Fe3O4 nanomaterials provide the loading platform as well as separation and recovery properties for the ternary Y-DNA walker. The ternary Y-DNA walker is designed to be driven by Nb.BbvCI cleaving a large number of FAM probes to achieve signal amplification. Since Ochratoxin A (OTA) can bind to the constituent aptamer in the ternary Y-DNA walker, adding OTA will destroy the structure of the ternary Y-DNA walker, thereby inhibiting the driving process of the walker. After optimization of various parameters, a standard curve was obtained from 100 to 0.05 ng·mL-1 of OTA with the limit of determination of 0.027 ng·mL-1. The spiked recovery of peanut samples by this method was 82.00-93.30%, and the aptasensor showed excellent specificity and long-term stability. This simple, robust, and scalable oligonucleotide chain-based ternary Y-DNA walker can provide a general signal amplification strategy for trace analysis.

Advances in riboswitch-based biosensor as food samples detection tool.

Food safety has always been a hot issue of social concern, and biosensing has been widely used in the field of food safety detection. Compared with traditional aptamer-based biosensors, aptamer-based riboswitch biosensing represents higher precision and programmability. A riboswitch is an elegant example of controlling gene expression, where the target is coupled to the aptamer domain, resulting in a conformational change in the downstream expression domain and determining the signal output. Riboswitch-based biosensing can be extensively applied to the portable real-time detection of food samples. The numerous key features of riboswitch-based biosensing emphasize their sustainability, renewable, and testing, which promises to transform engineering applications in the field of food safety. This review covers recent developments in riboswitch-based biosensors. The brief history, definition, and modular design (regulatory mode, reporter, and expression platform) of riboswitch-based biosensors are explained for better insight into the design and construction. We summarize recent advances in various riboswitch-based biosensors involving theophylline, malachite green, tetracycline, neomycin, fluoride, thrombin, naringenin, ciprofloxacin, and paromomycin, aiming to provide general guidance for the design of riboswitch-based biosensors. Finally, the challenges and prospects are also summarized as a way forward stratagem and signs of progress.

Aptamer based voltammetric patulin assay based on the use of ZnO nanorods.

The authors describe an aptamer based assay for the mycotoxin patulin (PAT). A gold electrode was modified with a composite made from ZnO nanorods (ZnO-NRs) and chitosan. The ZnO-NRs was prepared by reaction with ammonia and subsequent hydrothermal growth. Its properties were characterized by X-ray diffraction, Raman spectroscopy and scanning electron microscopy. Subsequently, thiol-modified aptamers were self-assembled on AuNPs that had been electrodeposited on the surface of the modified electrode. The presence of ZnO-NRs on the electrode increases the loading with AuNPs and aptamers. It also warrants a relatively stable microenvironment for the aptamers. In the presence of PAT, it will form a complex with the aptamer on the electrode surface. This hinders electron transfer from the electrode to the redox probe hexacyanoferrate and results in reduced current, which is typically measured at 0.176 V (vs. Ag/AgCl). The concentration of PAT can be calculated from the differences in the peak current before and after incubation with PAT. The assay has a linear response in the 50 ng·mL-1 to 0.5 pg·mL-1 PAT concentration range and a 0.27 pg·mL-1 lower detection limit. The sensor is specific, reproducible, repeatable, and long-term stable. It was successfully applied to the determination of PAT in spiked juice samples. Graphical abstract Schematic representation of aptamer based detection of patulin (PAT). It is based on the fact that ZnO nanorods on the surface of the electrode increase the loading of the gold nanoparticles and the aptamers, thereby improving the electrode performance.

Dual pH- and ATP-Responsive Antibacterial Nanospray: On-Demand Release of Antibacterial Factors, Imaging Monitoring, and Accelerated Healing of Bacteria-Infected Wounds under NIR Activation.

The prevalence of pathogenic bacterial infections with high morbidity and mortality poses a widespread challenge to the healthcare system. Therefore, it is imperative to develop nanoformulations capable of adaptively releasing antimicrobial factors and demonstrating multimodal synergistic antimicrobial activity. Herein, an NIR-activated multifunctional synergistic antimicrobial nanospray MXene/ZIF-90@ICG was prepared by incorporating ZIF-90@ICG nanoparticles onto MXene-NH2 nanosheets. MXene/ZIF-90@ICG can on-demand release the antimicrobial factors MXenes, ICG, and Zn2+ in response to variations in pH and ATP levels within the bacterial infection microenvironment. Under NIR radiation, the combination of MXenes, Zn2+, and ICG generated a significant amount of ROS and elevated heat, thereby enhancing the antimicrobial efficacy of PDT and PTT. Meanwhile, NIR excitation could accelerate the further release of ICG and Zn2+, realizing the multimodal synergistic antibacterial effect of PDT/PTT/Zn2+. Notably, introducing MXenes improved the dispersion of the synthesized antimicrobial nanoparticles in aqueous solution, rendering MXene/ZIF-90@ICG a candidate for application as a nanospray. Importantly, MXene/ZIF-90@ICG demonstrated antimicrobial activity and accelerated wound healing in the constructed in vivo subcutaneous Staphylococcus aureus infection model with NIR activation, maintaining a favorable biosafety level. Therefore, MXene/ZIF-90@ICG holds promise as an innovative nanospray for adaptive multimodal synergistic and efficient antibacterial applications with NIR activation.

Aptamer-modified paper-based analytical devices for the detection of food hazards: Emerging applications and future perspective.

Food analysis plays a critical role in assessing human health risks and monitoring food quality and safety. Currently, there is a pressing need for a reliable, portable, and quick recognition element for point-of-care testing (POCT) to better serve the demands of on-site food analysis. Aptamer-modified paper-based analytical devices (Apt-PADs) have excellent characteristics of high portability, high sensitivity, high specificity, and on-site detection, which have been widely used and concerned in the field of food safety. The article reviews the basic components and working principles of Apt-PADs, and introduces their representative applications detecting food hazards. Finally, the advantages, challenges, and future directions of Apt-PADs-based sensing performance are discussed, to provide new directions and insights for researchers to select appropriate Apt-PADs according to specific applications.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

Universal Near-Infrared Fluorescent Nanoprobes for Detection and Real-Time Imaging of ATP in Real Food Samples, Living Cells, and Bacteria.

Adenosine triphosphate (ATP), an essential metabolite for active microorganisms to maintain life activities, has been widely regarded as a marker of cell activity and an indicator of microbial contamination. Herein, we designed two near-infrared (NIR) fluorescent nanoprobes named CYA@ZIF-90 and CYQ@ZIF-90 by encapsulating the NIR dye CYA/CYQ in ZIF-90 for the rapid detection of ATP. Between them, nanoprobe CYA@ZIF-90 can achieve higher NIR emission (702 nm) and rapid detection (2 min). Based on the superior spatiotemporal resolution imaging of ATP fluctuations in living cells, the applicability of CYA@ZIF-90 for imaging and detection of ATP in living bacteria was explored for the first time. The nanoprobe indirectly realizes the quantitative detection of bacteria, and the detection limit can be as low as 74 CFU mL-1. Therefore, the prepared nanoprobe is expected to become a universal ATP sensing detection tool, which can be further applied to evaluate cell apoptosis, cell proliferation, and food-harmful microbial control.

Colorimetric aptasensor for fumonisin B1 detection based on the DNA tetrahedra-functionalized magnetic beads and DNA hydrogel-coated bimetallic MOFzyme.

The toxicity and incidence of fumonisin B1 (FB1) pose a major challenge to public health and the environment, prompting the development of alternative quantitative strategies for FB1. Herein, a colorimetric aptasensor was constructed based on DNA tetrahedra-functionalized magnetic beads (MBs) and DNA hydrogel-coated Mn-Zr bimetallic metal-organic frameworks-based nanozyme (MOFzyme). Initially, MBs functionalized by DNA tetrahedra demonstrated excellent capturing capability for FB1. Along with the capture of FB1, catalyst DNA (C) was released into the supernatant. Aided by fuel DNA (F), C can trigger continuous cleavage of the main chains and cross-linking points of the DNA hydrogel through an entropy-driven DNA circuit integrated into the hydrogel coating. Subsequently, the bimetallic MOFzyme encapsulated inside the DNA hydrogel was exposed and exerted its superb peroxidase-like activity, producing a colorimetric signal whose intensity was positively dependent on the amount of FB1. The developed aptasensor exhibited good linearity in the range of 5 × 10-4 to 50 ng mL-1 with a limit of detection (LOD) of 0.38 pg mL-1, and reasonable specificity in different matrices. Furthermore, the aptasensor was successfully applied to quantify FB1 in actual samples with recoveries fell within 92.25 %- 108.00 %, showing its great potential in environmental monitoring and food safety.

A novel biomimetic network amplification strategy designed fluorescent aptasensor based on yolk-shell Fe3O4 nanomaterials for aflatoxin B1 detection.

In this study, yolk-shell Fe3O4-based nanomaterials designing of fluorescent aptasensor using a new type of biomimetic network-constitutional dynamic networks (CDNs) amplification strategy was developed for aflatoxin B1 (AFB1) detection. By ingeniously designing the base sequences A, a, B, b, and coupling with endonuclease (BbvCI), a constitutes of CDNs is formed as a fluorescence intensity amplifier. With such design, the as- prepared aptasensor exhibits good sensitivity from 50 fg·mL-1-50 ng·mL-1 with a detection limit of 35.94 fg·mL-1. Moreover, the CDNs can achieve 1000-fold amplification in terms of linear range and detection limit. The results confirmed that this new type of biomimetic network amplification strategy can supply-one efficient approach to improve signal amplification. Furthermore, the prepared aptamer sensor was tested for spiked recovery in peanut samples, and the recoveries ranged from 83.79 to 95.06 %, which has confirmed its practical application value in the field of food safety.

Broad-Spectrum Detection of Tetracyclines by Riboswitch-Based Cell-Free Expression Biosensing.

We describe a sensitive and selective method for the determination of tetracycline content in foods using a riboswitch sensor. The sensor is based on a cell-free expression system that can be lyophilized to produce paper-based sensors or tube-based sensors for long-term storage. The riboswitch constructed using artificially screened tetracycline RNA aptamers was cloned into the pET-28a(+) vector of Escherichia coli TOP 10. The expression of the green fluorescent protein was positively correlated with the concentration of tetracyclines. The binding of tetracyclines to the aptamer domain results in a conformational change in the riboswitch secondary structure, resulting in the exposure of the ribosome binding site thereby promoting expression. The detection limits of the prepared sensor for the detection of tetracycline, oxytetracycline, chlortetracycline, and doxycycline were 0.47, 0.079, 0.084, and 0.43 µM, respectively. Moreover, the 1 µM tetracyclines allow for qualitative detection in milk samples by the naked eye. The work provides a proof-of-principle for riboswitch design to address global health and food safety.

Concatenated dynamic DNA network modulated SERS aptasensor based on gold-magnetic nanochains and Au@Ag nanoparticles for enzyme-free amplification analysis of tetracycline.

Tetracycline (TC) poses a great threat to food and environmental safety due to its misuse in animal husbandry and aquaculture. Therefore, an efficient analytical method is needed for the detection of TC to prevent possible hazards. Herein, a cascade amplification SERS aptasensor for sensitive determination of TC was constructed based on aptamer, enzyme-free DNA circuits, and SERS technology. The capture probe and signal probe were obtained by binding DNA hairpins H1 and H2 to the prepared Fe3O4@hollow-TiO2/Au nanochains (Fe3O4@h-TiO2/Au NCs) and Au@4-MBA@Ag nanoparticles, respectively. The dual amplification of EDC-CHA circuits significantly facilitated the sensitivity of the aptasensor. Additionally, the introduction of Fe3O4 simplified the operation of the sensing platform due to its superb magnetic capability. Under optimal conditions, the developed aptasensor exhibited a distinct linear response to TC with a low limit of detection of 15.91 pg mL-1. Furthermore, the proposed cascaded amplification sensing strategy exhibited excellent specificity and storage stability, and its practicability and reliability were verified by TC detection of real samples. This study provides a promising idea for the development of specific and sensitive signal amplification analysis platforms in the field of food safety.

Colorimetric aptasensor targeting zearalenone developed based on the hyaluronic Acid-DNA hydrogel and bimetallic MOFzyme.

Zearalenone (ZEN) is a widespread nonsteroidal mycotoxin with estrogen-like activity. Sensitive and reliable quantification of ZEN in food is critical to ensure food safety and safeguard agricultural production. Herein, by combining the metal-organic frameworks-based nanozyme (MOFzyme) and hyaluronic acid (HA)-DNA hydrogel, a well-designed colorimetric aptasensor was developed. The HA-DNA hydrogel was deposited on the surface of the bimetallic MOFzyme via strand-induced hybridization chain reaction (HCR). Relying on the ZEN-specific aptamer integrated in hydrogel structure, the disintegration of the hydrogel network and the concomitant exposure of the encapsulated MOFzyme could be specifically triggered by the introduction of ZEN molecules. Moreover, the magnitude of hydrogel disintegration was positively correlated with the amount of ZEN, by which the quantification of ZEN can be effortlessly achieved. Benefiting from the delicate design, the satisfactory catalytic performance and stability of bimetallic MOFzyme and the appealing stimuli-responsiveness of DNA hydrogel, the developed aptasensor demonstrated superior analytical performance and ease of use. Under optimal conditions, the linear range of the aptasensor fell between 0.001 and 200 ng mL-1 with a limit of detection (LOD) of 0.8 pg mL-1. Furthermore, the aptasensor was successfully applied for the quantitative detection of ZEN in corn and soybean samples with recoveries ranging from 94.0% to 109.0%. The developed aptasensor is expected to be a prospective universal platform for accurately quantifying food or environmental hazards.

Split aptamer remodeling-initiated target-self-service 3D-DNA walker for ultrasensitive detection of 17ß-estradiol.

DNA walker machines, as one of the dynamic DNA nanodevices, have attracted extensive interest in the field of analysis due to their inherent superiority. Herein, we reported a split aptamer remodeling-initiated target-self-service 3D-DNA walker for ultrasensitive, specific, and high-signal-background ratio determination of 17ß-estradiol (E2) in food samples. Two split probes (STWS-a and STWS-b) were rationally designed that can undergo structural reassembled to serve as walking strands (STWS) under the induction of the target. Meanwhile, an intact E6-DNAzyme region was formed and activated at the tail of STWS. The activated E6-DNAzyme then continuously drives the 3D-DNA walker for signal amplification and specific detection of E2. Under optimal conditions, the proposed DNA walker-based biosensor exhibited excellent linearity in the range of 1 pM to 50 nM with a low limit of detection (LOD) of 0.28 pM, and good precision (2.7%) for 11 replicate determinations of 1 nM of E2. Furthermore, the developed DNA walker-based biosensor achieved excellent sensitive analysis of E2 in the complex food matrix with recoveries of 95.6-106.5%. This newly proposed split aptamer-based strategy has the advantages of ultrasensitive, high signal-to-background ratio, and high stability. Noteworthy, the successful operation of the DNA walker initiated by the split aptamer expands the principles of DNA walker design and provides a universal signal amplification platform for trace analysis.

Strategies to manipulate the performance of aptamers in SELEX, post-SELEX and microenvironment.

Aptamers are short single-stranded DNA or RNA oligonucleotides isolated from randomized libraries, presenting high affinity and specificity toward targets with similar to antibodies. Recently, aptamers have demonstrated their outstanding application potential ranging from biosensors, bioimaging, and therapeutics due to various advantages including low immunogenicity, ease of large-scale synthesis, low batch-to-batch variation, easily chemical modification, and programmability. However, the current overall success rate of aptamer is far from being satisfactory, and still needs to overwhelm the major obstacle in affinity, specificity, and stability for practical application. The efficient strategy of manipulating the binding performance of aptamers, and improving their performance in practical application is of great significance. Herein, we review the challenges and advances in manipulating the binding performance (e.g., affinity, specificity, and stability) of aptamers to obtain high-quality aptamers by comprehensive analyzing their structure and properties. This mainly includes interfering with the SELEX protocol to obtain excellent parental aptamers, engineering aptamers in post-SELEX process and matching the optimal working microenvironment. Moreover, the perspectives of future direction are also summarized. We hope to provide researchers with alternative strategies for enhancing the performance of aptamers in practical applications and promoting the explosive development of aptamers in related fields.

Aptamer-based thin film gold electrode modified with gold nanoparticles and carboxylated multi-walled carbon nanotubes for detecting oxytetracycline in chicken samples.

In this work, a disposable and portable aptasensor for the fast and sensitive detection of oxytetracycline (OTC) using gold nanoparticles (AuNPs)/carboxylated multi-walled carbon nanotubes (cMWCNTs)@thionine connecting complementary strand of aptamer (cDNA) as signal tags was constructed. The substrate electrode of the aptasensor was thin film gold electrode (TFGE), which have the advantages of portable and uniform performance. In the presence of OTC, OTC competed with cDNA to combine with aptamer. The bioconjugate (AuNPs/cMWCNTs/cDNA@thionine) was released from the TFGE. Thus, the electrochemical signal declined. Under optimized conditions, the aptasensor exhibited good stability, high selectivity and high sensitivity. Furthermore, the developed electrochemical aptamer-based TFGE had a wide dynamic range of 1 × 10-13-1 × 10-5 g mL-1 for target OTC with a low detection limit of 3.1 × 10-14 g mL-1 and was successfully used for the determination of OTC in chicken sample.