Development of Colloidal Gold Immunochromatography and Reverse-Transcription Loop-Mediated Isothermal Amplification Assays to Detect Lychnis Mottle Virus.

Lychnis mottle virus (LycMoV; genus Unassigned, family Secoviridae) infection of Angelica sinensis produces mottle and mosaic symptoms, damaging the host. Early detection of relevant pathogens is the most critical step in preventing the potential transmission of infectious disease. Polyclonal antibodies with high potency and high specificity were prepared using the recombinant LycMoV capsid protein as an antigen. Here, we developed and optimized a rapid colloidal gold immunochromatography assay (GICA) detection system for LycMoV using this antibody. Under optimum conditions, GICA specifically detected (up to 10,000-fold) positive LycMoV samples. A real-time reverse-transcription loop-mediated isothermal amplification (RT-LAMP) system was also established by selecting the primers with high sensitivity and specificity to LycMoV. The RT-LAMP detection threshold was 1.42 fg/µl (291 copies/µl). A GICA-RT-LAMP assay system was further established and optimized. The minimum GICA detection line was calculated at 1.52 × 10-2 ng/µl. Although GICA did not detect positive samples after capturing virus at 2.53 × 10-3 ng/µl, GICA-LAMP and GICA-RT-PCR did, whose sensitivity was comparatively greater than sixfold. This is the first report showing that GICA-RT-LAMP is a cost-effective approach for use in detecting LycMoV without extracting nucleic acids. These sensitive assays will help improve virus disease management in A. sinensis crops.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

Genetic diversity analysis of lychnis mottle virus and first identification of Angelica sinensis infection.

Gansu Province is a district renowned for the cultivation of Angelica sinensis (Oliv.) Diels, accounting for greater than 90% of China's total annual production. However, virus infection has caused a reduction in A. sinensis yield. Here, we collected suspected virus-infected A. sinensis leaf samples from Gansu Province's A. sinensis cultivation area. For the first time, using small RNA deep sequencing and RT-PCR, lychnis mottle virus (LycMoV) was found to naturally infect A. sinensis. The coat protein (cp) gene of the Gansu A. sinensis LycMoV isolate was obtained through cloning, where its nucleotide and amino acid identity was highest while having the closest affinity to the China Pearl (i.e., Prunus persica) isolate. Recombination analysis indicated that genetic recombination had only a limited influencing effect on the molecular evolution of LycMoV. Moreover, results from genetic diversity analysis indicated that the host, geographic isolation, and genetic drift may be the main factors that contributed to the formation of genetic diversity and differentiation in LycMoV. Furthermore, the LycMoV population trend was expansionary. Selection pressure may also be the main driver for the evolution of the entire LycMoV population, while the driving effect of genetic recombination is limited. This study marks a new LycMoV host (i.e., A. sinensis) for the first time and provides scientific support for the identification, prevention, and control of LycMoV.