Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 43
Filtrar
Mais filtros

Base de dados
País/Região como assunto
Tipo de documento
Intervalo de ano de publicação
1.
Org Biomol Chem ; 21(47): 9398-9409, 2023 12 06.
Artigo em Inglês | MEDLINE | ID: mdl-37982163

RESUMO

Globally, human papillomavirus (HPV) infection is the leading cause of mortality associated with cervical cancer, oral cancer (oropharyngeal), and head and neck squamous cell carcinoma (HNSCC). It is essential to explore anti-cancer drugs against life-threatening HPV infections. Aiming to search for potentially better anticancer agents, a small library of ß-C-glycosylated methylidene succinimides have been synthesized under bulk and mechanical grinding conditions using the Wittig olefination reaction. Thus, the reaction of different 2,3,4,6-tetra-O-benzyl-C-glycosyl aldehydes with N-aryl/alkyl maleimides in the presence of PPh3 at 25 °C under bulk and mechanical grinding conditions results in the formation of stereochemically defined (E)-3-(2,3,4,6-tetra-O-benzyl-C-glycosylmethylidene)-N-alkyl/phenyl succinimides, which upon debenzylation with 1 M BCl3 in DCM at -78 °C lead to the synthesis of (E)-3-(C-glycosylmethylidene)-N-alkyl/phenyl succinimides in good to excellent yields. The developed methodology is efficient and environmentally benign because there is no use of organic solvents, and the products are obtained in a stereochemically defined form and in high yields. The aqueous solubility of all synthesized ß-C-glycosylated methylidene succinimides makes them potential candidates for the evaluation of their different biological activities. In the present work, the synthesized glycosylated alkylidine succinimides were subjected to an in-silico molecular docking study against the E6 oncoprotein of high-risk type HPV16, which is responsible for the inactivation of the tumor suppressor p53 protein. Analysis of the molecular docking data revealed that the synthesized compounds are effective inhibitors of HPV infection, which is the cause of oral, head and neck, and cervical cancer. In comparison with the positive control 5-FU, an anti-cancer drug used in chemotherapy, more than fifteen compounds were found to be better E6 protein inhibitors.


Assuntos
Antineoplásicos , Carcinoma de Células Escamosas , Neoplasias de Cabeça e Pescoço , Proteínas Oncogênicas Virais , Neoplasias do Colo do Útero , Feminino , Humanos , Carcinoma de Células Escamosas/metabolismo , Simulação de Acoplamento Molecular , Solventes , Antineoplásicos/farmacologia
2.
Arch Toxicol ; 97(1): 103-120, 2023 01.
Artigo em Inglês | MEDLINE | ID: mdl-36443493

RESUMO

ROS include hydroxyl radicals (HO.), superoxide (O2..), and hydrogen peroxide (H2O2). ROS are typically produced under physiological conditions and play crucial roles in living organisms. It is known that ROS, which are created spontaneously by cells through aerobic metabolism in mitochondria, can have either a beneficial or detrimental influence on biological systems. Moderate levels of ROS can cause oxidative damage to proteins, DNA and lipids, which can aid in the pathogenesis of many disorders, including cancer. However, excessive concentrations of ROS can initiate programmed cell death in cancer. Presently, a variety of chemotherapeutic drugs and herbal agents are being investigated to induce ROS-mediated cell death in cancer. Therefore, preserving ROS homeostasis is essential for ensuring normal cell development and survival. On account of a significant association of ROS levels at various concentrations with carcinogenesis in a number of malignancies, further studies are needed to determine the underlying molecular mechanisms and develop the possibilities for intervening in these processes.


Assuntos
Peróxido de Hidrogênio , Neoplasias , Humanos , Espécies Reativas de Oxigênio/metabolismo , Peróxido de Hidrogênio/metabolismo , Neoplasias/tratamento farmacológico , Neoplasias/genética , Neoplasias/metabolismo , Carcinogênese , Estresse Oxidativo , Apoptose , Transformação Celular Neoplásica
3.
Monaldi Arch Chest Dis ; 93(4)2023 Feb 02.
Artigo em Inglês | MEDLINE | ID: mdl-36786163

RESUMO

Serratia marcescens is an aerobic, Gram-negative bacillus predominantly seen in patients with intravenous drug use, immunosuppression, previous antibiotic exposure, and indwelling catheterization. Gram-negative organism causing infective endocarditis (IE) is rare. Serratia marcescens IE is uncommon and is reported to be seen in 0.14% of all cases. In this report, we discuss in detail about a 38-year-old man with a history of intravenous drug abuse presenting with S. marcescens related prosthetic valve IE.


Assuntos
Endocardite Bacteriana , Serratia , Adulto , Humanos , Masculino , Antibacterianos , Endocardite Bacteriana/diagnóstico , Endocardite Bacteriana/tratamento farmacológico , Serratia marcescens
4.
Homeopathy ; 112(4): 262-274, 2023 11.
Artigo em Inglês | MEDLINE | ID: mdl-36858077

RESUMO

BACKGROUND: Plant-derived homeopathic medicines (HMs) are cheap and commercially available but are mechanistically less explored entities than conventional medicines. PURPOSE: The aim of our study was to evaluate the impact of selected plant-derived HMs derived from Berberis aquifolium (BA), Berberis vulgaris (BV), Mentha piperita (MP), Curcuma longa (CL), Cinchona officinalis (CO), Thuja occidentalis (TO) and Hydrastis canadensis (HC) on cervical cancer (CaCx) cells in vitro. METHODS: We screened the mother tincture (MT) and 30C potencies of the above-mentioned HMs for anti-proliferative and cytotoxic activity on human papillomavirus (HPV)-negative (C33a) and HPV-positive CaCx cells (SiHa and HeLa) by MTT assay. Total phenolic content (TPC) and the free-radical scavenging activity of each HM was also determined using standard assays. Phytochemicals reportedly available in these HMs were examined for their potential inhibitory action on HPV16 E6 by in silico molecular docking. RESULTS: All tested MTs induced a differential dose-dependent cytotoxic response that varied with cell line. For C33a cells, the order of response was TO > CL > BA > BV > HC > MP > CO, whereas for SiHa and HeLa cells the order was HC > MP > TO > CO > BA > BV > CL and CL > BA > CO, respectively. 30C potencies of all HMs showed an inconsistent response. Further, anti-CaCx responses displayed by MTs did not follow the order of an HM's phenolic content or free radical scavenging activity. Analysis revealed anti-oxidant content of BA, BV and HC had the lowest contribution to their anti-CaCx activity. Using in silico modeling of molecular docking between the HPV16 E6 protein crystallographic structures (6SJA and 4XR8) and main phytochemical components of BV, BA, HC, CL and TO, their potential to inhibit the HPV16 E6 protein carcinogenic interactions was identified. CONCLUSION: The study has shown a comparative evaluation of the potential of several plant-derived MTs and HMs to affect CaCx cell line survival in vitro (through cytotoxicity and free radical scavenging) and their theoretical molecular targets in silico for the first time. Data demonstrated that MTs of BA and BV are likely to be the most potent HMs that strongly inhibited CaCx growth and have a strong anti-HPV phytochemical constitution.


Assuntos
Antineoplásicos , Homeopatia , Infecções por Papillomavirus , Neoplasias do Colo do Útero , Feminino , Humanos , Neoplasias do Colo do Útero/tratamento farmacológico , Neoplasias do Colo do Útero/metabolismo , Células HeLa , Simulação de Acoplamento Molecular , Antineoplásicos/farmacologia , Compostos Fitoquímicos/farmacologia , Radicais Livres , Linhagem Celular Tumoral
5.
BMC Cancer ; 22(1): 164, 2022 Feb 11.
Artigo em Inglês | MEDLINE | ID: mdl-35148692

RESUMO

BACKGROUND: Exosomes play a key role in cell-to-cell communication and are integral component of the tumor microenvironment. Recent observations suggest transfer of RNA through tumor-derived exosomes that can potentially translate into regulatory proteins in the recipient cells. Role of cervical cancer-derived exosomes and their transcript cargo is poorly understood. MATERIALS AND METHODS: The total RNA of exosomes from HPV-positive (SiHa and HeLa) and HPV-negative (C33a) cervical cancer cell lines were extracted and the transcripts were estimated using Illumina HiSeq X. Further, validation of HPV transcripts were performed using RT-PCR. RESULTS: 3099 transcripts were found to be differentially-exported in HPV-positive vs. HPV-negative exosomes (p value <0.05). Analysis of top 10 GO terms and KEGG pathways showed enrichment of transcripts belonging to axon guidance and tumor innervation in HPV-positive exosomes. Among top 20 overexpressed transcripts, EVC2, LUZP1 and ANKS1B were the most notable due to their involvement in Hh signaling, cellular migration and invasion, respectively. Further, low levels of HPV-specific reads were detected. RT-PCR validation revealed presence of E6*I splice variant of HPV18 in exosomal RNA of HeLa cells. The E6*I transcripts were consistently retained in exosomes obtained from HeLa cells undergoing 5-FU and cisplatin-induced oxidative stress. CONCLUSION: Our data suggests the enrichment of poly-A RNA transcripts in the exosomal cargo of cervical cancer cells, which includes pro-tumorigenic cellular RNA and viral transcripts such as HPV E6, which may have clinical utility as potential exosomal biomarkers of cervical cancer.


Assuntos
Exossomos/genética , Exossomos/virologia , Proteínas Oncogênicas Virais/genética , RNA Viral/genética , Neoplasias do Colo do Útero/virologia , Biomarcadores Tumorais/genética , Linhagem Celular Tumoral , Feminino , Perfilação da Expressão Gênica , Células HeLa , Humanos
6.
J Cell Biochem ; 122(2): 259-276, 2021 02.
Artigo em Inglês | MEDLINE | ID: mdl-33053226

RESUMO

Prostate cancer (PCa) frequently metastasizes to the bone leading to devastating complications such as severe pain and fracture. However, the mechanisms by which PCa cells cause bone loss remain less understood. We investigated the role and mechanisms by which PCa cells induce osteoclastogenesis using cultured monocytic osteoclast precursors. Treatment of RAW264.7 cells with PCa cell lines: DU145, LNCaP, PC-3, or their conditioned media led to the formation of distinct multinucleated, TRAP+ osteoclasts. This phenomenon was associated with the increased activation of transcription factor nuclear factor-kB (NF-κB). High transcript level of receptor activator of nuclear factor-kB ligand (RANKL), tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) were detected in PCa cells. TNF-α and LT-α augmented, whereas IL-6 reduced the RANKL-induced osteoclast formation in RAW264.7 cultures. Our results also demonstrated that PCa cells-induced osteoclastogenesis involved the activation of the TRAF6-IKK-p65-NF-κB signaling cascade. Together, our study demonstrates that PCa cells produce RANKL and several other pro-inflammatory cytokines known to influence osteoclastogenesis, by targeting the NF-κB signaling pathway.


Assuntos
Citocinas/metabolismo , NF-kappa B/metabolismo , Neoplasias da Próstata/metabolismo , Ligante RANK/farmacologia , Receptor Ativador de Fator Nuclear kappa-B/metabolismo , Animais , Diferenciação Celular/genética , Diferenciação Celular/fisiologia , Citocinas/genética , Interleucina-6/farmacologia , Masculino , Camundongos , NF-kappa B/genética , Osteoclastos/efeitos dos fármacos , Osteoclastos/metabolismo , Osteogênese/genética , Osteogênese/fisiologia , Neoplasias da Próstata/genética , Células RAW 264.7 , Transdução de Sinais/genética , Transdução de Sinais/fisiologia
7.
Cancer Cell Int ; 21(1): 319, 2021 Jun 24.
Artigo em Inglês | MEDLINE | ID: mdl-34167524

RESUMO

BACKGROUND: Angiogenic switch is a hallmark feature of transition from low-grade to high-grade cervical intraepithelial neoplasia (CIN) in cervical cancer progression. Therefore, early events leading to locally-advanced cervical metastatic lesions demand a greater understanding of the underlying mechanisms. Recent leads indicate the role of tumor-derived exosomes in altering the functions of endothelial cells in cervical cancer, which needs further investigation. METHODS: Exosomes isolated from cervical cancer cell lines were assessed for their angiogenic effect on the human umbilical vein endothelial cells (HUVEC) using tube formation and wound healing assay. The exosomal uptake by HUVEC cells was monitored using PKH-67 labelling followed by fluorescence microscopy. Alterations in Hh-GLI signaling components, PTCH1 and GLI1, in HUVEC were measured by immunoblotting. Changes in angiogenesis-related transcripts of vascular endothelial growth factor VEGF-A, VEGF-B, VEGFR2 and angiopoietin-1, angiopoietin-2, osteopontin were measured in exosome-treated HUVEC and in the exosomal RNA by RT-PCR. RESULTS: Enhanced tube formation, with an increased number of nodes and branching was observed in HUVEC's treated with exosomes derived from different cervical cancer cell lines. HPV-positive (SiHa and HeLa) cells' exosomes were more angiogenic. Exosome-treated HUVEC showed increased migration rate. PKH-67 labelled exosomes were found internalized in HUVEC. A high level of PTCH1 protein was detected in the exosome-treated endothelial cells. Subsequent RT-PCR analysis showed increased transcripts of Hh-GLI downstream target genes VEGF-A, VEGFR2, angiopoietin-2, and decreased expression of VEGF-B, and angiopoietin-1, suggestive of active Hh-GLI signaling. These effects were more pronounced in HUVEC's treated with exosomes of HPV-positive cells. However, these effects were independent of tumor-derived VEGF-A as exosomal cargo lacked VEGF-A transcripts or proteins. CONCLUSION: Overall, the data showed cervical cancer exosomes promote pro-angiogenic response in endothelial cells via upregulation of Hh-GLI signaling and modulate downstream angiogenesis-related target genes. The study provides a novel exosome-mediated mechanism potentially favoring cervical angiogenesis and thus identifies the exosomes as potential pharmacological targets against locally-advanced metastatic cervical lesions.

8.
Plant Dis ; 2020 Oct 28.
Artigo em Inglês | MEDLINE | ID: mdl-33112216

RESUMO

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

9.
Tumour Biol ; 37(10): 13137-13154, 2016 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-27449048

RESUMO

Etiological role of viral proteins E6 and E7 of high-risk HPV in cervical carcinogenesis is well established. However, their contribution in chemoresistance and epithelial-mesenchymal transition (EMT) that leads to advanced metastatic lesions and chemoresistance is poorly defined. In the present study, contribution of viral oncoproteins in acquisition of EMT character during onset of chemoresistance was assessed. A chemoresistant cell line (SiHaCR) was developed from an established HPV16-positive cervical cancer cell line, SiHa, by escalating selection pressure of 5-fluorouracil (5-FU). Expression of Survivin, ABCG2, Snail, Slug, Twist, and Vimentin was examined in SiHa and SiHaCR cells by reverse transcriptase-PCR (RT-PCR) and immunoblotting assays. Mesenchymal phenotype in SiHaCR cells was confirmed by assessment of migration and invasion potentials. SiHaCR cells displayed elevated level of functional and molecular markers associated with chemoresistance (Survivin, ABCG2) and EMT (Snail, Slug, Twist, Vimentin) and reduced E-cadherin. SiHaCR also showed increased levels of HPV16 E6 and E7 transcripts. Specific silencing of HPV16 E6, but not E7 using corresponding siRNA, demonstrated a differential involvement of HPV oncogenes in manifestation of EMT. HPV16 E6 silencing resulted in reduction of Slug and Twist expression. However, the expression of Snail and Vimentin was only marginally affected. In contrast, there was an increase in the expression of E-cadherin. A reduced migration and invasion capabilities were observed only in E6-silenced SiHaCR cells, which further confirmed functional contribution of HPV16 E6 in manifestation of EMT. Taken together, our study demonstrated an active involvement of HPV16 E6 in regulation of EMT, which promotes chemoresistance in cervical cancer.


Assuntos
Resistencia a Medicamentos Antineoplásicos , Transição Epitelial-Mesenquimal , Fluoruracila/farmacologia , Regulação Neoplásica da Expressão Gênica , Proteínas Oncogênicas Virais/metabolismo , Proteínas E7 de Papillomavirus/metabolismo , Proteínas Repressoras/metabolismo , Neoplasias do Colo do Útero/patologia , Antimetabólitos Antineoplásicos/farmacologia , Apoptose , Western Blotting , Movimento Celular , Proliferação de Células , Feminino , Humanos , Técnicas Imunoenzimáticas , Proteínas Oncogênicas Virais/antagonistas & inibidores , Proteínas Oncogênicas Virais/genética , Proteínas E7 de Papillomavirus/antagonistas & inibidores , Proteínas E7 de Papillomavirus/genética , RNA Mensageiro/genética , Reação em Cadeia da Polimerase em Tempo Real , Proteínas Repressoras/antagonistas & inibidores , Proteínas Repressoras/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Células Tumorais Cultivadas , Neoplasias do Colo do Útero/genética , Neoplasias do Colo do Útero/virologia , Cicatrização
10.
J Family Med Prim Care ; 13(6): 2305-2309, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-39027854

RESUMO

Background: The canine plays a vital role in dentofacial aesthetics and function. It supports the base of the alar and upper lip, which are crucial for smile aesthetics. When impacted, these functions are lost, leading to low self-esteem and overall poor health-related quality of life. The present study was conducted to find the prevalence of impacted and transmigrated canines in orthodontic patients and also to find the most prevalent type of canine impaction. Materials and Methods: This retrospective study was conducted in a hospital setting at Dental College. A total of 3050 OPGs (Orthopantomagram) of patients who visited dental hospitals for orthodontic treatment constituted the final sample. Demographic details regarding age, gender, and place of residence were collected from the patients. Evaluation of sample radiographs on the standard light box was performed to collect data regarding impacted and transmigrated canines. Statistical analysis was performed using descriptive statistics and Chi-square test. Results: Prevalence of impacted canine was found to be 2.46%. Impacted canine prevalence of 1.53% and 2.85% was reported in males and females, respectively. Only two female patients had transmigrated mandibular impacted canines. Comparison of arch showed a statistically significant (P value 0.02) higher prevalence in the maxillary arch, which was 1.54%, and in the mandibular arch, it was 0.92%. The present study reported significantly more unilateral impactions (P value 0.00) than bilateral impactions. Conclusion: The overall prevalence for impacted canine was 2.46%. Prevalence was higher in female patients. Early diagnosis of impacted canines is vital for planning orthodontic treatment in such patients.

11.
Curr Top Med Chem ; 2024 Sep 09.
Artigo em Inglês | MEDLINE | ID: mdl-39252624

RESUMO

Traditional medicinal foods derived from natural sources have gained increasing attention in recent years due to their perceived health benefits and potential therapeutic properties and are deeply rooted in cultural practices. This review aimed at understanding their potential health benefits, emphasizes the need to identify the key bioactive substances in traditional home medicine. We have discussed the bioactive properties, molecular targets, and anti-cancer effects of various compounds such as curcumin, genistein, berberine, resveratrol, and, quercetin present in traditional medicinal foods. Our study highlights the potential of traditional medicinal food in the prevention and management of various health conditions, including cardiovascular diseases, cancer and neurodegenerative disorders as evident from in vitro, in vivo and clinical trials. Additionally, our study explores the mechanistic action of various bioactive constituents of grapes, rosemary, barberry, turmeric and garlic that have been shown to interfere with cancer growth, proliferation, metastasis, angiogenesis, and induce apoptosis by targeting various pathways and the cell cycle. Additionally, a wide range of healing abilities of medicinal foods including their impact on cancer cells demonstrate their direct anti-tumor potential along with antioxidant and antiinflammatory properties. To summarize, the present review highlights that integrating the insights of contemporary science with the age-old wisdom of traditional medicine in a systematic way holds immense potential for developing alternate and effective approaches to cancer therapeutics and offering evidence-based dietary recommendations.

12.
Cancers (Basel) ; 16(18)2024 Sep 18.
Artigo em Inglês | MEDLINE | ID: mdl-39335155

RESUMO

Colorectal cancer (CRC) remains a significant global health burden with high incidence and mortality. MicroRNAs (miRNAs) are small non-protein coding transcripts, conserved throughout evolution, with an important role in CRC tumorigenesis, and are either upregulated or downregulated in various cancers. RNA-binding proteins (RBPs) are known as essential regulators of miRNA activity. Human antigen R (HuR) is a prominent RBP known to drive tumorigenesis with a pivotal role in CRC. In this review, we discuss the regulatory role of the HuR/miRNA axis in CRC. Interestingly, miRNAs can directly target HuR, altering its expression and activity. However, HuR can also stabilize or degrade miRNAs, forming complex feedback loops that either activate or block CRC-associated signaling pathways. Dysregulation of the HuR/miRNA axis contributes to CRC initiation and progression. Additionally, HuR-miRNA regulation by other small non-coding RNAs, circular RNA (circRNAs), or long-non-coding RNAs (lncRNAs) is also explored here. Understanding this HuR-miRNA interplay could reveal novel biomarkers with better diagnostic or prognostic accuracy.

13.
Naunyn Schmiedebergs Arch Pharmacol ; 397(1): 41-57, 2024 01.
Artigo em Inglês | MEDLINE | ID: mdl-37566307

RESUMO

Patients with glioblastoma multiforme and anaplastic astrocytoma are treated with temozolomide. Although it has been demonstrated that temozolomide increases GBM patient survival, it has also been connected to negative immune-related adverse effects. Numerous research investigations have shown that flavonoids have strong antioxidant and chemo-preventive effects. Consequently, it might lessen chemotherapeutic medicines' side effects while also increasing therapeutic effectiveness. The need for creating innovative, secure, and efficient drug carriers for cancer therapy has increased over time. Recent research indicates that exosomes have enormous potential to serve as carriers and cutting-edge drug delivery systems to the target cell. In recent years, researchers have been paying considerable attention to exosomes because of their favorable biodistribution, biocompatibility, and low immunogenicity. In the present review, the mechanistic information of the anti-glioblastoma effects of temozolomide and flavonoids coupled with their exosomal delivery to the targeted cell has been discussed. In addition, we discuss the safety aspects of temozolomide and flavonoids against glioma. The in-depth information of temozolomide and flavonoids action via exosomal delivery can unravel novel strategies to target Glioma.


Assuntos
Glioblastoma , Glioma , Humanos , Temozolomida/farmacologia , Temozolomida/uso terapêutico , Flavonoides/farmacologia , Flavonoides/uso terapêutico , Distribuição Tecidual , Glioma/tratamento farmacológico , Glioblastoma/tratamento farmacológico , Glioblastoma/metabolismo , Linhagem Celular Tumoral , Resistencia a Medicamentos Antineoplásicos , Antineoplásicos Alquilantes/farmacologia , Antineoplásicos Alquilantes/uso terapêutico
14.
Cancers (Basel) ; 16(9)2024 Apr 27.
Artigo em Inglês | MEDLINE | ID: mdl-38730663

RESUMO

In recent years, kaempferol, a natural flavonoid present in various fruits and vegetables, has received significant attention in gastrointestinal cancer research due to its varied therapeutic effects. Kaempferol has been proven to alter several molecular mechanisms and pathways, such as the PI3/Akt, mTOR, and Erk/MAPK pathway involved in cancer progression, showing its inhibitory effects on cell proliferation, survival, angiogenesis, metastasis, and migration. Kaempferol is processed in the liver and small intestine, but limited bioavailability has been a major concern in the clinical implications of kaempferol. Nano formulations have been proven to enhance kaempferol's efficacy in cancer prevention. The synergy of nanotechnology and kaempferol has shown promising results in in vitro studies, highlighting the importance for more in vivo research and clinical trials to determine safety and efficacy. This review aims to focus on the role of kaempferol in various types of gastrointestinal cancer and how the combination of kaempferol with nanotechnology helps in improving therapeutic efficacy in cancer treatment.

15.
Heliyon ; 10(15): e35735, 2024 Aug 15.
Artigo em Inglês | MEDLINE | ID: mdl-39170533

RESUMO

Egyptian clover/Berseem (Trifolium alexandrinum L.) is the most popular winter leguminous multi-cut fodder crop widely cultivated in the northwest and central parts of India. Quality seed significantly impacts farm productivity, farmers' profitability, and socioeconomic welfare. Foundation and certified seeds enable high-quality seed production, making breeder seed (BS) the most important link in the seed supply chain. In India, berseem BS indent had increased from 1998 - 99 to 2012-13; afterwards, it followed a constant but decreasing trend. Of the 27 notified cultivars, 24 came into the seed supply chain between 1998-1999 and 2021-2022, indicating high varietal availability to stakeholders. The study examines the potential causes of the national decline in BS indent and production and the differences in these figures over time. The highest BS indent was received for the variety JB-1 (276.1 q), followed by BL-10 (205.1 q), Mescavi (165.6 q) and Wardan (153.7 q) from 1998 - 99 to 2021-22. The varietal replacement rate (VRR) is high, 43.30 %, for the varieties that have reached the age of five or less in the recent three years (2019-20 to 2021-22). Additionally, it has been calculated that if the seed chain operates at 100 % efficiency, the BS generated (48.1q) in 2021-22 can cover an area of almost 0.12 million hectares in 2024-25. The study offers an in-depth overview of berseem BS indent and production, an analysis of the difficulties encountered in BS production, and future directions for expanding variety and producing excess BS in the nation.

16.
PLoS One ; 19(5): e0304328, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38787825

RESUMO

Nutritive value of five Cenchrus ciliaris (buffel grass) genotypes (IG96-50, IG96-96, IG96-358, IG96-401 and IG96-403) weredetermined. Their sugar contents (>70 mg/g of dry matter) and ensiling potential were evaluated using in vitro batch culture and in vivo studies. Research indicated significant differences (P < 0.05) in the dry matter, organic matter, ether extract, neutral detergent fiber, acid detergent fiber, cellulose and lignin contents of the C. ciliaris genotypes tested. Genotypes also differed (P < 0.05) in total carbohydrates, structural carbohydrates, non-structural carbohydrates and protein fractions. Genotype IG96-96 had the lowest total digestible nutrients, digestible energy and metabolizable energy contents (377.2 g/kg, 6.95 and 5.71 MJ/kg of dry matter, respectively), and net energy values for lactation, maintenance and growth. After 45 days of ensiling, C. ciliaris silages differed (P < 0.05) in dry matter, pH, and lactic acid contents, and their values ranged between 255-339, 4.06-5.17 g/kg of dry matter and 10.8-28.0 g/kg of dry matter, respectively. Maize silage had higher (P < 0.05) Organic Matter (919.5g/kg of dry matter), ether extract (20.4g/kg of dry matter) and hemi-cellulose (272.3 g/kg of dry matter) than IG96-401 and IG96-96 silages. The total carbohydrates and non-structural carbohydrates of maize silage were higher (P < 0.05), while structural carbohydrates were comparable (P < 0.05) with C. ciliaris silages. Sheep on maize silage had (P < 0.05) higher metabolizable energy, lower crude protein, and digestible crude protein intake (g/kg of dry matter) than those on C. ciliaris silage diets. Nitrogen intake and urinary-N excretion were higher (P < 0.05) on genotype IG96-96 silage diet. Overall, this study suggested that certain C. ciliaris genotypes, notably IG96-401 and IG96-96, exhibited nutritive values comparable to maize silage in sheep studies, offering a promising avenue for future exploration as potential alternatives in diversified and sustainable livestock nutrition programs.


Assuntos
Cenchrus , Genótipo , Valor Nutritivo , Silagem , Zea mays , Animais , Silagem/análise , Zea mays/genética , Zea mays/química , Ovinos , Cenchrus/genética , Cenchrus/metabolismo , Fenômenos Fisiológicos da Nutrição Animal , Feminino , Ração Animal/análise , Digestão
17.
Explor Target Antitumor Ther ; 5(3): 477-494, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38966181

RESUMO

In recent times, there have been notable advancements in comprehending the potential anti-cancer effects of chrysin (CH), a naturally occurring flavonoid compound found abundantly in various plant sources like honey, propolis, and certain fruits and vegetables. This active compound has garnered significant attention due to its promising therapeutic qualities and minimal toxicity. CH's ability to combat cancer arises from its multifaceted mechanisms of action, including the initiation of apoptosis and the inhibition of proliferation, angiogenesis, metastasis, and cell cycle progression. CH also displays potent antioxidant and anti-inflammatory properties, effectively counteracting the harmful molecules that contribute to DNA damage and the development of cancer. Furthermore, CH has exhibited the potential to sensitize cancer cells to traditional chemotherapy and radiotherapy, amplifying the effectiveness of these treatments while reducing their negative impact on healthy cells. Hence, in this current review, the composition, chemistry, mechanisms of action, safety concerns of CH, along with the feasibility of its nanoformulations. To conclude, the recent investigations into CH's anti-cancer effects present a compelling glimpse into the potential of this natural compound as a complementary therapeutic element in the array of anti-cancer approaches, providing a safer and more comprehensive method of combating this devastating ailment.

18.
J Commun Dis ; 45(1-2): 33-40, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-25141552

RESUMO

Lymphatic filariasis is a major public health problem of tropical countries. Although its elimination is planned as global effort using mass drug administration in affected communities but its impact has been influenced by MDA coverage across countries. The drug coverage is affected by fever as side effect and its continuation for over 6 years which affect the population participation. Therefore alternative approaches are needed which can show impact faster than standard MDA. Present research using additional 12 days dose of DEC to mf carriers, show that if drug coverage could be regular, sustainable impact could be created in 4 years.


Assuntos
Dietilcarbamazina/administração & dosagem , Dietilcarbamazina/uso terapêutico , Filariose Linfática/prevenção & controle , Filaricidas/administração & dosagem , Filaricidas/uso terapêutico , Adolescente , Criança , Pré-Escolar , Esquema de Medicação , Filariose Linfática/tratamento farmacológico , Feminino , Humanos , Índia/epidemiologia , Masculino , Serviços Preventivos de Saúde/métodos , Saúde da População Rural , População Rural , Resultado do Tratamento
19.
Animals (Basel) ; 13(23)2023 Nov 28.
Artigo em Inglês | MEDLINE | ID: mdl-38067027

RESUMO

This study evaluated 5 annual and 11 perennial Indian pasture legumes species for their nutritive value, dry matter and mineral contents and in vitro fermentation parameters. Legume species differed significantly (p < 0.05) in various nutritional aspects such as organic matter, crude protein (CP), ether extract, fibres and protein fractions. Perennial Clitoria ternateaa had higher (p < 0.05) buffer soluble protein (477), while neutral detergent soluble protein was highest in annually grown Lablab purpureus (420 g/kg CP). Atylosia scarabaeoides (AS) had higher levels of nonstructural carbohydrates (NSCs) (392 g/kg dry matter (DM)) than structural carbohydrates (SC) (367 g/kg DM). Its rapidly degradable fraction (51.7 g/kg (total carbohydrate) tCHO) was lower (p < 0.05) than other fractions of carbohydrates. Total digestible nutrients, digestible energy and metabolisable energy varied, with Desmodium virgatus (DV) having higher values and Stylosanthas seabrana (SSe) having the lowest. Predicted dry matter intake, digestible dry matter and relative feed value also showed significant differences (p < 0.05). Annual grasses such as Dolichos biflorus, Macroptilium atropurpureum, Rhynchosia minima (RM) were found to be better balanced with micro minerals. In vitro dry matter degradability, partition factor, short-chain fatty acids and microbial protein production of legumes varied significantly (p < 0.05). Gas and CH4 production (mL/g and mL/g (digestible DM) DDM) also varied, with Clitoria ternatea-blue having the highest gas production and C. ternatea -white (CT-w) and AS having lower CH4 production. Methane in total gas was low for DV, RM and CT-w (8.99%, 9.72% and 9.51%). Loss of DE and ME as CH4 varied (p < 0.05) among the legumes. Each legume offers unique benefits, potentially allowing for tailored combinations of annual and perennial legumes to optimize rumen feed efficiency.

20.
Front Genet ; 14: 1134779, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37035739

RESUMO

Breast cancer is the most commonly diagnosed cancer and a leading cause of death in women worldwide. It is a heterogeneous disease, as shown by the gene expression profiles of breast cancer samples. It begins in milk-producing ducts, with a high degree of diversity between and within tumors, as well as among cancer-bearing individuals. The enhanced prevalence of breast cancer is influenced by various hormonal, lifestyle, and environmental factors, and very early onset of the disease correlates strongly with the risk of local and distant recurrence. Many subtypes are difficult to treat with conventional therapeutic modalities, and therefore, optimal management and early diagnosis are the first steps to minimizing the mortality linked with breast cancer. The use of newer methods of nanotechnology extends beyond the concept of synthesizing drug delivery mechanisms into the creation of new therapeutics, such as delivering chemotherapeutics with nanomaterial properties. Exosomes, a class of nanovesicles, are emerging as novel tools for deciphering the patient-specific proteins and biomarkers across different disease models, including breast cancer. In this review, we address the role of exosomal miRNA in breast cancer diagnosis and treatment.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA