Characterising resuscitation promoting factor fluorescent-fusions in mycobacteria.

BACKGROUND: Resuscitation promoting factor proteins (Rpfs) are peptidoglycan glycosidases capable of resuscitating dormant mycobacteria, and have been found to play a role in the pathogenesis of tuberculosis. However, the specific roles and localisation of each of the 5 Rpfs in Mycobacterium tuberculosis remain mostly unknown. In this work our aim was to construct fluorescent fusions of M. tuberculosis Rpf proteins as tools to investigate their function. RESULTS: We found that Rpf-fusions to the fluorescent protein mCherry are functional and able to promote cell growth under different conditions. However, fusions to Enhanced Green Fluorescent Protein (EGFP) were non-functional in the assays used and none were secreted into the extracellular medium, which suggests Rpfs may be secreted via the Sec pathway. No specific cellular localization was observed for either set of fusions using time-lapse video microscopy. CONCLUSIONS: We present the validation and testing of five M. tuberculosis Rpfs fused to mCherry, which are functional in resuscitation assays, but do not show any specific cellular localisation under the conditions tested. Our results suggest that Rpfs are likely to be secreted via the Sec pathway. We propose that such mCherry fusions will be useful tools for the further study of Rpf localisation, individual expression, and function.

Unnatural amino acid analogues of membrane-active helical peptides with anti-mycobacterial activity and improved stability.

OBJECTIVES: The emergence of MDR-TB, coupled with shrinking antibiotic pipelines, has increased demands for new antimicrobials with novel mechanisms of action. Antimicrobial peptides have increasingly been explored as promising alternatives to antibiotics, but their inherent poor in vivo stability remains an impediment to their clinical utility. We therefore systematically evaluated unnatural amino acid-modified peptides to design analogues with enhanced anti-mycobacterial activities. METHODS: Anti-mycobacterial activities were evaluated in vitro and intracellularly against drug-susceptible and MDR isolates of Mycobacterium tuberculosis using MIC, killing efficacy and intracellular growth inhibition studies. Toxicity profiles were assessed against mammalian cells to verify cell selectivity. Anti-mycobacterial mechanisms were investigated using microfluidic live-cell imaging with time-lapse fluorescence microscopy and confocal laser-scanning microscopy. RESULTS: Unnatural amino acid incorporation was well tolerated without an appreciable effect on toxicity profiles and secondary conformations of the synthetic peptides. The modified peptides also withstood proteolytic digestion by trypsin. The all d-amino acid peptide, i(llkk)2i (II-D), displayed superior activity against all six mycobacterial strains tested, with a 4-fold increase in selectivity index as compared with the unmodified l-amino acid peptide in broth. II-D effectively reduced the intracellular bacterial burden of both drug-susceptible and MDR clinical isolates of M. tuberculosis after 4 days of treatment. Live-cell imaging studies demonstrated that II-D permeabilizes the mycobacterial membrane, while confocal microscopy revealed that II-D not only permeates the cell membrane, but also accumulates within the cytoplasm. CONCLUSIONS: Unnatural amino acid modifications not only decreased the susceptibility of peptides to proteases, but also enhanced mycobacterial selectivity.

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis.

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-ß-hydroxysteroid dehydrogenase (3-ß HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P5228-ß-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

An Auto-luminescent Fluorescent BCG Whole Blood Assay to Enable Evaluation of Paediatric Mycobacterial Responses Using Minimal Blood Volumes.

Introduction: Understanding protective human immunity against mycobacteria is critical to developing and evaluating new vaccines against tuberculosis. Children are the most susceptible population to infection, disease, and death from tuberculosis, but also have the strongest evidence of BCG-inducible protection. Limited amounts of blood can be obtained for research purposes in paediatrics and therefore there is a need for high-yield, low-volume, human immunology assays. Methods: We transformed BCG Danish with plasmids encoding luciferase full operon derived from Photorhabdus luminescens together with Green Fluorescent Protein and antibiotic selection markers. We characterised the luminescent and fluorescent properties of this recombinant BCG strain (BCG-GFP-LuxFO) using a luminometer and flow cytometry and developed a paediatric whole blood in vitro infection model. Results: Luminescence of BCG-GFP-LuxFO correlated with optical density (Spearman Rank Correlation coefficient r = 0.985, p < 0.0001) and colony forming units (CFUs) in liquid culture medium (r = 0.971, p < 0.0001). Fluorescence of BCG-GFP-LuxFO in paediatric whole blood was confirmed by flow cytometry in granulocytes and monocytes 1 h following infection. Luminescence of BCG-GFP-LuxFO in whole blood corresponded with CFUs (r = 0.7123, p < 0.0001). Conclusion: The BCG-GFP-LuxFO assay requires 225 µL whole blood per sample, from which serial luminescence measurements can be obtained, together with biochemical analysis of supernatants and cellular assay applications using its fluorescent properties. This offers the opportunity to study human-mycobacterial interactions using multiple experimental modalities with only minimal blood volumes. It is therefore a valuable method for investigating paediatric immunity to tuberculosis.

Analysis of ParAB dynamics in mycobacteria shows active movement of ParB and differential inheritance of ParA.

Correct chromosomal segregation, coordinated with cell division, is crucial for bacterial survival, but despite extensive studies, the mechanisms underlying this remain incompletely understood in mycobacteria. We report a detailed investigation of the dynamic interactions between ParA and ParB partitioning proteins in Mycobacterium smegmatis using microfluidics and time-lapse fluorescence microscopy to observe both proteins simultaneously. During growth and division, ParB presents as a focused fluorescent spot that subsequently splits in two. One focus moves towards a higher concentration of ParA at the new pole, while the other moves towards the old pole. We show ParB movement is in part an active process that does not rely on passive movement associated with cell growth. In some cells, another round of ParB segregation starts before cell division is complete, consistent with initiation of a second round of chromosome replication. ParA fluorescence distribution correlates with cell size, and in sister cells, the larger cell inherits a local peak of concentrated ParA, while the smaller sister inherits more homogeneously distributed protein. Cells which inherit more ParA grow faster than their sister cell, raising the question of whether inheritance of a local concentration of ParA provides a growth advantage. Alterations in levels of ParA and ParB were also found to disturb cell growth.

Mycobacterium smegmatis is a suitable cell factory for the production of steroidic synthons.

A number of pharmaceutical steroid synthons are currently produced through the microbial side-chain cleavage of natural sterols as an alternative to multi-step chemical synthesis. Industrially, these synthons have been usually produced through fermentative processes using environmental isolated microorganisms or their conventional mutants. Mycobacterium smegmatis mc2 155 is a model organism for tuberculosis studies which uses cholesterol as the sole carbon and energy source for growth, as other mycobacterial strains. Nevertheless, this property has not been exploited for the industrial production of steroidic synthons. Taking advantage of our knowledge on the cholesterol degradation pathway of M. smegmatis mc2 155 we have demonstrated that the MSMEG_6039 (kshB1) and MSMEG_5941 (kstD1) genes encoding a reductase component of the 3-ketosteroid 9α-hydroxylase (KshAB) and a ketosteroid Δ1 -dehydrogenase (KstD), respectively, are indispensable enzymes for the central metabolism of cholesterol. Therefore, we have constructed a MSMEG_6039 (kshB1) gene deletion mutant of M. smegmatis MS6039 that transforms efficiently natural sterols (e.g. cholesterol and phytosterols) into 1,4-androstadiene-3,17-dione. In addition, we have demonstrated that a double deletion mutant M. smegmatis MS6039-5941 [ΔMSMEG_6039 (ΔkshB1) and ΔMSMEG_5941 (ΔkstD1)] transforms natural sterols into 4-androstene-3,17-dione with high yields. These findings suggest that the catabolism of cholesterol in M. smegmatis mc2 155 is easy to handle and equally efficient for sterol transformation than other industrial strains, paving the way for valuating this strain as a suitable industrial cell factory to develop à la carte metabolic engineering strategies for the industrial production of pharmaceutical steroids.

Mycobacterial Growth.

In this work, we review progress made in understanding the molecular underpinnings of growth and division in mycobacteria, concentrating on work published since the last comprehensive review ( Hett and Rubin 2008). We have focused on exciting work making use of new time-lapse imaging technologies coupled with reporter-gene fusions and antimicrobial treatment to generate insights into how mycobacteria grow and divide in a heterogeneous manner. We try to reconcile the different observations reported, providing a model of how they might fit together. We also review the topic of mycobacterial spores, which has generated considerable discussion during the last few years. Resuscitation promoting factors, and regulation of growth and division, have also been actively researched, and we summarize progress in these areas.

Cholesterol metabolism in Mycobacterium smegmatis.

The metabolism of cholesterol in Mycobacterium smegmatis mc(2) 155 has been investigated by using a microarray approach. The transcriptome of M. smegmatis growing in cholesterol was compared with that of cells growing in glycerol as the sole carbon and energy sources during the middle exponential phase. Microarray analyses revealed that only 89 genes were upregulated at least threefold during growth on cholesterol compared with growth on glycerol. The upregulated genes are scattered throughout the 7 Mb M. smegmatis genome and likely reflect a general physiological adaptation of the bacterium to grow on this highly hydrophobic polycyclic compound. Nevertheless, 39 of the catabolic genes are organized in three specific clusters. These results not only supported the role of KstR and KstR2 as auto-regulated repressors of cholesterol catabolism, and revealed some metabolic similarities and differences on actinobacteria, but more important, they have facilitated the identification of new catabolic genes, opening a research scenario that might provide important clues on the role of cholesterol in tuberculosis infection.