Borylation via iridium catalysed C-H activation: a new concise route to duocarmycin derivatives.

The synthesis of the ethyl ester analogue of the ultrapotent antitumour antibiotic seco-duocarmycin SA has been achieved in eleven linear steps from commercially available starting materials. The DSA alkylation subunit can be made in ten linear steps from the same precursor. The route involves C-H activation at the equivalent of the C7 position on indole leading to a borylated intermediate 9 that is stable enough for peptide coupling reactions but can be easily converted to the free hydroxyl analogue.

A Gold(III) Pincer Ligand Scaffold for the Synthesis of Binuclear and Bioconjugated Complexes: Synthesis and Anticancer Potential.

Cyclometalated (C^N^C)AuIII complexes bearing functionalized N-heterocyclic carbene (NHC) ligands provide a high-yielding, modular route to bioconjugated and binuclear complexes. This methodology has been applied to the synthesis of bioconjugated complexes presenting biotin and 17α-ethynylestradiol vectors, as well as to the synthesis of bimetallic AuIII /AuI complexes. The in vitro antiproliferative activities of these compounds against various cancer cells lines depend on the linker length, with the longer linker being the most potent. The estradiol conjugate AuC6 Estra proved to be more toxic against the estrogen receptor positive (ER+) cancer cells than against the ER- cancer cells and non-cancer cells. The bimetallic complex AuC6 Au was more selective for breast cancer cells with respect to a healthy cell standard than the monometallic complex AuNHC. The metal uptake study on cells expressing or not biotin and estrogen receptors revealed an improved and targeted delivery of gold for both the bioconjugated complexes AuC6 Biot and AuC6 Estra compared to the non-vectorised analogue AuNHC. The investigations of the interaction of the bioconjugates and bimetallic complexes with human telomeric G-quadruplex DNA using FRET-melting techniques revealed a reduced ability to stabilize this DNA structure with respect to the non-vectorised analogue AuNHC.

Perfluoroarene-based peptide macrocycles that inhibit the Nrf2/Keap1 interaction.

The Nrf2/Keap1 interaction is a target in the development of new therapeutic agents, where inhibition of the interaction activates Nrf2 and leads to the generation of downstream anti-inflammatory effects. Peptides that mimic the ß-turn in the Keap1 active site and are constrained by a disulfide bridge have high affinity for Keap1 but no intracellular activity. The introduction of a perfluoroalkyl-bridging group to constrain the peptides, coupled with a glutamic acid to proline replacement leads to a new peptide with a Ki of 6.1 nM for the Nrf2/Keap1 binding interaction, although this does not translate into intracellular activity.

Cardiovascular Mechanisms of Action of Anthocyanins May Be Associated with the Impact of Microbial Metabolites on Heme Oxygenase-1 in Vascular Smooth Muscle Cells.

Anthocyanins are reported to have cardio-protective effects, although their mechanisms of action remain elusive. We aimed to explore the effects of microbial metabolites common to anthocyanins and other flavonoids on vascular smooth muscle heme oxygenase-1 (HO-1) expression. Thirteen phenolic metabolites identified by previous anthocyanin human feeding studies, as well as 28 unique mixtures of metabolites and their known precursor structures were explored for their activity on HO-1 protein expression in rat aortic smooth muscle cells (RASMCs). No phenolic metabolites were active when treated in isolation; however, five mixtures of phenolic metabolites significantly increased HO-1 protein expression (127.4-116.6%, p ≤ 0.03). The present study demonstrates that phenolic metabolites of anthocyanins differentially affect HO-1 activity, often having additive, synergistic or nullifying effects.

A translational synthetic biology platform for rapid access to gram-scale quantities of novel drug-like molecules.

Plants are an excellent source of drug leads. However availability is limited by access to source species, low abundance and recalcitrance to chemical synthesis. Although plant genomics is yielding a wealth of genes for natural product biosynthesis, the translation of this genetic information into small molecules for evaluation as drug leads represents a major bottleneck. For example, the yeast platform for artemisinic acid production is estimated to have taken >150 person years to develop. Here we demonstrate the power of plant transient transfection technology for rapid, scalable biosynthesis and isolation of triterpenes, one of the largest and most structurally diverse families of plant natural products. Using pathway engineering and improved agro-infiltration methodology we are able to generate gram-scale quantities of purified triterpene in just a few weeks. In contrast to heterologous expression in microbes, this system does not depend on re-engineering of the host. We next exploit agro-infection for quick and easy combinatorial biosynthesis without the need for generation of multi-gene constructs, so affording an easy entrée to suites of molecules, some new-to-nature, that are recalcitrant to chemical synthesis. We use this platform to purify a suite of bespoke triterpene analogs and demonstrate differences in anti-proliferative and anti-inflammatory activity in bioassays, providing proof of concept of this system for accessing and evaluating medicinally important bioactives. Together with new genome mining algorithms for plant pathway discovery and advances in plant synthetic biology, this advance provides new routes to synthesize and access previously inaccessible natural products and analogs and has the potential to reinvigorate drug discovery pipelines.

Formal Total Synthesis of (+)-C9-Deoxyomuralide from l-Leucine Using a Double Sacrificial Chirality Transfer Approach.

Formal stereocontrolled syntheses of (±)- and (+)-C9-deoxyomuralide is reported, constituting one of the shortest routes to the full carbon skeleton reported to date.

Cytotoxicity of Pyrazine-Based Cyclometalated (C

The synthesis of a series of cyclometalated gold(III) complexes supported by pyrazine-based (C^N^C)-type pincer ligands is reported, including the crystal structure of a cationic example. The compounds provide a new platform for the study of antiproliferative properties of gold(III) complexes. Seven complexes were tested: the neutral series (C^Npz^C)AuX [X = Cl (1), 6-thioguanine (4), C≡CPh (5), SPh (6)] and an ionic series that included the N-methyl complex [(C^NpzMe^C)AuCl]BF4 (7) and the N-heterocyclic carbene complexes [(C^Npz^C)AuL]+ with L = 1,3-dimethylbenzimidazol-2-ylidene (2) or 1,3,7,9-tetramethylxanthin-8-ylidene (3). Tests against human leukemia cells identified 1, 2, 3, and 4 as particularly promising, whereas protecting the noncoordinated N atom on the pyrazine ring by methylation (as in 7) reduced the cytotoxicity. Complex 2 proved to be the most effective of the entire series against the HL60 leukemia, MCF-7 breast cancer, and A549 lung cancer cell lines, with IC50 values down to submicromolar levels, associated with a lower toxicity toward healthy human lung fibroblast cells. The benzimidazolylidene complex 2 accumulated more effectively in human lung cancer cells than its caffeine-based analogue 3 and the gold(III) chloride 1. Compound 2 proved to be unaffected by glutathione under physiological conditions for periods of up to 6 days and stabilizes the DNA G-quadruplex and i-motif structures; the latter is the first such report for gold compounds. We also show the first evidence of inhibition of MDM2-p53 protein-protein interactions by a gold-based compound and identified the binding mode of the compound with MDM2 using saturation transfer difference NMR spectroscopy combined with docking calculations.

Common Phenolic Metabolites of Flavonoids, but Not Their Unmetabolized Precursors, Reduce the Secretion of Vascular Cellular Adhesion Molecules by Human Endothelial Cells.

BACKGROUND: Flavonoids have been implicated in the prevention of cardiovascular disease; however, their mechanisms of action have yet to be elucidated, possibly because most previous in vitro studies have used supraphysiological concentrations of unmetabolized flavonoids, overlooking their more bioavailable phenolic metabolites. OBJECTIVE: We aimed to explore the effects of phenolic metabolites and their precursor flavonoids at physiologically achievable concentrations, in isolation and combination, on soluble vascular cellular adhesion molecule-1 (sVCAM-1). METHOD: Fourteen phenolic acid metabolites and 6 flavonoids were screened at 1 µM for their relative effects on sVCAM-1 secretion by human umbilical vein endothelial cells stimulated with tumor necrosis factor alpha (TNF-α). The active metabolites were further studied for their response at different concentrations (0.01 µM-100 µM), structure-activity relationships, and effect on vascular cellular adhesion molecule (VCAM)-1 mRNA expression. In addition, the additive activity of the metabolites and flavonoids was investigated by screening 25 unique mixtures at cumulative equimolar concentrations of 1 µM. RESULTS: Of the 20 compounds screened at 1 µM, inhibition of sVCAM-1 secretion was elicited by 4 phenolic metabolites, of which protocatechuic acid (PCA) was the most active (-17.2%, P = 0.05). Investigations into their responses at different concentrations showed that PCA significantly reduced sVCAM-1 15.2-36.5% between 1 and 100 µM, protocatechuic acid-3-sulfate and isovanillic acid reduced sVCAM-1 levels 12.2-54.7% between 10 and 100 µM, and protocatechuic acid-4-sulfate and isovanillic acid-3-glucuronide reduced sVCAM-1 secretion 27.6% and 42.8%, respectively, only at 100 µM. PCA demonstrated the strongest protein response and was therefore explored for its effect on VCAM-1 mRNA, where 78.4% inhibition was observed only after treatment with 100 µM PCA. Mixtures of the metabolites showed no activity toward sVCAM-1, suggesting no additive activity at 1 µM. CONCLUSIONS: The present findings suggest that metabolism of flavonoids increases their vascular efficacy, resulting in a diversity of structures of varying bioactivity in human endothelial cells.

The Keap1/Nrf2 pathway in health and disease: from the bench to the clinic.

The transcription factor nuclear factor-erythroid 2 p45-related factor 2 (Nrf2, with gene called NFE2L2) is a master regulator of the antioxidant response. In the last decade, interest has intensified in this research area as its importance in several physiological and pathological processes has become widely recognized; these include redox signalling and redox homoeostasis, drug metabolism and disposition, intermediary metabolism, cellular adaptation to stress, chemoprevention and chemoresistance, toxicity, inflammation, neurodegeneration, lipogenesis and aging. Regulation of Nrf2 is complex and although much attention has focussed on its repression by Kelch-like ECH-associated protein-1 (Keap1), recently it has become increasingly apparent that it is also controlled by cross-talk with other signalling pathways including the glycogen synthase kinase-3 (GSK-3)-ß-transducin repeat-containing protein (ß-TrCP) axis, ERAD (endoplasmic reticulum-associated degradation)-associated E3 ubiquitin-protein ligase (Hrd1, also called synoviolin), nuclear factor-kappa B (NF-κB), Notch and AMP kinase. Due to its beneficial role in several diseases, Nrf2 has become a major therapeutic target, with novel natural, synthetic and targeted small molecules currently under investigation to modulate the pathway and in clinical trials.

Solid-Phase Synthesis of Duocarmycin Analogues and the Effect of C-Terminal Substitution on Biological Activity.

The duocarmycins are potent antitumor agents with potential for use in the development of antibody-drug conjugates (ADCs) as well as being clinical candidates in their own right. In this article, we describe the synthesis of a duocarmycin monomer (DSA) that is suitably protected for utilization in solid-phase synthesis. The synthesis was performed on a large scale, and the resulting racemic protected Fmoc-DSA subunit was separated by supercritical fluid chromatography (SFC) into the single enantiomers; its application to solid-phase synthesis methodology gave a series of monomeric and extended duocarmycin analogues with amino acid substituents. The DNA sequence selectivity was similar to that in previous reports for both the monomeric and extended compounds. Substitution at the C-terminus of duocarmycin caused a decrease in antiproliferative activity for all of the compounds studied. An extended compound containing an alanine at the C-terminus was converted to the primary amide or to an extended structure containing a terminal tertiary amine, but this had no beneficial effects on biological activity.

Identification of a new p53/MDM2 inhibitor motif inspired by studies of chlorofusin.

Previous studies on the natural product chlorofusin have shown that the full peptide and azaphilone structure are required for inhibition of the interaction between MDM2 and p53. In the current work, we utilized the cyclic peptide as a template and introduced an azidonorvaline amino acid in place of the ornithine/azaphilone of the natural product and carried out click chemistry with the resulting peptide. From this small library the first ever non-azaphilone containing chlorofusin analog with MDM2/p53 activity was identified. Further studies then suggested that the simple structure of the Fmoc-norvaline amino acid that had undergone a click reaction was also able to inhibit MDM2/p53 interaction. This is an example where studies of a natural product have led to the serendipitous identification of a new small molecule inhibitor of a protein-protein interaction.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2).

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Tumor necrosis factor SNP haplotypes are associated with iron deficiency anemia in West African children.

Plasma levels of tumor necrosis factor-alpha (TNF-alpha) are significantly raised in malaria infection and TNF-alpha is thought to inhibit intestinal iron absorption and macrophage iron release. This study investigated putative functional single nucleotide polymorphisms (SNPs) and haplotypes across the major histocompatibility complex (MHC) class III region, including TNF and its immediate neighbors nuclear factor of kappa light polypeptide gene enhancer in B cells (lkappaBL), inhibitor-like 1 and lymphotoxin alpha (LTA), in relation to nutritional iron status and anemia, in a cohort of 780 children across a malaria season. The prevalence of iron deficiency anemia (IDA) increased over the malaria season (P < .001). The TNF(-308) AA genotype was associated with an increased risk of iron deficiency (adjusted OR 8.1; P = .001) and IDA (adjusted OR 5.1; P = .01) at the end of the malaria season. No genotypes were associated with IDA before the malaria season. Thus, TNF appears to be a risk factor for iron deficiency and IDA in children in a malaria-endemic environment and this is likely to be due to a TNF-alpha-induced block in iron absorption.

Design and synthesis of threading intercalators to target DNA.

Threading intercalators are high affinity DNA binding agents that bind by inserting a chromophore into the duplex and locating one group in each groove. The first threading intercalators that can be conjugated to acids, sulfonic acids and peptides to target them to duplex DNA are described, based upon the well studied acridine-3- or 4-carboxamides. Cellular uptake of the parent acridine is rapid and it can be visualized in the nucleus of cells. Both the parent compounds and their conjugates maintain antitumor activity.

Lipopolysaccharide-induced expression of NAD(P)H:quinone oxidoreductase 1 and heme oxygenase-1 protects against excessive inflammatory responses in human monocytes.

Monocytes play a central role in the immunopathological effects of sepsis. This role is mediated by production of the cytokines TNF-alpha and IL-1beta. The transcription factor NF-E2-related factor 2 (Nrf2) regulates innate immune responses in various experimental disease models. Presently, the role of Nrf2-regulated genes in LPS-treated human monocytes is not well defined. Herein we show that Nrf2 mediates a significant regulation of LPS-induced inflammatory responses. Analysis of Nrf2-regulated gene expression in human monocytes showed that LPS induced the expression of the phase II detoxification gene NAD(P)H:quinone oxidoreductase 1 (NQO1). Furthermore, NQO1 mRNA or protein expression in response to LPS was regulated by Nrf2. Silencing Nrf2 expression in human monocytes inhibited LPS-induced NQO1 expression; however, in contrast, it significantly increased TNF and IL-1beta production. Silencing expression of NQO1 alone, or in combination with heme oxygenase-1 (HO-1) silencing, markedly increased LPS-induced TNF and IL-1beta expression. Additionally, overexpression of NQO1 and/or HO-1 inhibited LPS-induced TNF and IL-1beta expression. These results show for the first time that LPS induces NQO1 and HO-1 expression in human monocytes via Nrf2 to modulate their inflammatory responsiveness, thus providing novel potential therapeutic strategies for the treatment of sepsis.

Ferracyclic carbonyl complexes as anti-inflammatory agents.

Reaction of Fe(CO)4Br2 with 2-aminopyridine and 2-aminonapthalene yields ferracyclic iron(ii) complexes bearing two CO ligands. Irradiation with visible light releases these two CO molecules. Substitution of a halide in the parent complexes by thioglucose provides significantly enhanced water solublity and raises the quantum yield for CO release by around five times. The complexes show anti-inflammatory activity in a TNF assay in the dark.

Peptide directed phthalocyanine-gold nanoparticles for selective photodynamic therapy of EGFR overexpressing cancers.

Gold nanoparticles, covalently functionalised with the photosensitiser C11Pc and PEG, were actively targeted towards epidermal growth factor receptor overexpressing cancers using the peptide FITC-ßAAEYLRK. Selective phototoxicity was observed at nanomolar concentrations with minimal dark toxicity.

Synthesis and evaluation of 9-aminoacridines derived from benzyne click chemistry.

A small set of 9-aminoacridine-3- and 4-carboxamides were synthesized efficiently using the benzyne/azide click chemistry. The products bind to duplex DNA but have different antitumour activity in the HL60 cell line.

Identification of selective protein-protein interaction inhibitors using efficient in silico peptide-directed ligand design.

The development of protein-protein interaction (PPI) inhibitors with therapeutic value is of increasing importance as the first clinical agent has now been approved, but PPIs remain difficult targets for the development of small molecule ligands. This article describes a highly efficient approach to the development of inhibitors of the p53/hDMX or hDM2 interaction that involves the design of small molecules in silico based upon a peptide/protein structure. The process for molecule design, starting from a virtual library of just over 1200 fragments, led to the eventual synthesis of twenty compounds, of which ten bound to either hDM2, hDMX or both in in vitro binding assays. This 50% success rate is extremely efficient compared to traditional high throughput screening. The identification of two selective hDMX inhibitors from twenty compounds highlights this efficiency as, to date, only two other hDMX-selective agents exist in the literature. Preliminary biological studies show that 20% of the compounds identified have cellular activity and activate downstream pathways associated with p53 activation.

Epigallocatechin activates haem oxygenase-1 expression via protein kinase Cdelta and Nrf2.

The Nrf2/anti-oxidant response element (ARE) pathway plays an important role in regulating cellular anti-oxidants, including haem oxygenase-1 (HO-1). Various kinases have been implicated in the pathways leading to Nrf2 activation. Here, we investigated the effect of epigallocatechin (EGC) on ARE-mediated gene expression in human monocytic cells. EGC time and dose dependently increased HO-1 mRNA and protein expression but had minimal effect on expression of other ARE-regulated genes, including NAD(P)H:quinone oxidoreductase 1, glutathione cysteine ligase and ferritin. siRNA knock down of Nrf2 significantly inhibited EGC-induced HO-1 expression. Furthermore, inhibition of PKC by Ro-31-8220 dose dependently decreased EGC-induced HO-1 mRNA expression, whereas MAP kinase and phosphatidylinositol-3-kinase pathway inhibitors had no significant effect. EGC stimulated phosphorylation of PKCalphabeta and delta in THP-1 cells. PKCdelta inhibition significantly decreased EGC-induced HO-1 mRNA expression, whereas PKCalpha- and beta-specific inhibitors had no significant effect. These results demonstrate for the first time that EGC-induced HO-1 expression occurs via PKCdelta and Nrf2.