Forodesine Enhances Immune Responses through Guanosine-Mediated TLR7 Activation while Preventing Graft-versus-Host Disease.

Recent evidence indicates that specific types of nuclear acids, including guanosine and its derivatives, act as natural ligands for TLR7. This led us to hypothesize that purine nucleoside phosphorylase inhibitors not only can induce apoptosis of T cells but also can lead to TLR7 activation by accumulation of guanine nucleosides, in particular under systemic inflammation, where damaged tissues release a large amount of nucleotides. We demonstrate in the present study that a purine nucleoside phosphorylase inhibitor, forodesine, can reduce the disease severity and prolong the survival in a xenogeneic mouse model of graft-versus-host disease (GVHD). Guanine nucleosides were undetectable in mice during GVHD but increased significantly following forodesine treatment. Our in vitro experiments showed that forodesine enhanced guanosine-mediated cytokine production from APCs, including alveolar macrophages and plasmacytoid dendritic cells, through TLR7 signaling. Forodesine also enhanced Ag-presenting capacity, as demonstrated by increased CD8+ T cell proliferation and higher secretion of IFN-γ and IL-12p40 in an MLR with plasmacytoid dendritic cells. Furthermore, forodesine stimulated IFN-γ production from activated T cells in the presence of a low concentration of guanosine while inhibiting their proliferation and inducing apoptotic cell death. Although forodesine ameliorated GVHD severity, mice treated with forodesine showed significantly higher levels of multiple proinflammatory cytokines and chemokines in plasma, suggesting in vivo upregulation of TLR7 signaling. Our study suggests that forodesine may activate a wide range of immune cells, including T cells, through TLR7 stimulation while inhibiting GVHD by inducing apoptosis of T cells, after allogeneic hematopoietic stem cell transplant.

Individualized rabbit anti-thymocyte globulin dosing in adult haploidentical hematopoietic cell transplantation with high-risk hematologic malignancy: Exposure-response analysis and population pharmacokinetics simulations.

Hematopoietic cell transplantation (HCT) for hematologic malignancies with non-remission disease and/or prior post-transplant relapse have poor relapse-free survival. We previously demonstrated the efficacy of haploidentical reduced-intensity HCT regimen with glucocorticoid-based graft-versus-host disease (GVHD) prophylaxis. We recently showed a possible association between rabbit antithymocyte globulin (rATG) exposure and acute GVHD (aGVHD) risk, leading to hypothesize that optimization of rATG exposure may further improve this regimen. We retrospectively examined the exposure-response association of rATG and key clinical outcomes post haploidentical HCT. We subsequently developed an individualized rATG dosing that optimizes rATG exposure using a previously developed population pharmacokinetic model. Of the 103 patients analyzed, the median age was 47 years (range: 17-70) and majority had a non-remission disease prior to HCT (88%). rATG concentration on day 0 of HCT (Cday_0 ) was the strongest predictor of Grade 2-4 aGVHD through day +100. Patients with Cday_0 ≥ 20 µg/mL had an approximately 3-fold lower risk of Grade 2-4 aGVHD (hazard ratio [HR]: 0.32, 95% confidence interval [CI]: 0.16, 0.62) and Grade 3-4 aGVHD (HR: 0.33, 95% CI: 0.16, 0.68) as well as an approximately 2-fold lower risk of overall mortality (HR: 0.47, 95% CI: 0.28, 0.77) and relapse (HR: 0.50, 95% CI: 0.26, 0.94). In conclusion, this reduced-intensity haploidentical HCT regimen with exposure-optimized rATG may provide a promising option to patients undergoing high-risk HCT for hematologic malignancy. The developed rATG dosing warrant prospective validation.

Evaluation of the pharmacokinetics of liposomal amphotericin B and analysis of the relationship between pharmacokinetics, efficacy and safety in patients with hematological diseases.

INTRODUCTION: This study aimed to identify factors responsible for changes in blood concentrations of a liposomal formulation of amphotericin B (AMPH-B, L-AMB) and analyze the relationships between blood concentrations and efficacy or toxicity. METHODS: L-AMB was administered to 30 patients being treated for hematological diseases. AMPH-B plasma concentrations were determined right before the initiation (Cmin) and at the end (Cmax) of infusion on at least 1 day, beginning on Day 3 of L-AMB treatment. The relationships of Cmin divided by dose (C/D ratio) to body weight, age, hepatic function, renal function, serum albumin, C-reactive protein (CRP), response, hypokalemia, and renal impairment were evaluated. RESULTS: C/D ratio was not correlated with age, hepatic function, renal function, or serum albumin. Body weight adjusted C/D ratio was negatively correlated with CRP. Cmax and Cmin were compared between responders and non-responders, those with or without hypokalemia, and those with or without renal impairment. A higher Cmax in patients with hypokalemia was the only significant difference seen. CONCLUSIONS: The negative correlation between CRP and plasma concentrations was likely caused by higher distribution of L-AMB from the blood to infected tissue in patients with a greater degree of infection, with a resulting decrease in plasma concentrations. AMPH-B plasma concentrations were not related to response. Higher Cmax of AMPH-B were observed in patients with hypokalemia, but no relationship between plasma concentration and renal toxicity was observed, suggesting that AMPH-B plasma concentrations appear to be minimally related to PD when used as L-AMB.

Effects of combined test dose and therapeutic drug monitoring strategy in exposure-directed busulfan.

Although exposure-directed busulfan (BU) dosing can improve allogeneic hematopoietic stem cell transplantation outcomes, there is still large variability in BU exposure with test dose alone due to changes in BU clearance caused by drug interactions. We conducted a single-arm phase II trial using the combined test dose and therapeutic drug monitoring strategy (PK-guided group) and compared the outcomes with an external historical cohort receiving a fixed-dose (fixed-dose group). The first eight and second eight doses were adjusted based on the area under the blood concentration-time curve (AUC) of the test and first doses, respectively, targeting a total AUC of 82.1 mg·h/L. All patients received either BU and cyclophosphamide conditioning (BU/CY) or fludarabine (FLU)-containing conditioning. The BU clearance at the first dose decreased more in patients receiving FLU than in those receiving BU/CY; however, BU clearance also declined over time in patients who received BU/CY. The simulated total AUC (sAUC) with test dose only was significantly higher in patients who received FLU than in those who received BU/CY, but sAUC with the combined strategy was comparable. The 100-day progression-free survival was 85.5% (95% confidence interval [CI]: 71.9-92.8%), and was not inferior to that in the fixed-dose group. For the FLU-containing regimens, the PK-guided group showed decreased relapse (0.0% vs. 26.9%, p = 0.03), and favorable overall survival (75.1% vs. 57.0%, p = 0.07) at 1 year. The combined strategy effectively controlled the BU exposure close to the target levels, potentially improving efficacy, especially in patients receiving the FLU-containing regimen. Clinical evaluation of efficacy of dose-modified intravenous busulfan in allogeneic hematopoietic stem cell transplantation for hematological malignancy (#UMIN000014077, June 15th, 2014).

N,N-Diethyl-3-toluamide Formulation Based on Ethanol Containing 0.1% 2-Hydroxypropyl-ß-cyclodextrin Attenuates the Drug's Skin Penetration and Prolongs the Repellent Effect without Stickiness.

N,N-diethyl-3-toluamide (DEET) is one of the most widely used insect repellents in the world. It was reported that a solution containing 6-30% cyclodextrin (CD) as a solvent instead of ethanol (EtOH) provided an enhancement of the repellent action time duration of the DEET formulation, although the high-dose CD caused stickiness. In order to overcome this shortcoming, we attempted to prepare a 10% DEET formulation using EtOH containing low-dose CDs (ß-CD, 2-hydroxypropyl-ß-CD (HPßCD), methyl-ß-CD, and sulfobutylether-ß-CD) as solvents (DEET/EtOH/CD formulations). We determined the CD concentration to be 0.1% in the DEET/EtOH/CD formulations, since the stickiness of 0.1% CDs was not felt (approximately 8 × 10-3 N). The DEET residue on the skin superficial layers was prolonged, and the drug penetration into the skin tissue was decreased by the addition of 0.1% CD. In particular, the retention time and attenuated penetration of DEET on the rat skin treated with the DEET/EtOH/HPßCD formulation was significantly higher in comparison with that of the DEET/EtOH formulation without CD. Moreover, the repellent effect of DEET was more sustained by the addition of 0.1% HPßCD in the study using Aedes albopictus. In conclusion, we found that the DEET/EtOH/HPßCD formulations reduced the skin penetration of DEET and prolonged the repellent action without stickiness.

Cefepime-induced encephalopathy in a COVID-19 patient: a case report.

Prolonged neurological symptoms such as "brain fog" and cognitive impairment have occurred after coronavirus disease 2019 (COVID-19) infection. In this report, we describe impaired consciousness caused by cefepime hydrochloride (CFPM) in a patient with cognitive sequalae of COVID-19. A 56-year-old male patient was diagnosed with penile abscess after COVID-19 infection, and a blood culture detected two drug-resistant Pseudomonas aeruginosa strains. Therefore, CFPM 2 g × twice/day was administered on day 71 after intensive care unit admission. Approximately 48 h after CFPM administration, the patient showed disturbances in consciousness. Contrast-enhanced computed tomography, magnetic resonance imaging, and spinal fluid examination revealed no obvious abnormalities. Therefore, CFPM-induced neurotoxicity was suspected. CFPM was discontinued and ceftazidime 2 g × three times/day was initiated. The patient's consciousness improved 30 h after the final administration of CFPM. Serum CFPM concentrations were 14.2, 21.7, 21.7, and 11.9 µg/mL on days 1, 2, and 3 after the initiation of CFPM and on the day after CFPM was discontinued, respectively. In conclusion, intensivists should pay attention to new neurological symptoms such as CFPM-induced encephalopathy in patients with prolonged neurological symptoms after COVID-19 infection.

Two-point blood sampling is sufficient and necessary to estimate the area under the concentration-time curve for intravenous busulfan in infants and young children.

BACKGROUND: Therapeutic drug monitoring for busulfan is important to prevent adverse events and improve outcomes in stem cell transplantation. We investigated intravenous busulfan pharmacokinetics and evaluated the utility of limited sampling strategy (LSS) as a simple method to estimate the area under the concentration-time curve (AUC). PROCEDURE: The study comprised 87 busulfan measurements in 54 children who received intravenous busulfan between August 2015 and May 2020. AUCs were calculated from three to five blood sampling points in each patient, and the correlation between AUC and plasma concentrations (ng/mL) at 1, 2, 3, 4, and 6 h after initiating busulfan infusion (C1 , C2 , C3 , C4 , and C6 , respectively). RESULTS: By one-point sampling strategy, the most relevant predicted AUC was based on C6 (r2  = 0.789; precision, 11.0%) in all patients. The predicted AUC based on C6 was acceptable (r2  = 0.937; precision, 5.9%) for adolescent patients weighing >23 kg, but the correlation was poor in infants and young children weighing ≤ 23 kg (r2  = 0.782; precision, 11.4%). By two-point sampling strategy, the predicted AUC based on C3 and C6 showed the most relevant concentrations (r2  = 0.943; precision, 6.4%), even in infants and young children, whereas the predicted AUC based on C3 and C6 was acceptable (r2  = 0.963; precision, 5.7%). CONCLUSIONS: The AUC of busulfan can be predicted based on C6 in adolescent patients. However, there was substantial interindividual variation in busulfan pharmacokinetics in infants and young children, in whom two-point LSS was necessary for accurate AUC prediction.

DNA methyltransferase- and histone deacetylase-mediated epigenetic alterations induced by low-level methylmercury exposure disrupt neuronal development.

Methylmercury (MeHg) is a chemical substance that causes adverse effects on fetal development. However, the molecular mechanisms by which environmental MeHg affects fetal development have not been clarified. Recently, it has been suggested that the toxic effects of chemicals on fetal development are related alterations in epigenetics, such as DNA methylation and histone modification. In order to analyze the epigenetic effects of low-level MeHg exposure on neuronal development, we evaluated neuronal development both in vivo and in vitro. Pregnant mice (C57BL/6J) were orally administrated 3 mg/kg of MeHg once daily from embryonic day 12-14. Fetuses were removed on embryonic day 19 and brain tissues were collected. LUHMES cells were treated with 1 nM of MeHg for 6 days and collected on the last day of treatment. In both in vivo and in vitro samples, MeHg significantly suppressed neurite outgrowth. Decreased acetylated histone H3 (AcH3) levels and increased histone deacetylase (HDAC) 3 and HDAC6 levels were observed in response to MeHg treatment in both in vivo and in vitro experiments. In addition, increased DNA methylation and DNA methyltransferase 1 (DNMT1) levels were observed in both in vivo and in vitro experiments. The inhibition of neurite outgrowth resulting from MeHg exposure was restored by co-treatment with DNMT inhibitor or HDAC inhibitors. Our results suggest that neurological effects such as reduced neurite outgrowth due to low-level MeHg exposure result from epigenetic changes, including a decrease in AcH3 via increased HDAC levels and an increase in DNA methylation via increased DNMT1 levels.

Intraocular penetration of liposomal amphotericin B after intravenous injection in inflamed human eyes.

PURPOSE: To determine the intraocular penetration of amphotericin B (AMPH-B) after an intravenously injection of liposomal amphotericin B (L-AMB) in inflamed human eyes. METHODS: Seven eyes of 5 patients with fungal eye diseases (endophthalmitis in 6 eyes and keratitis in 1 eye) were treated with intravenous injections of 100-250 mg/day of L-AMB. Samples of blood, corneal button, aqueous humor, and vitreous humor were collected and assessed for AMPH-B. RESULTS: The AMPH-B level in the cornea (604.0 µg/g) of the case with fungal keratitis exceeded the minimum inhibitory concentration. However, the levels in the aqueous and vitreous humors of the cases with fungal endophthalmitis were lower, e.g., 0.02 ± 0.01 µg/ml (0.09% of serum level) in the aqueous humor and 0.05 ± 0.08 µg/ml (0.17% of serum level) in the vitreous humor. CONCLUSIONS: The AMPH-B levels administered intravenously were very low in the aqueous and vitreous humors. Our findings indicate that intravenous L-AMB can be considered only for patients with mild endogenous fungal endophthalmitis, e.g., isolated chorioretinitis without vitreous extensions.

Prospective Study of Allogeneic Hematopoietic Stem Cell Transplantation with Post-Transplantation Cyclophosphamide and Antithymocyte Globulin from HLA-Mismatched Related Donors for Nonmalignant Diseases.

Allogeneic hematopoietic stem cell transplantation (HSCT) is performed as a curative treatment for children with nonmalignant diseases, such as bone marrow failure syndromes and primary immunodeficiencies. Because graft-versus-host-disease (GVHD) is a major factor affecting survival probability and quality of life after HSCT, the availability of HLA-matched donors restricts the application of HSCT. Recently, HSCT with post-transplantation cyclophosphamide (PTCy) has emerged as a potent method to prevent GVHD after HSCT from HLA-haploidentical donors, and some studies have suggested the safety of PTCy-HSCT for nonmalignant diseases. We conducted a prospective clinical trial aiming to help confirm the safety of HSCT and further reduction of GVHD using a combination of PTCy and low-dose antithymocyte globulin (ATG) from HLA-mismatched related donors for children with nonmalignant diseases. Six patients underwent HSCT and achieved engraftment at a median of 14.5 days, and no patient developed severe acute GVHD. All patients had sustained donor chimerism without developing chronic GVHD at the last follow-up. In conclusion, HSCT with PTCy and low-dose ATG from an HLA-mismatched related donor were feasible to control GVHD for nonmalignant diseases in the children involved in our study. © 2020 American Society for Transplantation and Cellular Therapy. Published by Elsevier Inc.

Identification and Characterization of a New Carboxylesterase 2 Isozyme, mfCES2C, in the Small Intestine of Cynomolgus Monkeys.

In contrast to a single human carboxylesterase 2 (CES2) isozyme (hCE2), three CES2 genes have been identified in cynomolgus monkeys: mfCES2A, mfCES2B, and mfCES2C . Although mfCES2A protein is expressed in several organs, mfCES2B is a pseudogene and the phenotype of the mfCES2C gene has not yet been clarified in tissues. In previous studies, we detected an unidentified esterase in the region of CES2 mobility upon nondenaturing PAGE analysis of monkey intestinal microsomes, which showed immunoreactivity for anti-mfCES2A antibody. The aim of the present study was to identify this unidentified esterase from monkey small intestine. The esterase was separated on nondenaturing PAGE gel and digested in-gel with trypsin. The amino acid sequences of fragmented peptides were analyzed by tandem mass spectrometry. The unidentified esterase was shown to be identical to mfCES2C (XP_015298642.1, predicted from the genome sequence data). mfCES2C consists of 559 amino acid residues and shows approximately 90% homology with mfCES2A (561 amino acid residues). In contrast to the ubiquitous expression of mfCES2A, mfCES2C is only expressed in the small intestine, kidney, and skin. The hydrolytic properties of recombinant mfCES2C, expressed in HEK293 cells, with respect to p-nitrophenyl derivatives, 4-methylumbelliferyl acetate, and irinotecan were similar to those of recombinant mfCES2A. However, mfCES2C showed a hydrolase activity for O-n-valeryl propranolol higher than mfCES2A. It is concluded that the previously unidentified monkey intestinal CES2 is mfCES2C, which shows different hydrolytic properties to mfCES2A, depending on the substrate. SIGNIFICANCE STATEMENT: In the present research, we determined that mfCES2C, a novel monkey CES2 isozyme, is expressed in the small intestine and kidney of the cynomolgus monkey. Interestingly, mfCES2C showed a relatively wide substrate specificity for ester-containing compounds. These findings may, in early stages of drug development, support the use of in vitro-to-in vivo extrapolation for the intestinal hydrolysis of ester drugs in the cynomolgus monkey.

Effective plasma concentrations of itraconazole and its active metabolite for the treatment of pulmonary aspergillosis.

BACKGROUND: Itraconazole (ITCZ) is used to treat pulmonary aspergillosis, but findings regarding the range of effective plasma concentrations are often contradictory. This study attempted to determine effective plasma concentrations of ITCZ and its active metabolite hydroxyitraconazole (OH-ITCZ) by retrospectively analyzing their relationships to clinical efficacy. METHODS: The study included 34 patients with pulmonary aspergillosis treated using ITCZ (mean age, 70 years). Each patient was treated with 200 mg ITCZ once daily (mean duration of treatment: 384 days). Plasma concentrations of ITCZ and OH-ITCZ at trough levels from 7 to 889 days after the start of treatment were determined using high-performance liquid chromatography. Clinical efficacy was assessed through the improvement clinical symptoms. RESULTS: Fifteen patients were classified as effective group and the other 19 patients as non-effective group. Mean (±standard deviation) ITCZ trough plasma concentration was significantly higher in effective group (1254 ± 924 ng/mL) than in non-effective group (260 ± 296 ng/mL). Mean OH-ITCZ plasma concentration was significantly higher in effective group (1830 ± 1031 ng/mL) than in non-effective group (530 ± 592 ng/mL). Receiver operating characteristic curve analysis revealed the optimal cutoff for ITCZ trough plasma concentration was 517 ng/mL, and 86.7% of effective group showed concentrations exceeding this value. The optimal cutoff for total ITCZ + OH-ITCZ plasma concentration was 1025 ng/mL, and 93.3% of effective group showed a concentration exceeding this value. CONCLUSIONS: Our findings indicate that effective plasma concentration ranges for the treatment of pulmonary aspergillosis begin at an ITCZ trough plasma concentration of 500 ng/mL and a total ITCZ + OH-ITCZ plasma concentration of 1000 ng/mL.

In vitro Evaluation of Linezolid and Doripenem Clearance with Different Hemofilters.

INTRODUCTION: Renal replacement therapy (RRT) is widely used in the treatment of septic acute kidney injury. However, little is known about how the adsorption properties of hemofilters used in RRT affect antibiotic concentration. Because a cytokine-adsorption membrane is frequently used in RRT, it is important to determine the antibiotic adsorption capacity of this membrane. OBJECTIVE: The present study aimed to investigate the antibiotic adsorption capacity of different hemofilter membranes by in vitro experiments using 2 antibacterial agents (linezolid and doripenem). METHODS: We performed experimental hemofiltration in vitro using polyacrylonitrile (AN69ST), polymethylmethacrylate (PMMA), and polysulfone (PS) hemofilters for 1,440 min. The test solution was a 1,000-mL substitution fluid containing 30 µg/mL linezolid and 120 µg/mL doripenem. We measured drug concentrations at the inlet, outlet, and filtrate ports of the hemofilters for 1,440 min and calculated the sieving coefficient (SC) and adsorption rate (Ra) of the drugs onto the hemofilters. RESULTS: The amount of linezolid adsorbed onto AN69ST, PMMA, and PS membranes was decreased relative to that in the control group at 15 min (p < 0.05). However, no SC for linezolid was obtained thereafter. The Ra of linezolid onto AN69ST, PMMA, and PS membranes was higher than that in the control group (p < 0.05). In contrast, no significant differences were observed in the concentrations and Ra values of doripenem adsorbed onto AN69ST, PMMA, and PS membranes compared with those in the control group. CONCLUSIONS: Doripenem was not adsorbed onto PMMA, PS, and AN69ST membranes. Linezolid was adsorbed onto PMMA, PS, and AN69ST membranes, but only temporarily, and this did not affect drug bioavailability.

Characterization of Antibody Products Obtained through Enzymatic and Nonenzymatic Glycosylation Reactions with a Glycan Oxazoline and Preparation of a Homogeneous Antibody-Drug Conjugate via Fc N-Glycan.

Glycan engineering of antibodies has received considerable attention. Although various endo-ß- N-acetylglucosaminidase mutants have been developed for glycan remodeling, a side reaction has been reported between glycan oxazoline and amino groups. In this study, we performed a detailed characterization for antibody products obtained through enzymatic and nonenzymatic reactions with the aim of maximizing the efficiency of the glycosylation reaction with fewer side products. The reactions were monitored by an ultraperformance liquid chromatography system using an amide-based wide-pore column. The products were characterized by liquid chromatography coupled with tandem mass spectrometry. The side reactions were suppressed by adding glycan oxazoline in a stepwise manner under slightly acidic conditions. Through a combination of an azide-carrying glycan transfer reaction under optimized conditions and a bio-orthogonal reaction, a potent cytotoxic agent monomethyl auristatin E was site-specifically conjugated at N-glycosylated Asn297 with a drug-to-antibody ratio of 4. The prepared antibody-drug conjugate exhibited cytotoxicity against HER2-expressing cells.

Neutropenia and renal dysfunction due to intravesical cidofovir for virus-associated hemorrhagic cystitis after kidney and allogenic hematopoietic stem cell transplantations.

We present a patient with virus-associated hemorrhagic cystitis who underwent kidney and allogenic hematopoietic stem cell transplantations (allo-HSCT). Six months post-allo-HSCT, adenovirus hemorrhagic cystitis occurred, which has been in remission after a single dose of intravesical cidofovir. This might cause prolonged neutropenia and nephrotoxicity, suggesting cidofovir absorption in the blood.

Biological role of site-specific O-glycosylation in cell adhesion activity and phosphorylation of osteopontin.

Osteopontin (OPN) is an extracellular glycosylated phosphoprotein that promotes cell adhesion by interacting with several integrin receptors. We previously reported that an OPN mutant lacking five O-glycosylation sites (Thr134/Thr138/Thr143/Thr147/Thr152) in the threonine/proline-rich region increased cell adhesion activity and phosphorylation compared with the wild type. However, the role of O-glycosylation in cell adhesion activity and phosphorylation of OPN remains to be clarified. Here, we show that site-specific O-glycosylation in the threonine/proline-rich region of OPN affects its cell adhesion activity and phosphorylation independently and/or synergistically. Using site-directed mutagenesis, we found that OPN mutants with substitution sets of Thr134/Thr138 or Thr143/Thr147/Thr152 had decreased and increased cell adhesion activity, respectively. In contrast, the introduction of a single mutation into the O-glycosylation sites had no effect on OPN cell adhesion activity. An adhesion assay using function-blocking antibodies against αvß3 and ß1 integrins, as well as αvß3 integrin-overexpressing A549 cells, revealed that site-specific O-glycosylation affected the association of OPN with the two integrins. Phosphorylation analyses using phos-tag and LC-MS/MS indicated that phosphorylation levels and sites were influenced by the O-glycosylation status, although the number of O-glycosylation sites was not correlated with the phosphorylation level in OPN. Furthermore, a correlation analysis between phosphorylation level and cell adhesion activity in OPN mutants with the site-specific O-glycosylation showed that they were not always correlated. These results provide conclusive evidence of a novel regulatory mechanism of cell adhesion activity and phosphorylation of OPN by site-specific O-glycosylation.

Methylmercury causes epigenetic suppression of the tyrosine hydroxylase gene in an in vitro neuronal differentiation model.

Methylmercury (MeHg) is the causative substance of Minamata disease, which is associated with various neurological disorders such as sensory disturbance and ataxia. It has been suggested low-level dietary intake of MeHg from MeHg-containing fish during gestation adversely affects the fetus. In our study, we investigated the toxicological effects of MeHg exposure on neuronal differentiation focusing on epigenetics. We used human fetal brain-derived immortalized cells (LUHMES cells) as a human neuronal differentiation model. Cell viability, neuronal, and catecholamine markers in LUHMES cells were assessed after exposure to MeHg (0-1000 nM) for 6 days (from day 2 to day 8 of neuronal differentiation). Cell viability on day 8 was not affected by exposure to 1 nM MeHg for 6 days. mRNA levels of AADC, DBH, TUJ1, and SYN1 also were unaffected by MeHg exposure. In contrast, levels of TH, the rate-limiting enzyme for dopamine synthesis, were significantly decreased after MeHg exposure. Acetylated histone H3, acetylated histone H3 lysine 9, and tri-methyl histone H3 lysine 9 levels at the TH gene promoter were not altered by MeHg exposure. However, tri-methylation of histone H3 lysine 27 levels, related to transcriptional repression, were significantly increased at the TH gene promotor after MeHg exposure. In summary, MeHg exposure during neuronal differentiation led to epigenetic changes that repressed TH gene expression. This study provides useful insights into the toxicological mechanisms underlying the effects of developmental MeHg exposure during neuronal differentiation.

Breakthrough Exophiala dermatitidis infection during prophylactic administration of micafungin during second umbilical cord blood transplantation after graft failure.

Exophiala dermatitidis infections in patients with hematological malignancies are very rare. Our patient had a blood stream infection caused by E. dermatitidis following the second umbilical cord blood transplantation (UCBT) after graft failure during the first UCBT. To our knowledge, this is the first report describing a breakthrough fungal infection caused by E. dermatitidis during the prophylactic administration of micafungin (MCFG). Therefore, MCFG-treated patients should be monitored for breakthrough E. dermatitidis infection during hematopoietic stem cell transplantation.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Plasma concentrations of dasatinib have a clinical impact on the frequency of dasatinib dose reduction and interruption in chronic myeloid leukemia: an analysis of the DARIA 01 study.

BACKGROUND: Dasatinib has shown promising anti-leukemic activity against chronic myeloid leukemia (CML). However, patients receiving dasatinib frequently require dose reductions and treatment interruptions (treatment alteration). METHODS: We prospectively analyzed the frequency and significance of treatment alteration during dasatinib therapy in patients with CML. In all patients, trough plasma concentrations of dasatinib (Cmin) at steady state were assessed on day 28 of therapy. RESULTS: 28% of patients had their doses reduced at a median of 42 days, and 25% of patients had temporarily interrupted at a median of 54 days after treatment initiation. The overall dasatinib treatment alteration-free rate at 1 year was 66%. Age was significantly correlated with Cmin on day 28 (p = 0.014), and the correlation remained significant after adjusting dasatinib dose (g), body weight (kg) (Cmin/D/W) (p = 0.026). In the univariate analysis, deep molecular response, advanced PS, higher Cmin/D/W were associated with a significantly higher risk of treatment alteration (HR 4.19, 95% CI: 1.06-16.60, p = 0.041; HR 5.26, 95% CI: 1.33-20.80, p = 0.018; and HR 10.15, 95% CI: 2.55-40.48, p = 0.001, respectively). In the multivariate analysis, advanced PS and higher Cmin/D/W were correlated with the incidence of treatment alteration (HR 4.78, 95% CI: 1.01-22.70, p = 0.049; HR 6.17, 95% CI: 1.17-32.50, respectively). CONCLUSION: Current data demonstrate that patients treated with dasatinib who displayed a high Cmin/D/W value and/or advanced PS were at a high risk for altered treatment.