RESUMEN
Gene therapy is a focus of interest in both human and veterinary medicine, especially in recent years due to the potential applications of CRISPR/Cas9 technology. Another relatively new approach is that of epigenetic therapy, which involves an intervention based on epigenetic marks, including DNA methylation, histone post-translational modifications, and post-transcription modifications of distinct RNAs. The epigenome results from enzymatic reactions, which regulate gene expression without altering DNA sequences. In contrast to conventional CRISP/Cas9 techniques, the recently established methodology of epigenetic editing mediated by the CRISPR/dCas9 system is designed to target specific genes without causing DNA breaks. Both natural epigenetic processes and epigenetic editing regulate gene expression and thereby contribute to maintaining the balance between physiological functions and pathophysiological states. From this perspective, knowledge of specific epigenetic marks has immense potential in both human and veterinary medicine. For instance, the use of epigenetic drugs (chemical compounds with therapeutic potential affecting the epigenome) seems to be promising for the treatment of cancer, metabolic, and infectious diseases. Also, there is evidence that an epigenetic diet (nutrition-like factors affecting epigenome) should be considered as part of a healthy lifestyle and could contribute to the prevention of pathophysiological processes. In summary, epigenetic-based approaches in human and veterinary medicine have increasing significance in targeting aberrant gene expression associated with various diseases. In this case, CRISPR/dCas9, epigenetic targeting, and some epigenetic nutrition factors could contribute to reversing an abnormal epigenetic landscape to a healthy physiological state.
RESUMEN
Background: Chemical modifications in mRNAs, tRNAs, rRNAs, and non-coding RNAs stabilize these nucleic acids and regulate their function. In addition to regulating the translation of genetic information from mRNA to proteins, it has been revealed that modifications in RNAs regulate repair processes in the genome. Methods: Using local laser microirradiation, confocal microscopy, dot blots, and mass spectrometry we studied the role of N7-methylguanosine (m7G), which is co-transcriptionally installed in RNA. Results: Here, we show that after UVC and UVA irradiation, the level of m7G RNA is increased initially in the cytoplasm, and after local laser microirradiation, m7G RNA is highly abundant in UVA-damaged chromatin. This process is poly(ADP-ribose) polymerase (PARP)-dependent, but not accompanied by changes in the level of m7G-writers, including methyltransferases RNMT, METTL1, and WBSCR22. We also observed that METTL1 deficiency does not affect the recruitment of m7G RNA to microirradiated chromatin. Analyzing the levels of mRNA, let-7e, and miR-203a in both the cytoplasm and the cell nucleus, we revealed that UVC irradiation changed the level of mRNA, and significantly increased the pool of both let-7e and miR-203a, which correlated with radiation-induced m7G RNA increase in the cytoplasm. Conclusions: Irradiation by UV light increases the m7G RNA pool in the cytoplasm and in the microirradiated genome. Thus, epigenetically modified RNAslikely contribute to DNA damage responses or m7G signals the presence of RNA damage.
RESUMEN
Introduction: There have only been a few molecular studies conducted on the detection of T. gondii in tissues of carnivores in South Africa, with no data on the genetic diversity of this parasite. That is why the aim of this study was to detect and genotype T. gondii DNA in tissues of selected wild and domestic carnivores in South Africa. Methods: Samples were collected from 80 animals of 20 species (mainly road-killed) in the four provinces of Limpopo (n=57), Mpumalanga (n=21), Gauteng (n=1) and Free State (n=1) during the period 2014-2018. Samples of brain (n=31), heart (n=4), liver (n=40), spleen (n=2) and lung (n=3) were used to detect T. gondii by real-time PCR targeting a 529 bp repeating fragment of T. gondii DNA. Samples that were positive in real-time PCR were genotyped using 15 microsatellite markers. Results: T. gondii DNA was detected in 4 (5 %) samples: in the brain from a Black-backed Jackal (Canis mesomelas), in the liver from a African Wildcat (Felis silvestris lybica) and in the liver and heart of two Rusty-spotted Genets (Genetta maculata) respectively. The DNA sample from Black-backed Jackal was genotyped and characterized as belonging to the type Africa 4 lineage (equivalent to RFLP genotype ToxoDB#20), that is a widespread lineage in Africa. Discussion: This is the first genetic characterization of T. gondii isolated from a wild carnivore on the African continent and the first report of T. gondii in Black-backed Jackal. The Africa 4 lineage was also confirmed in the region of Southern Africa for the first time.
Asunto(s)
Toxoplasma , Toxoplasmosis Animal , Animales , Toxoplasma/genética , Sudáfrica/epidemiología , Toxoplasmosis Animal/diagnóstico , Toxoplasmosis Animal/epidemiología , Toxoplasmosis Animal/parasitología , Chacales/genética , Genotipo , ADN BacterianoRESUMEN
Lyme disease, caused by some strains of bacterial spirochetes Borrelia burgdorferi sensu lato (Bbsl), affects humans but also domestic animals including horses. The primary pathogens in horses in Europe are B. afzelii, B. garinii and B. burgdorferi sensu stricto. To our knowledge, there are no data available on the seropositivity of B. burgdorferi s.l. in horses from the Czech Republic. In this country, horses are mainly used for sport, breeding, and recreational riding in areas where vectors of B. burgdorferi s.l. are present, which is why they are frequently at risk of infection. The aim of the study was to detect anti-borrelia IgM and IgG antibodies in clinically healthy and sick horses from the Czech Republic and to evaluate the risk factors of infection. In total, sera of 262 horses (247 clinically healthy horses and 15 horses hospitalized due to symptoms of encephalitis/meningoencephalitis) were examined by an indirect sandwich enzyme-linked immunosorbent assay. Positivity of B. burgdorferi was 27% (66/247) in clinically healthy horses (21% IgM, 7% IgG and 3% IgM + IgG antibodies) and 20% (3/15) in horses with clinical signs (20% IgM, 7% IgG and 7% IgM + IgG). In the clinically healthy horses, positivity statistically differed (p ≤ 0.05) only in Pony and Warmblood breeds, being the most affected at 32% and 30%, respectively, while other characteristics (sex, age, usage and localities) had no effect on positivity. This is the first survey of antibodies to B. burgdorferi s.l. in Czech horses showing that horses are exposed to ticks infected with B. burgdorferi s.l. This should be taken into account when making differential diagnoses in patients with non-specific symptoms to start with adequate therapy.
RESUMEN
RNA modifications have been known for many years, but their function has not been fully elucidated yet. For instance, the regulatory role of acetylation on N4-cytidine (ac4C) in RNA can be explored not only in terms of RNA stability and mRNA translation but also in DNA repair. Here, we observe a high level of ac4C RNA at DNA lesions in interphase cells and irradiated cells in telophase. Ac4C RNA appears in the damaged genome from 2 to 45 min after microirradiation. However, RNA cytidine acetyltransferase NAT10 did not accumulate to damaged sites, and NAT10 depletion did not affect the pronounced recruitment of ac4C RNA to DNA lesions. This process was not dependent on the G1, S, and G2 cell cycle phases. In addition, we observed that the PARP inhibitor, olaparib, prevents the recruitment of ac4C RNA to damaged chromatin. Our data imply that the acetylation of N4-cytidine, especially in small RNAs, has an important role in mediating DNA damage repair. Ac4C RNA likely causes de-condensation of chromatin in the vicinity of DNA lesions, making it accessible for other DNA repair factors involved in the DNA damage response. Alternatively, RNA modifications, including ac4C, could be direct markers of damaged RNAs.
Asunto(s)
Citidina , ARN , ARN/metabolismo , Citidina/genética , Citidina/metabolismo , Inhibidores de Poli(ADP-Ribosa) Polimerasas , Cromatina , AcetilaciónRESUMEN
Bats may carry various viruses and bacteria which can be harmful to humans, but little is known about their role as a parasitic source with zoonotic potential. The aim of this study was to test wild bats for the presence of selected parasites: Toxoplasma gondii, Neospora caninum and microsporidia Encephalitozoon spp. In total, brain and small intestine tissues of 100 bats (52 Myotis myotis, 43 Nyctalus noctula and 5 Vespertilio murinus) were used for the DNA isolation and PCR detection of the abovementioned agents. Toxoplasma gondii DNA was detected by real-time PCR in 1% of bats (in one male of M. myotis), while all bats were negative for N. caninum DNA. Encephalitozoon spp. DNA was detected by nested PCR in 25% of bats, including three species (twenty-two M. myotis, two N. noctula and one V. murinus). Positive samples were sequenced and showed homology with the genotypes Encephalitozoon cuniculi II and Encephalitozoon hellem 2C. This is the first study on wild vespertilionid bats from Central Europe and worldwide, with a relatively high positivity of Encephalitozoon spp. detected in bats.
Asunto(s)
Quirópteros , Coccidiosis , Encephalitozoon , Neospora , Parásitos , Toxoplasma , Toxoplasmosis Animal , Animales , Masculino , Humanos , Neospora/genética , Toxoplasma/genética , Toxoplasmosis Animal/parasitología , Coccidiosis/veterinaria , Encephalitozoon/genética , Parásitos/genética , Europa (Continente) , Reacción en Cadena en Tiempo Real de la PolimerasaRESUMEN
The aim of this study was to detect antibodies to Toxoplasma gondii and Neospora caninum in exotic animal species kept in three zoos in Slovakia. Antibodies to T. gondii and N. caninum were detected by commercial Enzyme-linked immunosorbent assay (ELISA, ID Screen Toxoplasmosis Indirect Multispecies and ID Screen Neospora caninum Indirect Multispecies, ID Vet, Montpellier, France). Antibodies to T. gondii and N. caninum were detected in 43% (24/56) and 5% (3/55) of animals, respectively. The three animals with N. caninum antibodies: two wolves (Canis lupus) and one Hartmann's mountain Zebra (Equus zebra hartmannae), were clinically healthy, and both wolves simultaneously had antibodies to T. gondii. The results of our study provide a picture of the recent circulation of T. gondii in three Slovakian zoos with the S/P (ratio of antibodies in the sample to antibodies in positive control) value higher than 200%, found in five animals (9%) indicating acute toxoplasmosis. The highest S/P value (296%) was detected in a Roloway monkey (Cercopithecus roloway), which was healthy without clinical signs, presuming that Roloway monkey is a species less susceptible to T. gondii infection. Results of our study showed the presence of T. gondii and N. caninum in Slovakian zoos, confirming recent T. gondii infections according to the high level of antibodies detected in five animals, referring to acute toxoplasmosis.
Asunto(s)
Coccidiosis , Neospora , Toxoplasma , Toxoplasmosis Animal , Lobos , Animales , Eslovaquia/epidemiología , Anticuerpos Antiprotozoarios , Coccidiosis/epidemiología , Coccidiosis/veterinaria , Toxoplasmosis Animal/diagnóstico , Toxoplasmosis Animal/epidemiología , Estudios Seroepidemiológicos , HaplorrinosRESUMEN
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
Asunto(s)
Genes p53 , Proteína p53 Supresora de Tumor , Proteína p53 Supresora de Tumor/genética , Proteína p53 Supresora de Tumor/metabolismo , Fosforilación , Daño del ADN , Reparación del ADN , ADN/metabolismoRESUMEN
RNA methylation, especially 6-methyladenosine (m6A)-modified RNAs, plays a specific role in DNA damage response (DDR). Here, we also observe that RNA modified at 8-methyladenosine (m8A) is recruited to UVA-damaged chromatin immediately after microirradiation. Interestingly, the level of m8A RNA at genomic lesions was reduced after inhibition of histone deacetylases and DNA methyltransferases. It appears in later phases of DNA damage response, accompanied by active DNA demethylation. Also, PARP inhibitor (PARPi), Olaparib, prevented adenosine methylation at microirradiated chromatin. PARPi abrogated not only m6A and m8A RNA positivity at genomic lesions, but also XRCC1, the factor of base excision repair (BER), did not recognize lesions in DNA. To this effect, Olaparib enhanced the genome-wide level of γH2AX. This histone modification interacted with m8A RNAs to a similar extent as m8A RNAs with DNA. Pronounced interaction properties we did not observe for m6A RNAs and DNA; however, m6A RNA interacted with XRCC1 with the highest efficiency, especially in microirradiated cells. Together, we show that the recruitment of m6A RNA and m8A RNA to DNA lesions is PARP dependent. We suggest that modified RNAs likely play a role in the BER mechanism accompanied by active DNA demethylation. In this process, γH2AX stabilizes m6A/m8A-positive RNA-DNA hybrid loops via its interaction with m8A RNAs. R-loops could represent basic three-stranded structures recognized by PARP-dependent non-canonical m6A/m8A-mediated DNA repair pathway.
Asunto(s)
Desmetilación del ADN , Inhibidores de Poli(ADP-Ribosa) Polimerasas , Inhibidores de Poli(ADP-Ribosa) Polimerasas/farmacología , Reparación del ADN , ADN/metabolismo , Daño del ADN , Cromatina , ARN/genética , ARN/metabolismo , Metilación de ADNRESUMEN
Leptospirosis is a widespread zoonosis, affecting humans, domestic animals and wildlife, with small mammals as a reservoir of this infection. In recent years, this disease has been re-emerging and affects approximately 1 million people all over the world each year. Due to this disease having a significant health impact, it is important to identify the source and method of infection. The risk of Leptospira sp. infection is higher mainly in the cities of developed and industrialised countries. The aim of the study was the detection of antibodies against Leptospira sp. in some wild small mammals captured in the Czech Republic. In total, samples of 855 animals captured in three locations of Moravia during a six-year study (2010-2015) were examined by a microscopic agglutination test, using eight serovars of Leptospira interrogans sensu lato, representing serogroups Grippotyphosa, Icterohaemorrhagiae, Australis, Canicola, Sejroe, Javanica, Pomona and Pyrogenes, as antigens. Antibodies to Leptospira sp. were detected in 6.1% (52/855) of animals, with a prevalence of 6.4% (51/801) and 1.9% (1/54) in rodents and insectivores, respectively. The only statistically significant difference (p ≤ 0.05) was in prevalence between individual species (0-33%), while there were no differences in sex (6.7% in females and 5.1% in males), locality (1.8-8%) and year of trapping (0-8.4%). Only two serovars, L. interrogans serovar Pomona and L. interrogans serovar Grippotyphosa, were detected in 5.5% and 0.5% of animals, respectively. The prevailing serovar of pathogenic L. interrogans s.l. can be identified in a number of infected people in the Czech Republic. The composition of vaccines should be based on the current occurrence of Leptospira serovars in the actual territory. For this reason, the occurrence of Leptospira and its serovars should therefore be regularly monitored.
RESUMEN
BACKGROUND: Variants of linker histone H1 are tissue-specific and are responsible for chromatin compaction accompanying cell differentiation, mitotic chromosome condensation, and apoptosis. Heterochromatinization, as the main feature of these processes, is also associated with pronounced trimethylation of histones H3 at the lysine 9 position (H3K9me3). METHODS: By confocal microscopy, we analyzed cell cycle-dependent levels and distribution of phosphorylated histone H1 (H1ph) and H3K9me3. By mass spectrometry, we studied post-translational modifications of linker histones. RESULTS: Phosphorylated histone H1, similarly to H3K9me3, has a comparable level in the G1, S, and G2 phases of the cell cycle. A high density of phosphorylated H1 was inside nucleoli of mouse embryonic stem cells (ESCs). H1ph was also abundant in prophase and prometaphase, while H1ph was absent in anaphase and telophase. H3K9me3 surrounded chromosomal DNA in telophase. This histone modification was barely detectable in the early phases of mitosis. Mass spectrometry revealed several ESC-specific phosphorylation sites of H1. HDAC1 depletion did not change H1 acetylation but potentiated phosphorylation of H1.2/H1.3 and H1.4 at serine 38 positions. CONCLUSIONS: Differences in the level and distribution of H1ph and H3K9me3 were revealed during mitotic phases. ESC-specific phosphorylation sites were identified in a linker histone.
RESUMEN
Canine distemper is a highly contagious viral disease in carnivores and represents a serious threat for both wild and domestic animals. The aim of our study was to monitor the occurrence of the canine distemper virus in wildlife from the Czech Republic, reveal the H gene heterogeneity in positive samples and perform subsequent phylogenetic analysis. In total, 412 wild animals of 10 species were included in the study: 219 red foxes (Vulpes vulpes), 79 European badgers (Meles meles), 47 European otters (Lutra lutra), 40 stone martens (Martes foina), 10 pine martens (M. martes), 7 raccoons (Procyon lotor), 5 undetermined martens (Martes sp.), 2 wolves (Canis lupus), 1 European polecat (Mustela putorius), 1 free-ranging ferret (Mustela putorius furo), and 1 free-ranging American mink (Neovison vison). Most animals were found dead or were killed by hunters during hunting seasons in the years 2012-2020 and came from all 14 regions of the Czech Republic. In the animals that were hunted, symptoms such as apathy, loss of shyness or disorientation were reported. Canine distemper virus (CDV) was detected by real-time RT-PCR in the tissues of 74 (18%) of the animals, including 62 (28%) red foxes, 4 (10%) stone martens, 3 (43%) raccoons, 2 (20%) pine martens, 2 (2.5%) European badgers and 1 (20%) undetermined marten. There was a statistical difference in positivity among animal species (p < 0.0001), regions (p = 0.0057), and the years of sampling (p = 0.0005). To determine the genetic characteristics of circulating variants of CDV in wildlife, 23 of 74 CDV variants were partially sequenced. Phylogenetic analysis showed that 21 variants belonged to the European lineage and two strains belonged to the European-Wildlife lineage. This study provides the first comprehensive overview of the prevalence and spatial distribution of CDV in wildlife in the Czech Republic, including molecular phylogenetic analysis of currently circulating CDV lineages.
RESUMEN
Blood sampling is a challenging procedure in many captive animals. Although manual restraint or anesthesia are usually possible, they entail intense stress and a high risk of injuries or organ failure. Blood sampling using medicinal leeches (Hirudo medicinalis) represents a promising non-invasive alternative to venipuncture; however, leech blood meal was to date used only for qualitative analyses such as genetic or serological screenings. Hence, the aim of this study was to evaluate the suitability of the leech blood sampling method for quantification of hematological and biochemical parameters. Medicinal leeches were manually applied on 67 zoo animals of eleven species, and control blood samples were obtained by venipuncture of the jugular vein. The leeches drew up to 20 ml of blood in 20 to 55 min. Although most hematological and biochemical parameters were significantly altered in leech-derived samples, their values showed strong (r = 0.62-0.79; 10/24 parameters) to very strong (r > 0.8; 13/24 parameters) correlations with venipuncture in all blood parameters, except for sodium (r = 0.39). As the parameter alterations and correlations were similar among species, simple cross-species regression formulas were sufficient to correct the alterations, thereby ensuring good repeatability between leeches and venipuncture in most parameters. Our data thus suggest that medicinal leeches can be used as a reliable non-invasive and stress-reducing alternative to standard venipuncture, even for quantitative assays. This opens new opportunities for a significant improvement to animal welfare in zoological gardens, conservation programmes, and ecophysiological research, where quantification of blood parameters is often needed.
RESUMEN
Reports on non-invasive blood sampling are limited, and there are only a few studies on using kissing bugs (Reduviidae) and medicinal leeches (Hirudo medicinalis) for hematology and biochemistry testing in various zoo animal species. The aim of this study was to evaluate the usefulness of non-invasive blood sampling with medicinal leeches for arbovirus epidemiological investigations in various animal species from one zoo collection. Medicinal leeches were manually applied on 35 animals of 11 species. Control blood samples were obtained by venipuncture of the jugular vein. Antibodies to tick-borne encephalitic virus (TBEV) were detected by using the immunoenzymatic method or an immunofluorescent assay (IFAT), depending on the animal species. One of the 35 animals (2.9%) was seropositive (Ovis aries), whereas the rest of the samples were seronegative in both methods of sampling (non-invasive by leeches vs. invasive by venipuncture). Blood sampling using medicinal leeches showed promising results. It is likely a good alternative to other more complex and invasive methods, and it can provide significant advancement in blood sampling for preventive medicine and epidemiological studies in zoo animals.
RESUMEN
METTL16 methyltransferase is responsible for the methylation of N6-adenosine (m6A) in several RNAs. In mouse cells, we showed that the nuclear distribution of METTL16 is cell cycle-specific. In the G1/S phases, METTL16 accumulates to the nucleolus, while in the G2 phase, the level of METTL16 increases in the nucleoplasm. In metaphase and anaphase, there is a very low pool of the METTL16 protein, but in telophase, residual METTL16 appears to be associated with the newly formed nuclear lamina. In A-type lamin-depleted cells, we observed a reduction of METTL16 when compared with the wild-type counterpart. However, METTL16 does not interact with A-type and B-type lamins, but interacts with Lamin B Receptor (LBR) and Lap2α. Additionally, Lap2α depletion caused METTL16 downregulation in the nuclear pool. Furthermore, METTL16 interacted with DDB2, a key protein of the nucleotide excision repair (NER), and also with nucleolar proteins, including TCOF, NOLC1, and UBF1/2, but not fibrillarin. From this view, the METTL16 protein may also regulate the transcription of ribosomal genes because we observed that the high level of m6A in 18S rRNA appeared in cells with upregulated METTL16.
RESUMEN
Monitoring infectious diseases is one of the most important pillars of preventative veterinary medicine in zoological collections. The zoo environment offers a great variety of different animal species living in proximity and in contact with small wild animals and vectors (e.g., ticks and mosquitos). In this context, tick-borne encephalitis virus (TBEV), Usutu virus (USUV), and West Nile virus (WNV) causing vector-borne diseases are emerging pathogens that raise concern. The aim of the study was to detect antibodies to selected flaviviruses in various animal species in the Ljubljana Zoo, Slovenia. In total, 874 sera from 96 animal species were tested for antibodies to TBEV by enzyme-linked immunosorbent assays (ELISA); positive samples were confirmed by a virus neutralization test (VNT) using TBEV, WNV, and USUV antigens. Antibodies to TBEV were detected by ELISA in 3.9% (34/874) of zoo animals, with 4% (30/753) in mammals and 5% (4/86) in birds; the sera of reptiles (n = 34) and amphibians (n = 1) were negative. Antibodies to TBEV were confirmed by VNT in 11 mammals; one bird was positive for both WNV and USUV. The mixture of exotic animal species and their contact with wild animals and vectors such as ticks and mosquitos suggest that screening of infectious diseases in zoo animals might provide good insight into the epizootological situation of the area. This is the first survey of TBEV, WNV, and USUV in a zoological collection in Slovenia.
RESUMEN
Wild small mammals and ticks play an important role in maintaining and spreading zoonoses in nature, as well as in captive animals. The aim of this study was to monitor selected agents with zoonotic potential in their reservoirs and vectors in a zoo, and to draw attention to the risk of possible contact with these pathogens. In total, 117 wild small mammals (rodents) and 166 ticks were collected in the area of Brno Zoo. Antibodies to the bacteria Coxiella burnetii, Francisella tularensis, and Borrelia burgdorferi s.l. were detected by a modified enzyme-linked immunosorbent assay in 19% (19/99), 4% (4/99), and 15% (15/99) of rodents, respectively. Antibodies to Leptospira spp. bacteria were detected by the microscopic agglutination test in 6% (4/63) of rodents. Coinfection (antibodies to more than two agents) were proved in 14.5% (15/97) of animals. The prevalence of C. burnetii statistically differed according to the years of trapping (p = 0.0241). The DNAs of B. burgdorferi s.l., Rickettsia sp., and Anaplasma phagocytophilum were detected by PCR in 16%, 6%, and 1% of ticks, respectively, without coinfection and without effect of life stage and sex of ticks on positivity. Sequencing showed homology with R. helvetica and A. phagocytophilum in four and one positive samples, respectively. The results of our study show that wild small mammals and ticks in a zoo could serve as reservoirs and vectors of infectious agents with zoonotic potential and thus present a risk of infection to zoo animals and also to keepers and visitors to a zoo.
RESUMEN
Theileria equi and Babesia caballi are protozoan agents causing equine piroplasmosis, endemic in countries all over the world. The aim of this study was to detect antibodies to T. equi and B. caballi in horses in the Czech Republic and to investigate the origin of the infection. Blood sera from 711 horses were examined with competitive enzyme-linked immunosorbent assay; positive samples were verified with indirect fluorescence immunoassay. Antibodies to T. equi and B. caballi were detected in eight (1.1%) and three (0.4%) horses, respectively. Infection with T. equi was confirmed by PCR and sequencing in the blood of five serologically positive horses. An autochthonous origin of T. equi infection could not be excluded in two (0.3%) horses. Intensive movement of horses across European countries and the expanding occurrence of competent tick vector Dermacentor reticulatus in the Czech Republic create an increasing risk of establishing active foci of equine piroplasmosis in the country.
Asunto(s)
Babesia , Babesiosis , Enfermedades de los Caballos , Theileria , Theileriosis , Animales , Babesia/genética , Babesiosis/epidemiología , Bovinos , República Checa/epidemiología , Enfermedades de los Caballos/epidemiología , Caballos , Theileria/genética , Theileriosis/epidemiologíaRESUMEN
The protozoan parasites Theileria equi and Babesia caballi, transmitted by ticks, cause equine piroplasmosis, the most prevalent tick-borne disease in equids. Trichinellosis is a worldwide food-borne zoonosis caused by helminth Trichinella spp. that can lead to serious disease in humans, with fatal outcome. Although the infection is rare in horses, it deserves attention due to the increasing use of horse meat as a source of protein for humans. Horse trichinellosis is caused by several Trichinella species, most commonly by T. spiralis. The aim of the study was to determine the prevalence of antibodies to T. equi, B. caballi and Trichinella spp. in equids from three states of Northern Nigeria. Serum samples were collected from 139 clinically healthy animals, comprising 115 horses and 24 donkeys. Antibodies to T. equi and B. caballi were detected in serum by competitive-inhibition enzyme-linked immunosorbent assay (cELISA) and antibodies to Trichinella spp. by ELISA. Antibodies to T. equi were detected in 34% of equids (41% horses and 0% donkeys), antibodies to B. caballi in 9% of equids (8% horses and 13% donkeys), and antibodies to Trichinella spp. in 4% of equids (4% horses and 0% donkeys). There was co-infection of T. equi and B. caballi in 1% of horses and co-infection of T. equi and Trichinella spp. in 2.6% of horses. This is the first report on seroprevalence of Trichinella spp. in equids from Northern Nigeria.