RESUMO
Type 3 resistant starch from Canna edulis (Ce-RS3) is an insoluble dietary fiber which could improve blood lipids in animals, but clinically robust evidence is still lacking. We performed a double-blind randomized controlled trial to assess the effects of Ce-RS3 on lipids in mild hyperlipidemia. One hundred and fifteen patients were included followed the recruitment criteria, and were randomly allocated to receive Ce-RS3 or placebo (native starch from Canna edulis) for 12 weeks (20â¯g/day). In addition to serum lipids, complete blood counts, serum inflammatory factors, antioxidant indexes, and dietary survey, 16â¯S rRNA sequencing technique was utilized to analyze the gut microbiota alterations. Targeted quantitative metabolomics (TQM) was used to detect metabolite changes. Compared with the placebo, Ce- RS3 significantly decreased levels of total cholesterol, lowdensity lipoprotein cholesterol, and non-high-density lipoprotein cholesterol, and increased the glutathione peroxidase. Based on the 16â¯S rRNA sequencing, TQM, the correlation analysis, as well as the Kyoto Encyclopedia of Genes (KEGG) and Genomes and Human Metabolome Database (HMDB) analysis, we found that Ce-RS3 could increase the abundances of genera Faecalibacterium and Agathobacter, while reduce the abundances of genera norank_f_Ruminococcaceae and Christensenellaceae_R-7_ group to regulate phenylalanine metabolism, which could reduce the fatty acid biosynthesis and fatty acid elongation in the mitochondria to lower blood lipids. Conclusively, we firstly confirmed the feasibility of Ce-RS3 for clinical application, which presents a novel, effective therapy for the mild hyperlipidemia. (Chictr. org. cn. Clinical study on anti-mild hyperlipidemia of Canna edulis RS3 resistant starch, ID Number: ChiCTR2200062871).
Assuntos
Microbioma Gastrointestinal , Hiperlipidemias , Humanos , Microbioma Gastrointestinal/efeitos dos fármacos , Método Duplo-Cego , Masculino , Pessoa de Meia-Idade , Hiperlipidemias/tratamento farmacológico , Hiperlipidemias/sangue , Hiperlipidemias/microbiologia , Feminino , Adulto , Lipídeos/sangue , Amido Resistente , Amido , Hipolipemiantes/uso terapêutico , Hipolipemiantes/farmacologia , IdosoRESUMO
Potato virus Y (PVY) is one of the most important pathogens in the genus Potyvirus that seriously harms agricultural production. Copper (Cu), as a micronutrient, is closely related to plant immune response. In this study, we found that foliar application of Cu could inhibit PVY infection to some extent, especially at 7 days post inoculation (dpi). To explore the effect of Cu on PVY infection, transcriptome sequencing analysis was performed on PVY-infected tobacco with or without Cu application. Several key pathways regulated by Cu were identified, including plant-pathogen interaction, inorganic ion transport and metabolism, and photosynthesis. Moreover, the results of virus-induced gene silencing (VIGS) assays revealed that NbMLP423, NbPIP2, NbFd and NbEXPA played positive roles in resistance to PVY infection in Nicotiana benthamiana. In addition, transgenic tobacco plants overexpressing NtEXPA11 showed increased resistance to PVY infection. These results contribute to clarify the role and regulatory mechanism of Cu against PVY infection, and provide candidate genes for disease resistance breeding.
Assuntos
Cobre , Resistência à Doença , Nicotiana , Doenças das Plantas , Potyvirus , Nicotiana/virologia , Nicotiana/genética , Potyvirus/fisiologia , Cobre/farmacologia , Doenças das Plantas/virologia , Resistência à Doença/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Perfilação da Expressão Gênica , Plantas Geneticamente Modificadas/virologia , Regulação da Expressão Gênica de Plantas , TranscriptomaRESUMO
Tomato yellow mottle-associated virus (TYMaV) belongs to the genus Cytorhabdovirus in the family Rhabdoviridae and has been reported to infect a variety of Solanaceae crops, such as Solanum lycopersicum, S. nigrum, Capsicum annuum and Nicotiana benthamiana (Li et al. 2022, Li et al. 2023, Xu et al. 2017, Zhou et al. 2019). In August 2022, about 500 out of 2000 tobacco (N. tabacum) plants showing leaf distortion, crinkling and mosaic symptoms were found in one tobacco growing field in Xingren City, Guizhou Province, China. To identify the causal pathogen(s), leaves from 20 symptomatic tobacco plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq) and assembly. Briefly, total RNA was extracted with TRIzol Reagent (Takara, Kusatsu, Japan). A small RNA cDNA library was constructed by the small RNA Sample Pre Kit. sRNA-Seq was performed with an Illumina NovaSeq 6000 platform. About 29 million reads were obtained and 334 contigs generated after removal of host-derived sequences. Among them, 31 unique contigs mapped to the TYMaV genome (NC_034240.1), covering 28.43% of the genome with the mean read coverage of 0.92%. Meanwhile, 226 contigs mapped to the genome of a potyvirus, chilli veinal mottle virus (ChiVMV, NC_005778.1), covering 88.79% of the genome with the mean read coverage of 0.83%. To verify the sRNA-Seq result for TYMaV identification, reverse transcription (RT)- PCR was performed with specific primers TYMaV-F (5'-CTGACGTAGTGTTGGCAGAT-3') and TYMaV-R (5'-AACCTCCATGCAGAACCATGG-3'). The expected-size 936-bp fragment was amplified from total RNA of all 20 samples. Dot enzyme-linked immunosorbent assays (Dot-ELISA) with antibody for TYMaV (kindly provided by Dr. Zhenggang Li from Guangdong Academy of Agricultural Sciences) were performed and further verified TYMaV infection. In addition, five asymptomatic tobacco plants from the same field as controls were used to detect TYMaV by RT-PCR and Dot-ELISA, and all samples showed negative test results. Subsequently, 17 primer pairs (Supplementary Table 1) were used to obtain the full-length sequence of TYMaV from a single positive tobacco sample by RT-PCR, followed by Sanger sequencing at Sangon Biotech (Shanghai, China). The resulting amplicon sequences were assembled into a nearly full-length genome sequence of a TYMaV isolate from tobacco in Guizhou (TYMaV-GZ). BLASTn analysis of the 13, 393 nt-long sequence (GeneBank accession number, PP444718) revealed 84.7% and 87.2% nt sequence identity with the TYMaV tomato isolate (KY075646.1) and the TYMaV S. nigrum isolate (MW527091.1), respectively. Moreover, five S. nigrum plants showing leaf crinkling and mosaic symptoms from tobacco fields tested positive for TYMaV by RT-PCR assay, suggesting a potential spread of TYMaV between tobacco and S. nigrum, which may serve as a reservoir for the virus in the tobacco fields. However, the transmission route of TYMaV remains unknown, and further verification is needed. To our knowledge, this is the first report of TYMaV infecting tobacco crop in China. It will be important to assess the potential economic importance of TYMaV to tobacco production in China and elsewhere, and to elucidate the respective roles of this virus and ChiVMV in the leaf distorting and yellowing symptoms.
RESUMO
SYAUP-491 is a novel alkyl sulfonamide. In this study, in vivo and in vitro tests were performed along with a proteomic analysis to determine the effects and underlying mechanisms of the antibacterial activity of SYAUP-491 against the causative agent of bacterial leaf blight in rice. The antibacterial test results suggested that SYAUP-491 exhibited significant activities against Xanthomonas oryzae pv. oryzae (Xoo) in vitro and in vivo. The minimal EC50 values reached 6.96 µg/mL and the curative activity reached 74.1%. Detailed studies demonstrated that SYAUP-491 altered membrane permeability and caused morphological changes. Based on proteomics results, SYAUP-491 might inhibit bacterial protein synthesis. SYAUP-491 may disrupt and alter cell membrane permeability and could further act on ribosomes in the bacterial body. Given the above results, SYAUP-491 could serve as a new lead compound in the research of antibacterial control of plant pathogenic bacterial disease.
Assuntos
Oryza , Xanthomonas , Proteômica , Antibacterianos/farmacologia , Sulfonamidas , Oryza/microbiologia , Doenças das Plantas/prevenção & controle , Doenças das Plantas/microbiologia , Testes de Sensibilidade MicrobianaRESUMO
BACKGROUND: Vascular dementia (VaD) is a prevalent neurodegenerative disease characterized by cognitive impairment due to cerebrovascular factors, affecting a significant portion of the aging population and highlighting the critical need to understand specific targets and mechanisms for effective prevention and treatment strategies. We aimed to identify pathways and crucial genes involved in the progression of VaD through bioinformatics analysis and subsequently validate these findings. METHODS: We conducted differential expression analysis, Weighted Gene Co-expression Network Analysis (WGCNA), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, and Protein-Protein Interaction (PPI) analysis. We utilized pheochromocytoma 12 (PC12) cells to create an in vitro oxygen-glucose deprivation (OGD) model. We investigated the impact of overexpression and interference of adrenoceptor alpha 1D (ADRA1D) on OGD PC12 cells using TdT-mediated dUTP nick-end labeling (TUNEL), reverse transcription-quantitative polymerase chain reaction (RT-qPCR), western blot (WB), and Fluo-3-pentaacetoxymethyl ester (Fluo-3 AM) analysis. RESULTS: We found 187 differentially expressed genes (DEGs) in the red module that were strongly associated with VaD and were primarily enriched in vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction, mitogen-activated protein kinase (MAPK) signaling pathway, and cell adhesion. Among these pathways, we identified ADRA1D as a gene shared by vasoconstriction, G protein-coupled amine receptor activity, and neuroactive ligand-receptor interaction. The TUNEL assay revealed a significant decrease in PC12 cell apoptosis with ADRA1D overexpression (p < 0.01) and a significant increase in apoptosis upon silencing ADRA1D (p < 0.01). RT-qPCR and WB analysis revealed elevated ADRA1D expression (p < 0.001) and decreased phospholipase C beta (PLCß) and inositol 1,4,5-trisphosphate receptor (IP3R) expression (p < 0.05) with ADRA1D overexpression. Moreover, the Fluo-3 AM assessment indicated significantly lower intracellular Ca2+ levels with ADRA1D overexpression (p < 0.001). Conversely, interference with ADRA1D yielded opposite results. CONCLUSION: Our study provides a new perspective on the pathogenic mechanisms of VaD and potential avenues for therapeutic intervention. The results highlight the role of ADRA1D in modulating cellular responses to OGD and VaD, suggesting its potential as a target for VaD treatment.
Assuntos
Compostos de Anilina , Demência Vascular , Doenças Neurodegenerativas , Xantenos , Animais , Ratos , Humanos , Idoso , Demência Vascular/genética , Ligantes , Aminas , Transdução de Sinais/genética , Proteínas de Ligação ao GTPRESUMO
BACKGROUND: To cure advanced hypopharyngeal squamous cell carcinoma (HPSCC), primary operation followed by adjuvant (chemo-)radiotherapy (OP-CRT) or definitive chemoradiation (CCRT) are the two primary options. This study aimed to compare the failure patterns and long-term survival outcomes of HPSCC patients treated with these two strategies. PATIENTS AND METHODS: From 2007 to 2015, 198 pathologically confirmed HPSCC patients receiving either OP-CRT or CCRT were retrospectively reviewed. Failure patterns and survival outcomes stratified by the 7th American Joint Committee on Cancer staging system and treatment modalities were compared. RESULTS: One hundred and eighty-nine patients (95.4%) were stage III/IV and 62 patients (31.3%) received OP-CRT. Median follow-up duration was 4.9 years. Compared with CCRT, OP-CRT provided better 3-year local relapse-free survival for T3 (93 vs 48%, p < 0.0001), T4a (88 vs 37%, p = 0.0005) and better 3-year regional relapse-free survival for N2b+2c (93 vs 60%, p < 0.0001). Of note, for stage IVA subjects, OP-CRT provided better 3-year loco-regional relapse-free survival (85 vs 37%, p < 0.0001), marginal poor 3-year distant metastasis-free survival (62 vs 79%, p = 0.06), but comparable 3-year OS (52 vs 44%, p = 0.37) and 5-year OS (44 vs 31%, p = 0.15) compared with CCRT. CONCLUSIONS: For patients with advanced HPSCC, although OP-CRT and CCRT provided similar overall survival, failure patterns were distinct. OP-CRT provided better loco-regional control but was more likely to encounter distant metastases than CCRT. The detailed analysis of failure patterns will pave the way to improve this devastating disease.
Assuntos
Neoplasias Hipofaríngeas , Humanos , Estudos Retrospectivos , Neoplasias Hipofaríngeas/cirurgia , Estadiamento de Neoplasias , Recidiva Local de Neoplasia/terapia , QuimiorradioterapiaRESUMO
Type 2C protein phosphatases (PP2Cs) play key roles in regulating plant senescence and ripening. Here, we discovered a subfamily F PP2C, SlPP2C, associated with leaf senescence through transcriptome analysis. The gene expression, protein accumulation, and promoter activity of SlPP2C all gradually increased along with the progression of leaf and flower senescence and fruit ripening in tomato. Also, the expression of SlPP2C was highly up-regulated by the senescent-inducible hormone treatments, showing more sensitivity to ethylene (ETH) and abscisic acid (ABA). Meanwhile, SlPP2C RNA interference (RNAi) tomato transgenic lines showed obvious delayed senescence and ripening phenotypes of leaves, flowers, and fruits. SlPP2C RNAi lines delayed leaf senescence with higher chlorophyll fluorescence and content, and lower expressions of senescence marker genes (SlSGR1 and SlSAG12) compared to WT. SlPP2C RNAi lines clearly delayed flower senescence time; it was at least twice longer than WT. SlPP2C RNAi lines delayed fruit ripening, exhibiting higher firmness and lower polygalacturonase activity compared to WT. In addition, we proved that SlPP2C is unable to interact with any of the ABA receptors (SlPYLs). Together, the results demonstrate that SlPP2C is a senescence-related and ripening-related gene.
Assuntos
Senescência Vegetal , Solanum lycopersicum , Solanum lycopersicum/genética , Frutas/metabolismo , Ácido Abscísico/farmacologia , Ácido Abscísico/metabolismo , Etilenos/metabolismo , Folhas de Planta/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Regulação da Expressão Gênica de PlantasRESUMO
Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.
RESUMO
Phytophthora parasitica is a highly destructive oomycete plant pathogen that is capable of infecting a wide range of hosts including many agricultural cash crops, fruit trees, and ornamental garden plants. One of the most important diseases caused by P. parasitica worldwide is black shank of tobacco. Rapid, sensitive, and specific pathogen detection is crucial for early rapid diagnosis which can facilitate effective disease management. In this study, we used a genomics approach to identify repeated sequences in the genome of P. parasitica by genome sequence alignment, and identified a 203 bp P. parasitica-specific sequence, PpM34, that is present in 31-60 copies in the genome. The P. parasitica genome-specificity of PpM34 was supported by PCR amplification of 24 genetically diverse strains of P. parasitica, 32 strains representing twelve other Phytophthora species, one Pythium specie, six fungal species and three bacterial species, all of which are plant pathogens. Our PCR and real-time PCR assays showed that the PpM34 sequence was highly sensitive in specifically detecting P. parasitica. Finally, we developed a PpM34-based high-efficiency Recombinase Polymerase Amplification (RPA) assay, which allowed us to specifically detect as little as 1 pg of P. parasitica total DNA from both pure cultures and infected Nicotiana benthamiana at 39°C using a fluorometric thermal cycler. The sensitivity, specificity, convenience and rapidity of this assay represents a major improvement for early diagnosis of P. parasitica infection.
RESUMO
In the traditional method of the bio-fabrication of zinc oxide nanoparticles (ZnONPs), bacterial strains face metal toxicity and antimicrobial action. In the current study, an alkalescent nucleoside antibiotic was mixed with zinc hexanitrate to fabricate the ZnONPs. An integrated approach of DIAION HP-20 macroporous resin and sephadex LH-20 column chromatography was adopted to separate and purify alkalescent nucleoside AN03 from Streptomyces koyanogensis. Alkalescent nucleoside was confirmed by the Doskochilova solvent system. The bio-fabricated ZnONPs were characterized by using Fourier transform infrared (FTIR), X-ray diffraction (XRD), and transmission electron microscopy (TEM) analyses. The XRD spectrum and the TEM images confirmed the crystallinity and the spherical shape of the ZnONPs with an average size of 22 nm. FTIR analysis showed the presence of functional groups, which confirmed the bio-fabrication of ZnONPs from alkalescent nucleoside ANO3. In-vitro studies showed that 75 µg/mL of ZnONPs had a strong inhibitory zone (28.39 mm) against the Magnaporthe grisea and significantly suppressed the spore germination. SEM and TEM observations respectively revealed that ZnONPs caused breakage in hyphae and could damage the cells of M. grisea. Greenhouse experiments revealed that the foliar spray of ZnONPs could control the rice blast disease by 98%. Results also revealed that ZnONPs had positive effects on the growth of the rice plant. The present study suggested that ZnONPs could be fabricated from microbe-derived nucleoside antibiotics without facing the problems of metal toxicity and antimicrobial action, thus overcoming the problem of pathogen resistance. This could be a potent biocontrol agent in rice blast disease management.
Assuntos
Magnaporthe , Nanopartículas , Oryza , Óxido de Zinco , Antibacterianos/farmacologia , Antibacterianos/química , Óxido de Zinco/química , Nucleosídeos/farmacologia , Pyricularia grisea , Nanopartículas/química , Oryza/microbiologiaRESUMO
Maize lethal necrosis (MLN), one of the most important maize viral diseases, is caused by maize chlorotic mottle virus (MCMV) infection in combination with a potyvirid, such as sugarcane mosaic virus (SCMV). However, the resistance mechanism of maize to MLN remains largely unknown. In this study, we obtained isoform expression profiles of maize after SCMV and MCMV single and synergistic infection (S + M) via comparative analysis of SMRT- and Illumina-based RNA sequencing. A total of 15,508, 7567, and 2378 differentially expressed isoforms (DEIs) were identified in S + M, MCMV, and SCMV libraries, which were primarily involved in photosynthesis, reactive oxygen species (ROS) scavenging, and some pathways related to disease resistance. The results of virus-induced gene silencing (VIGS) assays revealed that silencing of a vitamin C biosynthesis-related gene, ZmGalDH or ZmAPX1, promoted viral infections, while silencing ZmTAT or ZmNQO1, the gene involved in vitamin E or K biosynthesis, inhibited MCMV and S + M infections, likely by regulating the expressions of pathogenesis-related (PR) genes. Moreover, the relationship between viral infections and expression of the above four genes in ten maize inbred lines was determined. We further demonstrated that the exogenous application of vitamin C could effectively suppress viral infections, while vitamins E and K promoted MCMV infection. These findings provide novel insights into the gene regulatory networks of maize in response to MLN, and the roles of vitamins C, E, and K in conditioning viral infections in maize.
Assuntos
Ácido Ascórbico , Potyvirus , Transcriptoma , Potyvirus/fisiologia , Vitaminas , Zea mays/genética , Doenças das Plantas/genéticaRESUMO
Cyetpyrafen is a compound that lacks inherent uptake and systemic translocation activity. If mites do not come into direct contact with the pesticide solution on leaves, the efficacy cannot be achieved. Controlling the particle size can potentially play a crucial role in the manifestation of efficacy. In this study, high-throughput formulation technology was used to systematically screen a large number of adjuvants to obtain cyetpyrafen formulations. The particle size of the active ingredient in the formulation was measured. By examining the dynamic light scattering and contact angle, we simulated the actual process of the efficacy transmission of cyetpyrafen formulations against Tetranychus cinnabarinus. Our results showed that the activity of cyetpyrafen increases as the particle size decreases, suggesting that reducing the particle size can enhance the coverage and deposition on crop leaves, and further improve the dispersion efficiency and enhance spreading capabilities. Furthermore, controlling the particle size at 160 nm resulted in an LC50 value of 0.2026, which is approximately double than that of the commercial product. As a novel pesticide for mites, our study presents the most effective cyetpyrafen formulation in practice. Our findings provide valuable insights into controlling other mite species that pose a threat to agricultural products.
Assuntos
Ácaros , Praguicidas , Animais , Praguicidas/farmacologia , Tamanho da Partícula , Agricultura , Dose Letal MedianaRESUMO
Tobacco target spot disease is caused by Rhizoctonia solani AG-3 TB, which causes serious harm to the quality and yield of tobacco. In this study, thin layer chromatography (TLC), high performance liquid chromatography (HPLC), infrared absorption spectroscopy (IR), and nuclear magnetic resonance spectroscopy (NMR) were used to purify and identify the potential phytotoxin produced by R. solani AG-3 TB. The result indicated that the purified toxin compound was 3-methoxyphenylacetic acid (3-MOPAA) (molecular formula: C9H10O3). The exogenous purified compound 3-MOPAA was tested, and the results revealed that 3-MOPAA can cause necrosis in tobacco leaves. 3-MOPAA is a derivative of phenylacetic acid (PAA), which should be produced by specific enzymes, such as hydroxylase or methylase, in the presence of PAA. These results enrich the research on the pathogenic phytotoxins of R. solani and provide valuable insights into the pathogenic mechanism of AG-3 TB.
Assuntos
Nicotiana , Toxinas Biológicas , Pirrolidinonas , RhizoctoniaRESUMO
BACKGROUND: Early, precise and simultaneous identification of plant viruses is of great significance for preventing virus spread and reducing losses in agricultural yields. METHODS AND RESULTS: In this study, the identification of plant viruses from symptomatic samples collected from a cigar tobacco planting area in Deyang and a flue-cured tobacco planting area in Luzhou city, Sichuan Province, China, was conducted by deep sequencing of small RNAs (sRNAs) through an Illumina sequencing platform, and plant virus-specific contigs were generated based on virus-derived siRNA sequences. Additionally, sequence alignment and phylogenetic analysis were performed to determine the species or strains of these viruses. A total of 27930450, 21537662 and 28194021 clean reads were generated from three pooled samples, with a total of 105 contigs mapped to the closest plant viruses with lengths ranging from 34 ~ 1720 nt. The results indicated that the major viruses were potato virus Y, Chilli veinal mottle virus, tobacco vein banding mosaic virus, tobacco mosaic virus and cucumber mosaic virus. Subsequently, a fast and sensitive multiplex reverse transcription polymerase chain reaction assay was developed for the simultaneous detection of the most frequent RNA viruses infecting cigar and flue-cured tobacco in Sichuan. CONCLUSIONS: These results provide a theoretical basis and convenient methods for the rapid detection and control of viruses in cigar- and flue-cured tobacco.
Assuntos
Perfilação da Expressão Gênica/métodos , Nicotiana/virologia , Pequeno RNA não Traduzido/genética , RNA-Seq/métodos , Vírus/classificação , Cucumovirus/genética , Cucumovirus/isolamento & purificação , Cucumovirus/patogenicidade , Resistência à Doença , Evolução Molecular , Reação em Cadeia da Polimerase Multiplex , Filogenia , Folhas de Planta/genética , Folhas de Planta/virologia , Potyvirus/genética , Potyvirus/isolamento & purificação , Potyvirus/patogenicidade , RNA Viral/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Alinhamento de Sequência , Nicotiana/genética , Vírus do Mosaico do Tabaco/genética , Vírus do Mosaico do Tabaco/isolamento & purificação , Vírus do Mosaico do Tabaco/patogenicidade , Vírus/genética , Vírus/isolamento & purificaçãoRESUMO
AIMS: Lovastatin has been indicated to impair growth and development of Phytophthora sojae. Therefore, this study was performed to understand the inhibitory mechanism of lovastatin and investigate the metabolic pathway potentially served as a new control target for this plant pathogen. METHODS AND RESULTS: Whole transcriptome analysis of lovastatin-treated P. sojae was performed by RNA-sequencing. The results revealed that 84 genes were upregulated and 58 were downregulated with more than fourfold changes under treatment. Kyoto Encyclopaedia of Genes and Genomes analysis indicated that the branched-chain amino acids (BCAAs) biosynthesis pathway was abundantly enriched. All enzymes in the BCAAs biosynthesis pathway were identified in the P. sojae genome. Moreover, the study found that the herbicide flumetsulam targeting acetohydroxyacid synthase (AHAS) of the BCAAs biosynthesis pathway could effectively inhibit mycelial growth of P. sojae. CONCLUSIONS: Lovastatin treatment significantly influences the BCAAs biosynthesis pathway in P. sojae. Moreover, the herbicide flumetsulam targets AHAS and inhibits growth of P. sojae. SIGNIFICANCE AND IMPACT OF THE STUDY: The present study revealed that BCAAs biosynthesis pathway was influenced by lovastatin treatment and its key enzyme AHAS was identified as a potential new control target, which provides clues for exploring more oomycetes to control plant diseases caused by P. sojae.
Assuntos
Herbicidas , Phytophthora , Phytophthora/genética , Transcriptoma , Aminoácidos de Cadeia Ramificada/metabolismo , Lovastatina/farmacologia , Lovastatina/metabolismo , Doenças das Plantas/prevenção & controle , Herbicidas/farmacologia , Glycine max/metabolismoRESUMO
Tabernaemontana bufalina Lour. is extensively cultivated as an ornamental plant in Hainan, Guangdong, and other regions of southern China. In January 2020, we observed a rust disease on T. bufalina leaves in Sanya (18.15ãN and 109.30ãE) Hainan, China, and the rust occurred all year-round. In the early stage of rust, yellow chlorotic spots appeared, and then uredinia on the abaxial leaf surface became visible. Uredinia (approximately 200-700 µm in diameter) were mostly yellowish-brown in color, solitary, and irregularly scattered. In the late stage of the disease, spots were connected into lesions, and eventually, the whole leaf became severely chlorotic. Urediniospores were light brown, subglobose, measured 25-30 µm × 20-25 µm. They had two pores and were echinulate with spines spaced 2-5 µm. The teliospores were naked, scattered, or aggregated on severely infected leaves. They were two-celled, measured 33-40 µm × 25-30 µm, elliptic, dark brown, and covered with tiny spines. The teliospores had a colorless pedicel at one end which was approximately 28-34 µm long and enlarged at the lower part. The morphological characteristics of the spores were consistent with the descriptions of Puccinia engleriana Henn. (Hennings 1905). In China, P. engleriana was first identified on the leaves of Tabernaemontana divaricata (L.) in Yunnan province, and recorded as new to China in 2012 (Zhuang 2012). Untill now, no leaf rust caused by P. engleriana has been reported in Hainan. Urediniospores were collected and DNA was extracted using a Quick-DNA extraction Kit (TIANGEN Biotech, Beijing, China). The nuclear large subunit (28S) region of the ribosomal DNA repeat was amplified with primers Rust28SF (Aime et al. 2018) and LR5 (Vilgalys and Hester 1990) following the protocol of Aime and McTaggart (2021). The length of the large subunit sequence was 1,010 bp. When searched the GenBank database, the sequence showed 97.07% homology to the large subunit ribosomal RNA gene (Sequence ID: MW147048.1) of P. engleriana, and 92.5% similarity with 18S ribosomal RNA gene (Sequence ID: KM249855.1) of P. hemerocallidis. This result was consistent with the morphological identification. As for the 3% difference in large subunit ribosomal RNA gene, it was speculated that it may be related to the differences of geographical distribution and host plants, as the reference P. engleriana was obtained from Tabernaemontana orientalis in Australia (Aime and McTaggart 2021). The large subunit sequence was submitted into the GenBank database, with accession No. MZ314895. T. bufalina cutting seedlings with 4 available leaves were used in the Koch's postulate test. These seedlings were planted in a greenhouse with a 14 h/10 h light/dark photoperiod at 28°C and 65% humidity. The urediniospores suspension (5ï´107/ml in 0.05% Tween 20 solution) was sprayed on 6 healthy seedlings and other 6 seedlings were sprayed with 0.05% Tween 20 solution as a negative control. Two weeks after inoculation, leaf chlorosis and yellowish uredinia were observed on the inoculated seedlings, whereas the non-inoculated seedlings stayed healthy. To our knowledge, this is the first report of P. engleriana causing leaf rust on T. bufalina in Hainan province. This report will provide the reference for future investigation of T. bufalina leaf rust, and for further improvement on the knowledge of the geographical distribution of P. engleriana in China.
RESUMO
Recently, rapid advances in nanotechnology have provided a lot of opportunities for the mass production of engineered nanomaterials of various types of chemicals, including metals and nonmetals, promoting the development of a new generation of industrial and commercial products and the field of nanomedicine [...].
Assuntos
Nanoestruturas , Nanotecnologia , Nanomedicina , Nanoestruturas/toxicidadeRESUMO
As an important microbial resource, Actinomycetes, especially Streptomyces, have important application values in medicine and biotechnology. Streptomyces fungicidicus SYH3 was isolated from soil samples in tomato-growing areas and showed good inhibitory effects on Alternaria solani in tomato. To obtain pure active compounds, SYH3 fermentation broth was subjected to XAD-16 macroporous resin and silica gel column chromatography. Combined with the repeated preparation and separation of preparative high-performance liquid chromatography (HPLC), a total of four monomer compounds were obtained after activity tracking. Compound 4 was identified as a new six-membered lactone ring compound named 6-(5-hydroxy-6-methylheptyl)-5,6-dihydro-2H-pyran-2-one by 1D and 2D nuclear magnetic resonance (NMR) data and mass spectrometry (MS). The other three active compounds belong to the cyclodipeptide, and their half maximal inhibitory concentration (IC50) values against A. solani were 43.4, 42.9, and 30.6 µg/mL, respectively. Compound 4 significantly inhibited the spore germination and induced swollen and deformed local hyphae of A. solani with an IC50 value of 24.9 µg/mL. Compound 4 also had broad-spectrum antifungal activity and had a good antifungal effect on the tested plant-pathogenic fungi. The modes of action of new compound (4) still require further investigation, representing a novel and effective anti-fungal agent for future application.
Assuntos
Antifúngicos , Streptomyces , Alternaria , Antifúngicos/química , Dipeptídeos/farmacologia , Testes de Sensibilidade Microbiana , Piranos , Streptomyces/químicaRESUMO
Drought stress hinders the growth and development of crop plants and ultimately its productivity. It is expected that drought stress will be frequent and intense in the future due to drastic changes in the global climate. It is necessary to make crop plants more resilient to drought stress through various techniques; drought-hardening is one of them. Defining various metabolic strategies used by tobacco plants to confer drought tolerance will be important for maintaining plant physiological functions, but studies addressing this topic are limited. This study was designed to elucidate the drought tolerance and adaptation strategies used by tobacco plants via the application of different circular drought-hardening cycles (control: no drought-hardening, T1: one cycle of drought hardening, T2: two cycles of drought-hardening, and T3: three cycles of drought-hardening) to two tobacco varieties namely Honghuadajinyuan (H) and Yun Yan-100 (Y). The results revealed that drought-hardening decreased the fresh and dry biomass of the tobacco plants. The decrease was more pronounced in the T3 treatment for both H (23 and 29%, respectively) and Y (26 and 31%, respectively) under drought stress. The MDA contents, especially in T1 and T2 in both varieties, were statistically similar compared with control under drought stress. Similarly, higher POD, APX, and GR activities were observed, especially in T3, and elevated amounts of AsA and GSH were also observed among the different circular drought-hardening treatments under drought stress. Thus circular drought-hardening mitigated the oxidative damage by increasing the antioxidant enzyme activities and elevated the content of antioxidant substances, a key metabolic strategy under drought stress. Similarly, another important plant metabolic strategy is the osmotic adjustment. Different circular drought-hardening treatments improved the accumulation of proline and soluble sugars contents which contributed to osmoregulation. Finally, at the molecular level, circular drought-hardening improved the transcript levels of antioxidant enzyme-related genes (CAT, APX1, and GR2), proline and polyamines biosynthesis-related genes (P5CS1 and ADC2), and ABA signaling (SnRK2), and transcription factors (AREB1 and WRKY6) in response to drought stress. As a result, circular drought-hardening (T2 and T3 treatments) promoted tolerance to water stress via affecting the anti-oxidative capacity, osmotic adjustment, and regulation of gene expression in tobacco.
Assuntos
Secas , Nicotiana , Antioxidantes , Expressão Gênica , Regulação da Expressão Gênica de Plantas , Osmorregulação , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Plantas Geneticamente Modificadas/metabolismo , Estresse Fisiológico , Nicotiana/genética , Nicotiana/metabolismoRESUMO
Sea buckthorn (Hippophae rhamnoides) is an important deciduous shrub for fruit and ecological restoration in arid and semi-arid regions of China. Twelve Chinese and Russian cultivars (cv. Shenqiuhong, eshi01, ... eshi11) were planted about 1.6 acre area in a seedling nursery, located in Qingyang City of Gansu province in northwest China, where high mortality (more than 70%) of sea buckthorn was observed in late July 2019. Symptoms consisted of massive chlorosis, drooping leaves and dried-up stems on 5-year-old trees. Pieces of tree roots and stems with irregular light-brown discoloration in the xylem vessels were selected. Small pieces of discolored tissue were surface disinfested (1 min in 1% sodium hypochlorite, followed by three rinses with sterile distilled water), air-dried, and placed on potato dextrose agar (PDA) medium for 5 days at 25°C in the dark. A fungus was consistently isolated from both diseased roots and stems tissues. Colonies on PDA grew rapidly. Dense mycelia were pinky-white initially, and became carmine red color with age on the undersurface of the plate. Macroconidia were moderately curved, 3 to 5 marked septa, hyaline, thick walled, and measuring 27.8± 3.6 µm × 4.8 ± 0.5 µm (n = 30). Microconidia were abundant, pear-shaped, ellipsoid to fusoid, often with a papilla at the base, and 8.4 ± 2.2 µm ×3.1 ± 0.3 µm (n = 30). Genomic DNA was extracted for amplification and sequencing of the internal transcribed spacer region (ITS1 and ITS4 primers) (White et al. 1990) of the ribosomal DNA (Accession Nos. MN160235 to MN160238) and translation elongation factor-1 alpha (EF1 and EF2 primers, accession Nos. MN429075 to MN429078) (O'Donnell et al. 1998). The sequences revealed 99% similarity to the sequences of the ITS (AY188917), and 100% identity with EF1-α (JF740808) regions of Fusarium sporotrichioides. Based on morphological and molecular characteristics, the fungus was identified as F. sporotrichioides (Leslie and Summerell 2006). Koch's postulates were fulfilled on healthy, potted 1-year-old sea buckthorn seedings using two isolates in a greenhouse at 25 °C, 90% relative humidity, and 12-hour light/dark photoperiod. Ten potted seedings were inoculated on the stems by placing a 5-mm-diameter mycelial plug (5-day-old PDA cultures for each isolate) into the surface of a wound created with a needle, and the inoculation sites were covered with Parafilm to maintain moisture. Ten seedings were inoculated with PDA plugs as controls. Seven to ten days after inoculation, typical symptoms of dark-brown necrotic lesions on chlorotic leaf margins were observed. About 2 weeks after inoculation, the inoculated stems were gradually dry up, accompanied by withering and fallen leaves. Control plants remained asymptomatic. Pathogens were successfully isolated from the inoculated stems again, exhibiting morphological characteristics identical to those of F. sporotrichioides. Previous papers reported F. sporotrichioides as a common pathogen caused lavender wilt (Cosic et al. 2012), foliar spots on forage corn (Moya-Elizondo et al. 2013) and maize ear rot (Wang et al. 2019). To our knowledge, this is the first report of sea buckthorn stem wilt caused by F. sporotrichioides on several Chinese and Russian cultivars in Gansu province of China. In Heilongjiang province, the same disease was reported in 2010 (Song et al. 2010), nearly 30 longitudes away from Gansu province. Therefore, this disease appears to be a serious risk for future sea buckthorn production.