Molecular dynamics simulations reveal the hidden EF-hand of EF-SAM as a possible key thermal sensor for STIM1 activation by temperature.

Intracellular calcium signaling is essential for many cellular processes, including store-operated Ca2+ entry (SOCE), which is initiated by stromal interaction molecule 1 (STIM1) detecting endoplasmic reticulum (ER) Ca2+ depletion. STIM1 is also activated by temperature independent of ER Ca2+ depletion. Here we provide evidence, from advanced molecular dynamics simulations, that EF-SAM may act as a true temperature sensor for STIM1, with the prompt and extended unfolding of the hidden EF-hand subdomain (hEF) even at slightly elevated temperatures, exposing a highly conserved hydrophobic Phe108. Our study also suggests an interplay between Ca2+ and temperature sensing, as both, the canonical EF-hand subdomain (cEF) and the hidden EF-hand subdomain (hEF), exhibit much higher thermal stability in the Ca2+-loaded form compared to the Ca2+-free form. The SAM domain, surprisingly, displays high thermal stability compared to the EF-hands and may act as a stabilizer for the latter. We propose a modular architecture for the EF-hand-SAM domain of STIM1 composed of a thermal sensor (hEF), a Ca2+ sensor (cEF), and a stabilizing domain (SAM). Our findings provide important insights into the mechanism of temperature-dependent regulation of STIM1, which has broad implications for understanding the role of temperature in cellular physiology.

Quantifying and Decoupling Molecular Interactions of Ionic Liquids with Gold Electrodes.

This work combined gold colloid probe atomic force microscopy (AFM) with a quartz crystal microbalance (QCM) to accurately quantify the molecular interactions of fluorine-free phosphonium-based ionic liquids (ILs) with gold electrode surfaces. First, the interactions of ILs with the gold electrode per unit area (FA', N/m2) were obtained via the force-distance curves measured by gold probe AFM. Second, a QCM was employed to detect the IL amount to acquire the equilibrium number of IL molecules adsorbed onto the gold electrode per unit area (NIL, Num/m2). Finally, the quantified molecular interactions of ILs with the gold electrode (F0, nN/Num) were estimated. F0 is closely related to the IL composition, in which the IL with the same anion but a longer phosphonium cation exhibits a stronger molecular interaction. The changes in the quantified interactions of gold with different ILs are consistent with the interactions predicted by the extended Derjaguin-Landau-Verwey-Overbeek theory, and the van der Waals interaction was identified as the major contribution of the overall interaction. The quantified molecular interaction is expected to enable the direct experimental-derived interaction parameters for molecular simulations and provide the virtual design of novel ILs for energy storage applications.

Carbon Nanodots from an In Silico Perspective.

Carbon nanodots (CNDs) are the latest and most shining rising stars among photoluminescent (PL) nanomaterials. These carbon-based surface-passivated nanostructures compete with other related PL materials, including traditional semiconductor quantum dots and organic dyes, with a long list of benefits and emerging applications. Advantages of CNDs include tunable inherent optical properties and high photostability, rich possibilities for surface functionalization and doping, dispersibility, low toxicity, and viable synthesis (top-down and bottom-up) from organic materials. CNDs can be applied to biomedicine including imaging and sensing, drug-delivery, photodynamic therapy, photocatalysis but also to energy harvesting in solar cells and as LEDs. More applications are reported continuously, making this already a research field of its own. Understanding of the properties of CNDs requires one to go to the levels of electrons, atoms, molecules, and nanostructures at different scales using modern molecular modeling and to correlate it tightly with experiments. This review highlights different in silico techniques and studies, from quantum chemistry to the mesoscale, with particular reference to carbon nanodots, carbonaceous nanoparticles whose structural and photophysical properties are not fully elucidated. The role of experimental investigation is also presented. Hereby, we hope to encourage the reader to investigate CNDs and to apply virtual chemistry to obtain further insights needed to customize these amazing systems for novel prospective applications.

Diffusion-driven rotation in cholesteric liquid crystals studied using molecular dynamics simulation of a mixture of the Gay-Berne fluid and the Lennard-Jones fluid.

Diffusion-driven rotation in cholesteric liquid crystals has been studied using molecular dynamics simulation. Then a chemical potential gradient parallel to the cholesteric axis induces a torque that rotates the director at a constant rate around this axis, besides driving a mass current. An equimolar mixture of Gay-Berne ellipsoids and Lennard-Jones spheres was used as the molecular model. In order to keep the system homogeneous, the color conductivity algorithm was used to apply a color field instead of a chemical potential gradient to drive a mass current. Then the particles are given a color charge that interacts with a color field in the same way as with an electric field, but these charges do not interact with each other. This algorithm is often used to calculate the mutual diffusion coefficient. In the above liquid crystal model, it was found that the color field induces a torque that rotates the director at a constant rate around the cholesteric axis in addition to driving a mass current. The phenomenon was quantified by calculating the cross-coupling coefficient between the color field and the director angular velocity. The results were cross-checked by using a director rotation algorithm to exert a torque to rotate the director at a constant rate. Besides rotation of the director, this resulted in a mass current parallel to the cholesteric axis. The cross-coupling coefficient between the torque and the mass current was equal to the cross-coupling coefficient between the color field and the director rotation rate within a statistical uncertainty of 10 percent, thus fulfilling the Onsager reciprocity relations. As a further cross-check, these cross-coupling coupling coefficients, the color conductivity, and the twist viscosity were calculated by evaluating the corresponding Green-Kubo relations. Finally, it was noted that the orientation of the cholesteric axis parallel to the color field is the one that minimizes the irreversible energy dissipation rate. This is in accordance with a theorem stating that this quantity is minimal in the linear regime of a nonequilibrium steady state.

Selective Separation of Highly Similar Proteins on Ionic Liquid-Loaded Mesoporous TiO2.

Separating proteins from their mixtures is an important process in a great variety of applications, but it faces difficult challenges as soon as the proteins are simultaneously of similar sizes and carry comparable net charges. To develop both efficient and sustainable strategies for the selective separation of similar proteins and to understand the underlying molecular mechanisms to enable the separation are crucial. In this work, we propose a novel strategy where the cholinium-based amino acid [Cho][Pro] ionic liquid (IL) is used as the trace additive and loaded physically on a mesoporous TiO2 surface for separating two similar proteins (lysozyme and cytochrome c). The observed selective adsorption behavior is explained by the hydration properties of the [Cho][Pro] loaded on the TiO2 surface and their partially dissociated ions under different pH conditions. As the pH is increased from 5.0 to 9.8, the degree of hydration of IL ions also increases, gradually weakening the interaction strength of the proteins with the substrates, more for lysozymes, leading to their effective separation. These findings were further used to guide the detection of the retention behavior of a binary mixture of proteins in high-performance liquid chromatography, where the introduction of ILs did effectively separate the two similar proteins. Our results should further stimulate the use of ILs in the separation of proteins with a high degree of mutual similarity.

Microstructural and Dynamical Heterogeneities in Ionic Liquids.

Ionic liquids (ILs) are a special category of molten salts solely composed of ions with varied molecular symmetry and charge delocalization. The versatility in combining varied cation-anion moieties and in functionalizing ions with different atoms and molecular groups contributes to their peculiar interactions ranging from weak isotropic associations to strong, specific, and anisotropic forces. A delicate interplay among intra- and intermolecular interactions facilitates the formation of heterogeneous microstructures and liquid morphologies, which further contributes to their striking dynamical properties. Microstructural and dynamical heterogeneities of ILs lead to their multifaceted properties described by an inherent designer feature, which makes ILs important candidates for novel solvents, electrolytes, and functional materials in academia and industrial applications. Due to a massive number of combinations of ion pairs with ion species having distinct molecular structures and IL mixtures containing varied molecular solvents, a comprehensive understanding of their hierarchical structural and dynamical quantities is of great significance for a rational selection of ILs with appropriate properties and thereafter advancing their macroscopic functionalities in applications. In this review, we comprehensively trace recent advances in understanding delicate interplay of strong and weak interactions that underpin their complex phase behaviors with a particular emphasis on understanding heterogeneous microstructures and dynamics of ILs in bulk liquids, in mixtures with cosolvents, and in interfacial regions.

Molecular interactions of ionic liquids with SiO2 surfaces determined from colloid probe atomic force microscopy.

Ionic liquids (ILs) interact strongly with many different types of solid surfaces in a wide range of applications, e.g. lubrication, energy storage and conversion, etc. However, due to the nearly immeasurable large number of potential ILs available, identifying the appropriate ILs for specific solid interfaces with desirable properties is a challenge. Theoretical studies are highly useful for effective development of design and applications of these complex molecular systems. However, obtaining reliable force field models and interaction parameters is highly demanding. In this work, we apply a new methodology by deriving the interaction parameters directly from the experimental data, determined by colloid probe atomic force microscopy (CP-AFM). The reliability of the derived interaction parameters is tested by performing molecular dynamics simulations to calculate translational self-diffusion coefficients and comparing them with those obtained from NMR diffusometry.

Molecular Mechanistic Insights into the Ionic-Strength-Controlled Interfacial Behavior of Proteins on a TiO2 Surface.

By adjusting the ionic strengths through changing the concentration of the buffer ions, the molecular force and the interfacial behavior of cytochrome c (Cyt c) and TiO2 are systematically studied. The molecular forces determined by combining the adhesion force and adsorption capacity are found to first increase and then decrease with the increasing ionic strength, with a peak obtained at an ionic strength between 0.8 and 1.0 M. The mechanism is explained based on the dissociation and hydration of ions at the interfaces, where the buffer ions could be completely dissociated at ionic strengths of <0.8 M but were partially associated when the ionic strength increased to a high value (>1.2 M), and the strongest hydration was observed around 1.0 M. The hydrodynamic size and the zeta potential value representing the effective contact area and protein stability of the Cyt c molecule, respectively, are also affected by the hydration and are proportional to the molecular forces. The interfacial behavior of Cyt c molecules on the TiO2 surface, determined through surface-enhanced Raman scattering (SERS), is extremely affected by the ionic strength of the solution as the ion dissociation and hydration also increase the electron transfer ability, where the best SERS enhancement is observed at the ionic strength of around 1.0 M, corresponding to the largest molecular force. Our results provide a detailed understanding at the nanoscale on controlling the protein interfacial behavior with solid surfaces, adjusted by the buffer ions.

Hydrated Ionic Liquids Boost the Trace Detection Capacity of Proteins on TiO2 Support.

Trace detection based on surface-enhanced Raman scattering (SERS) has attracted considerable attention, and exploiting efficient strategies to stretch the limit of detection and understanding the mechanisms on molecular level are of utmost importance. In this work, we use ionic liquids (ILs) as trace additives in a protein-TiO2 system, allowing us to obtain an exceptionally low limit of detection down to 10-9 M. The enhancement factors (EFs) were determined to 2.30 × 104, 6.17 × 104, and 1.19 × 105, for the three systems: one without ILs, one with ILs in solutions, and one with ILs immobilized on the TiO2 substrate, respectively, corresponding to the molecular forces of 1.65, 1.32, and 1.16 nN quantified by the atomic force microscopy. The dissociation and following hydration of ILs, occurring in the SERS system, weakened the molecular forces but instead improved the electron transfer ability of ILs, which is the major contribution for the observed excellent detection. The weaker diffusion of the hydrated IL ions immobilized on the TiO2 substrate did provide a considerably greater EF value, compared to the ILs in the solution. This work clearly demonstrates the importance of the hydration of ions, causing an improved electron transfer ability of ILs and leading to an exceptional SERS performance in the field of trace detection. Our results should stimulate further development to use ILs in SERS and related applications in bioanalysis, medical diagnosis, and environmental science.

Microscopic shear flow simulations of a biaxial smectic A liquid crystal based on the soft ellipsoid string-fluid.

We have studied the behaviour of a biaxial smectic A liquid crystal based on the soft ellipsoid string-fluid in shear flow by molecular dynamics simulation using the SLLOD equation of motion. This is facilitated by the fact that the biaxial symmetry allows linear relations between the pressure and the velocity gradient. This means that linear irreversible thermodynamics can be applied independently of the simulations to obtain the torques determining the orientations of the system and that the predictions of this theory can be cross-checked by the simulations. It turns out that there is a torque turning the smectic layers to the orientation parallel to the vorticity plane if the simulation is started in another orientation. In the orientation parallel to the vorticity plane where the director formed by the long axes of the molecules, nw, is perpendicular to the vorticity plane there is another torque keeping the director formed by the normals of the broadsides of the molecules, nu, parallel to this plane at a constant alignment angle, ψ relative to the streamlines independently of the strain rate. Moreover, this alignment angle seems to be the one where the irreversible energy dissipation rate, , is minimal. This is in agreement with a recently proven theorem according to which is minimal in the linear regime of a nonequilibrium steady state. Finally, we studied the orientation of nu when the smectic layers are parallel to the shear plane. In a simulation this orientation is stabilised by the periodic boundary conditions. Then we found that there was a nonlinear torque turning nu to the orientation perpendicular to the streamlines thus minimising the value of even though this value is larger than the value of in the orientation parallel to the vorticity plane. This means that is minimized given the external boundary conditions.

Coarse-grained simulations of ionic liquid materials: from monomeric ionic liquids to ionic liquid crystals and polymeric ionic liquids.

Ionic liquid (IL) materials are promising electrolytes with striking physicochemical properties for energy and environmental applications. Heterogeneous structures and transport quantities of monomeric and polymeric ILs are intrinsically intercorrelated and span multiple spatiotemporal scales, which is more feasible for coarse-grained (CG) simulations than atomistic modelling. Herein we constructed a novel CG model for ethyl-imidazolium tetrafluoroborate ILs with varied cation alkyl chains ranging from C2 to C20, and the interaction parameters were validated against representative static and dynamic properties that were obtained from atomistic reference simulations and experimental characterizations at relevant thermodynamic states. This CG model was extended to study thermotropic phase behaviors of monomeric ILs and to explore ion association structures and ion transport quantities in polymeric ILs with different architectures. A systematic analysis of structural and dynamical quantities identifies an evolution of liquid morphology from homogeneous to nanosegregated structures and then a smectic mesomorphism via a gradual lengthening of cation alkyl chains, and thereafter a distinct structural transition characterized by a monotonic decrease in orientational and translational order parameters in a sequential heating cascade. Backbone and pendant polymeric ILs exhibit evident anion association structures with cation monomers and polymer chains, and striking intra- and interchain coordinations between cation monomers owing to an intrinsic polymer architecture effect. Such a peculiar ion pairing association leads to a progressive increase in anion intrachain hopping probabilities, and a concomitant decrease in anion interchain hopping events with a gradual lengthening of polymeric ILs. The anion diffusivities in polymeric ILs are intrinsically correlated with ion pairing association lifetimes and ion structural relaxation times via a universal power law correlation D ∼ τ-1, irrespective of polymer architectures.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Spectroscopic and In Silico Studies on the Interaction of Substituted Pyrazolo[1,2-a]benzo[1,2,3,4]tetrazine-3-one Derivatives with c-Myc G4-DNA.

Herein we describe a combined experimental and in silico study of the interaction of a series of pyrazolo[1,2-a]benzo[1,2,3,4]tetrazin-3-one derivatives (PBTs) with parallel G-quadruplex (GQ) DNA aimed at correlating their previously reported anticancer activities and the stabilizing effects observed by us on c-myc oncogene promoter GQ structure. Circular dichroism (CD) melting experiments were performed to characterize the effect of the studied PBTs on the GQ thermal stability. CD measurements indicate that two out of the eight compounds under investigation induced a slight stabilizing effect (2-4 °C) on GQ depending on the nature and position of the substituents. Molecular docking results allowed us to verify the modes of interaction of the ligands with the GQ and estimate the binding affinities. The highest binding affinity was observed for ligands with the experimental melting temperatures (Tms). However, both stabilizing and destabilizing ligands showed similar scores, whilst Molecular Dynamics (MD) simulations, performed across a wide range of temperatures on the GQ in water solution, either unliganded or complexed with two model PBT ligands with the opposite effect on the Tms, consistently confirmed their stabilizing or destabilizing ability ascertained by CD. Clues about a relation between the reported anticancer activity of some PBTs and their ability to stabilize the GQ structure of c-myc emerged from our study. Furthermore, Molecular Dynamics simulations at high temperatures are herein proposed for the first time as a means to verify the stabilizing or destabilizing effect of ligands on the GQ, also disclosing predictive potential in GQ-targeting drug discovery.

The ENUF method-Ewald summation based on nonuniform fast Fourier transform: Implementation, parallelization, and application.

Computer simulations of model systems are widely used to explore striking phenomena in promising applications spanning from physics, chemistry, biology, to materials science and engineering. The long range electrostatic interactions between charged particles constitute a prominent factor in determining structures and states of model systems. How to efficiently calculate electrostatic interactions in simulation systems subjected to partial or full periodic boundary conditions has been a grand challenging task. In the past decades, a large variety of computational schemes has been proposed, among which the Ewald summation method is the most reliable route to accurately deal with electrostatic interactions between charged particles in simulation systems. In addition, extensive efforts have been done to improve computational efficiencies of the Ewald summation based methods. Representative examples are approaches based on cutoffs, reaction fields, multi-poles, multi-grids, and particle-mesh schemes. We sketched an ENUF method, an abbreviation for the Ewald summation method based on the nonuniform fast Fourier transform technique, and have implemented this method in particle-based simulation packages to calculate electrostatic energies and forces at micro- and mesoscopic levels. Extensive computational studies of conformational properties of polyelectrolytes, dendrimer-membrane complexes, and ionic fluids demonstrated that the ENUF method and its derivatives conserve both energy and momentum to floating point accuracy, and exhibit a computational complexity of O N log N with optimal physical parameters. These ENUF based methods are attractive alternatives in molecular simulations where high accuracy and efficiency of simulation methods are needed to accelerate calculations of electrostatic interactions at extended spatiotemporal scales.

The Effect of Phenyl Substitutions on Microstructures and Dynamics of Tetraalkylphosphonium Bis(trifluoro- methylsulfonyl)imide Ionic Liquids.

Extensive atomistic simulations demonstrated that a gradual substitution of hexyl chains with phenyl groups in tetraalkylphosphonium cations results in remarkable changes in hydrogen bonding interactions, liquid structures and scattering structural functions, and rotational dynamics of hexyl chains and phenyl groups in tetraalkylphosphonium bis(trifluoromethylsulfonyl)imide ionic liquids. Hydrogen donor sites in hexyl chains present competitive characteristics with those in phenyl groups in coordinating anions, as well as their continuous and intermittent hydrogen bonding dynamics. Cation-cation and anion-anion spatial correlations show concomitant shift to short distances with decreased peak intensities with variations of cation structures, whereas cation-anion correlations have a distinct shift to large radial distances due to decreased associations of anions with neighboring cations. These microstructural changes are qualitatively manifested in shifts of prominent peaks for prevalent charge alternations and adjacency correlations between ion species in scattering structural functions. Meanwhile, rotational dynamics of hexyl chains speed up, which, in turn, slow down rotations of phenyl groups, whereas anions exhibit imperceptible changes in their rotational dynamics. These computational results are intrinsically correlated with conformational flexibilities, molecular sizes, and steric hindrance effects of phenyl groups in comparison with hexyl chains, and constrained distributions of anions around cations in heterogeneous ionic environments.

Excellent Protein Immobilization and Stability on Heterogeneous C-TiO2 Hybrid Nanostructures: A Single Protein AFM Study.

Enhancing molecular interaction is critical for improving the immobilization and stability of proteins on TiO2 surfaces. In this work, mesoporous TiO2 materials with varied pore geometries were decorated with phenyl phosphoric acid (PPA), followed by a thermal treatment to obtain chemically heterogeneous C-TiO2 samples without changing the geometry and crystalline structure, which can keep the advantages of both carbon and TiO2. The molecular interaction force between the protein and the surfaces was measured using atomic force microscopy by decomposing from the total adhesion forces, showing that the surface chemistry determines the interaction strength and depends on the amount of partial carbon coverage on the TiO2 surface (∼40-80%). Samples with 58.3% carbon coverage provide the strongest molecular interaction force, consistent with the observation from the detected friction force. Surface-enhanced Raman scattering and electrochemical biosensor measurements for these C-TiO2 materials were further conducted to illustrate their practical implications, implying their promising applications such as in protein detection and biosensing.

Feature vector clustering molecular pairs in computer simulations.

A clustering framework is introduced to analyze the microscopic structural organization of molecular pairs in liquids and solutions. A molecular pair is represented by a representative vector (RV). To obtain RV, intermolecular atom distances in the pair are extracted from simulation trajectory as components of the key feature vector (KFV). A specific scheme is then suggested to transform KFV to RV by removing the influence of permutational molecular symmetry on the KFV as the predicted clusters should be independent of possible permutations of identical atoms in the pair. After RVs of pairs are obtained, a clustering analysis technique is finally used to classify all the RVs of molecular pairs into the clusters. The framework is applied to analyze trajectory from molecular dynamics simulations of an ionic liquid (trihexyltetradecylphosphonium bis(oxalato)borate ([P6,6,6,14 ][BOB])). The molecular pairs are successfully categorized into physically meaningful clusters, and their effectiveness is evaluated by computing the product moment correlation coefficient (PMCC). (Willett, Winterman, and Bawden, J. Chem. Inf. Comput. Sci. 1986, 26, 109-118; Downs, Willett, and Fisanick, J. Chem. Inf. Comput. Sci. 1994, 34, 1094-1102) It is observed that representative configurations of two clusters are related to two energy local minimum structures optimized by density functional theory (DFT) calculation, respectively. Several widely used clustering analysis techniques of both nonhierarchical (k-means) and hierarchical clustering algorithms are also evaluated and compared with each other. The proposed KFV technique efficiently reveals local molecular pair structures in the simulated complex liquid. It is a method, which is highly useful for liquids and solutions in particular with strong intermolecular interactions. © 2019 Wiley Periodicals, Inc.

Characterizing key features in the formation of ice and gas hydrate systems.

Crystallization in liquids is critical to a range of important processes occurring in physics, chemistry and life sciences. In this article, we review our efforts towards understanding the crystallization mechanisms, where we focus on theoretical modelling and molecular simulations applied to ice and gas hydrate systems. We discuss the order parameters used to characterize molecular ordering processes and how different order parameters offer different perspectives of the underlying mechanisms of crystallization. With extensive simulations of water and gas hydrate systems, we have revealed unexpected defective structures and demonstrated their important roles in crystallization processes. Nucleation of gas hydrates can in most cases be characterized to take place in a two-step mechanism where the nucleation occurs via intermediate metastable precursors, which gradually reorganizes to a stable crystalline phase. We have examined the potential energy landscapes explored by systems during nucleation, and have shown that these landscapes are rugged and funnel-shaped. These insights provide a new framework for understanding nucleation phenomena that has not been addressed in classical nucleation theory. This article is part of the theme issue 'The physics and chemistry of ice: scaffolding across scales, from the viability of life to the formation of planets'.

On the Charge-Transfer Excitations in Azobenzene Maleimide Compounds: A Theoretical Study.

Photoswitchable systems with charge-transfer (CT) transitions have gained much attention during the recent years because of their many emerging applications. CT transitions themselves are of fundamental importance from physical, chemical, engineering, and molecular modeling points of view because they depend on the modified intramolecular electronic structure. CT transitions in azobenzene (AB) were observed when substituted with the maleimide (MI) functional group. This work represents a systematic theoretical study of excited states of the AB-MI structures of eight azo derivatives. In addition to the two main azo transitions (π → π* and n → π*), our calculations show a CT occurring between the azo moiety as a donor and the MI group as an acceptor. The CT mechanism can be characterized based on both the number and the position of the MI fragments. MI groups in the azo structure result in low-energy transitions, changing the order of the main transitions by introducing a CT character. Calculations using both density functional theory (DFT) and high-end molecular orbital theories confirm the CT character of these derivatives, although the order of excited states was found to differ depending on the chosen level of theory. We present here the first theoretical investigation of the electronic excited states (nπ*CT and ππ*CT) and corresponding transitions for this class of compounds. The computational results showed that the CT mechanism in AB-MI derivatives can occur via two pathways: planar and twisted. Our findings are expected to be of substantial interest, especially in the area of molecular optoelectronics and in the design of responsive materials.

The peculiar effect of water on ionic liquids and deep eutectic solvents.

Ionic liquids (ILs) and deep eutectic solvents (DESs) have been suggested as eco-friendly alternatives to organic solvents. A trace amount of water is often unavoidable as impurity, and water is also added on purpose to reduce their problematically high viscosity and lower their high price. Understanding the distinct effects of water on the properties of ILs/DESs is highly important. In this review, we collect published experimental and theoretical results for IL/DES-H2O systems at varied water concentrations and analyze them. Results from mechanistic studies, thermodynamic modelling and advanced experiments are collected and critically discussed. Six commonly studied IL/DES-H2O systems were selected to map experimental observations onto microscopic results obtained in mechanistic studies. A great variety of distinct contours of the excess properties can be observed over the entire compositional range, indicating that the properties of IL/DES-H2O systems are highly unpredictable. Mechanistic studies clearly demonstrate that the added H2O rapidly changes the heterogeneous 3D structures of pure ILs/DESs, leading to very different properties and behaviour. There are similarities between aqueous electrolytes and IL/DES solutions but the bulky and asymmetric organic cations in ILs/DESs do not conform to the standard salt dissolution and hydration concepts. Thermodynamic modelling previously assumes ILs/DESs to be either a neutral ion-pair or completely dissociated ions, neglecting specific ion hydration effects. A new conceptual framework is suggested for thermodynamic modelling of IL/DES-H2O binary systems to enable new technologies for their practical applications.