RESUMO
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
Assuntos
Citosina/química , Quadruplex G , Regiões Promotoras Genéticas , Proteína Wnt1/genética , Citosina/metabolismo , Metilação de DNA , Epigênese Genética , Ressonância Magnética Nuclear BiomolecularRESUMO
Enzymes catalyzing peptide macrocyclization are important biochemical tools in drug discovery. The three-residue cyclophane-forming enzymes (3-CyFEs) are an emerging family of post-translational modifying enzymes that catalyze the formation of three-residue peptide cyclophanes. In this report, we introduce three additional 3-CyFEs, including ChlB, WnsB, and FnnB, that catalyze cyclophane formation on Tyr, Trp, and Phe, respectively. To understand the promiscuity of these enzymes and those previously reported (MscB, HaaB, and YxdB), we tested single amino acid substitutions at the three-residue motif of modification (Ω1X2X3, Ω1 = aromatic). Collectively, we observe that substrate promiscuity is observed at the Ω1 and X2 positions, but a greater specificity is observed for the X3 residue. Two nonnative cyclophane products were characterized showing a Phe-C3 to Arg-Cß and His-C2 to Pro-Cß cross-links, respectively. We also tested the leader dependence of selected 3-CyFEs and show that a predicted helix region is important for cyclophane formation. These results demonstrate the biocatalytic potential of these maturases and allow rational design of substrates to obtain a diverse array of genetically encoded 3-residue cyclophanes.
Assuntos
Ciclofanos , Peptídeos , Sequência de Aminoácidos , Ciclização , Peptídeos/química , Processamento de Proteína Pós-TraducionalRESUMO
Cyclic peptide natural products have served as important drug molecules, with several examples used clinically. Enzymatic or chemical macrocyclization is the key transformation for constructing these chemotypes. Methods to generate new and diverse cyclic peptide scaffolds enabling the modular and predictable synthesis of peptide libraries are desirable in drug discovery platforms. Here we identify a suite of post-translational modifying enzymes from bacteria that install single or multiple strained cyclophane macrocycles. The crosslinking occurs on three-residue motifs that include tryptophan or phenylalanine to form indole- or phenyl-bridged cyclophanes. The macrocycles display restricted rotation of the aromatic ring and induce planar chirality in the asymmetric indole bridge. The biosynthetic gene clusters originate from a broad range of bacteria derived from marine, terrestrial and human microbiomes. Three-residue cyclophane-forming enzymes define a new and significant natural product family and occupy a distinct region in sequence-function space.