Heat capacity changes associated with G-quadruplex unfolding.

G-quadruplexes are four-stranded DNA structures that have been found in the cell and are thought to act as elements of control in genomic events. The measurements of the thermodynamic stability, ΔG, of G-quadruplexes shed light on the molecular forces involved in the stabilization of these structures. In thermodynamic studies, the differential heat capacity, ΔCP, of the folded and unfolded states of a G-quadruplex is a fundamental property that describes the temperature dependences of the differential enthalpy, ΔH, entropy, ΔS, and free energy, ΔG. Despite its recognized importance, the ΔCP of G-quadruplex unfolding has not been measured directly. Here, we use differential scanning calorimetry to evaluate changes in heat capacity, ΔCP, accompanying the unfolding transitions of G-quadruplexes formed by modified DNA sequences from the promoter regions of the c-MYC, VEGF, and Bcl-2 oncogenes. The average value of ΔCP is 0.49 ± 0.12 kcal mol-1 K-1. Our analysis revealed that disregarding ΔCP leads to significant errors in extrapolated values of the differential enthalpy, ΔH, and entropy, ΔS, of the folded and unfolded DNA conformations. Although the compensation between ΔH and ΔS weakens the effect of ΔCP on the differential free energy, ΔG, neglecting ΔCP may still result in relative errors in ΔG extrapolated to room temperature as great as 140%. We emphasize the importance of proper consideration of the effect of ΔCP in conformational studies of guanine-rich DNA molecules.

Tribute to Kenneth J. Breslauer.

It is an exciting experience to serve as guest editor for a Special Issue celebrating the 75th birthday of Professor Kenneth J [...].

Distribution of Conformational States Adopted by DNA from the Promoter Regions of the VEGF and Bcl-2 Oncogenes.

We employed a previously described procedure, based on circular dichroism (CD) spectroscopy, to quantify the distribution of conformational states adopted by equimolar mixtures of complementary G-rich and C-rich DNA strands from the promoter regions of the VEGF and Bcl-2 oncogenes. Spectra were recorded at different pHs, concentrations of KCl, and temperatures. The temperature dependences of the fractional populations of the duplex, G-quadruplex, i-motif, and coiled conformations of each promoter were then analyzed within the framework of a thermodynamic model to obtain the enthalpy and melting temperature of each folded-to-unfolded transition involved in the equilibrium. A comparison of the conformational data on the VEGF and Bcl-2 DNA with similar results on the c-MYC DNA, which we reported previously, reveals that the distribution of conformational states depends on the specific DNA sequence and is modulated by environmental factors. Under the physiological conditions of room temperature, neutral pH, and elevated concentrations of potassium ions, the duplex conformation coexists with the G-quadruplex conformation in proportions that depend on the sequence. This observed conformational diversity has biological implications, and it further supports our previously proposed thermodynamic hypothesis of gene regulation. In that hypothesis, a specific distribution of duplex and tetraplex conformations in a promoter region is fine-tuned to maintain the healthy level of gene expression. Any deviation from a healthy distribution of conformational states may result in pathology stemming from up- or downregulation of the gene.

Stabilization of G-Quadruplex-Duplex Hybrid Structures Induced by Minor Groove-Binding Drugs.

Once it had been realized that G-quadruplexes exist in the cell and are involved in regulation of genomic processes, the quest for ligands recognizing these noncanonical structures was underway. Many organic compounds that tightly associate with G-quadruplexes have been identified. However, the specificity of G-quadruplex-binding ligands towards individual structures remains problematic, as the common recognition element of these ligands is the G-tetrad. In this paper, we focus on G-quadruplex-duplex hybrids (QDH) containing a hairpin duplex incorporated as a stem-loop into the G-quadruplex core. The presence of a stem-loop renders QDH amenable to sequence-specific recognition by duplex-binding drugs. Should the thermodynamic crosstalk between the stem-loop and the tetraplex core be sufficiently strong, the drug binding to the loop would lead to the stabilization of the entire structure. We studied the stabilizing influence of the minor groove-binders netropsin and Hoechst 33258 on a family of QDH structures, as well as a G-quadruplex and a hairpin modeling the G-quadruplex core and the stem-loop of the QDH's. We found that the binding of either drug results in an enhancement of the thermal stability of all DNA structures, as expressed by increases in the melting temperature, TM. Analysis of the hierarchical order of increases in TM revealed that the drug-induced stabilization arises from drug binding to the G-quadruplex domain of a QDH and the stem-loop, if the latter contains an all-AT binding site. This result attests to the thermodynamic crosstalk between the stem-loop and the tetraplex core of a QDH. Given the existing library of minor groove-binding drugs recognizing mixed A·T and G·C DNA sequences, our results point to an untapped avenue for sequence-specific recognition of QDH structures in vitro and, possibly, in vivo; thereby, opening the way for selective stabilization of four-stranded DNA structures at predetermined genomic loci, with implications for the control of genomic events.

Volumetric Properties of Four-Stranded DNA Structures.

Four-stranded non-canonical DNA structures including G-quadruplexes and i-motifs have been found in the genome and are thought to be involved in regulation of biological function. These structures have been implicated in telomere biology, genomic instability, and regulation of transcription and translation events. To gain an understanding of the molecular determinants underlying the biological role of four-stranded DNA structures, their biophysical properties have been extensively studied. The limited libraries on volume, expansibility, and compressibility accumulated to date have begun to provide insights into the molecular origins of helix-to-coil and helix-to-helix conformational transitions involving four-stranded DNA structures. In this article, we review the recent progress in volumetric investigations of G-quadruplexes and i-motifs, emphasizing how such data can be used to characterize intra-and intermolecular interactions, including solvation. We describe how volumetric data can be interpreted at the molecular level to yield a better understanding of the role that solute-solvent interactions play in modulating the stability and recognition events of nucleic acids. Taken together, volumetric studies facilitate unveiling the molecular determinants of biological events involving biopolymers, including G-quadruplexes and i-motifs, by providing one more piece to the thermodynamic puzzle describing the energetics of cellular processes in vitro and, by extension, in vivo.

Volumetric Interplay between the Conformational States Adopted by Guanine-Rich DNA from the c-MYC Promoter.

The kinetic and thermodynamic stabilities of G-quadruplex structures have been extensively studied. In contrast, systematic investigations of the volumetric properties of G-quadruplexes determining their pressure stability are still relatively scarce. The G-rich strand from the promoter region of the c-MYC oncogene (G-strand) is known to adopt a range of conformational states including the duplex, G-quadruplex, and coil states depending on the presence of the complementary C-rich strand (C-strand) and solution conditions. In this work, we report changes in volume, ΔV, and adiabatic compressibility, ΔKS, accompanying interconversions of G-strand between the G-quadruplex, duplex, and coil conformations in the presence and absence of C-strand. We rationalize these volumetric characteristics in terms of the hydration and intrinsic properties of the DNA in each of the sampled conformational states. We further use our volumetric results in conjunction with the reported data on changes in expansibility, ΔE, and heat capacity, ΔCP, associated with G-quadruplex-to-coil transitions to construct the pressure-temperature phase diagram describing the stability of the G-quadruplex. The phase diagram is elliptic in shape, resembling the classical elliptic phase diagram of a globular protein, and is distinct from the phase diagram for duplex DNA. The observed similarity of the pressure-temperature phase diagrams of G-quadruplexes and globular proteins stems from their shared structural and hydration features that, in turn, result in the similarity of their volumetric properties. To the best of our knowledge, this is the first pressure-temperature stability diagram reported for a G-quadruplex.

Duplex-tetraplex equilibria in guanine- and cytosine-rich DNA.

Noncanonical four-stranded DNA structures, including G-quadruplexes and i-motifs, have been discovered in the cell and are implicated in a variety of genomic regulatory functions. The tendency of a specific guanine- and cytosine-rich region of genomic DNA to adopt a four-stranded conformation depends on its ability to overcome the constraints of duplex base-pairing by undergoing consecutive duplex-to-coil and coil-to-tetraplex transitions. The latter ability is determined by the balance between the free energies of participating ordered and disordered structures. In this review, we present an overview of the literature on the stability of G-quadruplex and i-motif structures and discuss the extent of duplex-tetraplex competition as a function of the sequence context of the DNA and environmental conditions including temperature, pH, salt, molecular crowding, and the presence of G-quadruplex-binding ligands. We outline how the results of in vitro studies can be expanded to understanding duplex-tetraplex equilibria in vivo.

Conformational Preferences of DNA Strands from the Promoter Region of the c-MYC Oncogene.

We characterized the conformational preferences of DNA in an equimolar mixture of complementary G-rich and C-rich strands from the promoter region of the c-MYC oncogene. Our CD-based approach presupposes that the CD spectrum of such a mixture is the spectral sum of the constituent duplex, G-quadruplex, i-motif, and coiled conformations. Spectra were acquired over a range of temperatures at different pHs and concentrations of KCl. Each spectrum was unmixed in terms of the predetermined spectra of the constituent conformational states to obtain the corresponding weighting factors for their fractional contributions to the total population of DNA. The temperature dependences of those contributions then were analyzed in concert according to a model based on a thermodynamic representation of the underlying equilibria. Fitted estimates of the melting enthalpy and temperature obtained for the duplex, G-quadruplex, and i-motif imply that the driving force behind dissociation of the duplex and the concomitant formation of tetrahelical structures is the folding of the G-strand into the G-quadruplex. The liberated C-strand adopts the i-motif conformation at acidic pH and exists in the coiled state at neutral pH. The i-motif alone cannot induce dissociation of the duplex even at pH 5.0, at which it is most stable. Under the physiological conditions of neutral pH, elevated potassium, and room temperature, the duplex and G-quadruplex conformations coexist with the C-strand in the coiled state. Taken together, our results suggest a novel, thermodynamically controlled mechanism for the regulation of gene expression.

On urea and temperature dependences of m-values.

The denaturing or stabilizing influence of a cosolvent on a protein structure is governed by a fine balance of the energetics of the excluded volume effect and the energetics of direct protein-cosolvent interactions. We have previously characterized the energetic contributions of excluded volume and direct interactions with urea for proteins and protein groups. In this work, we examine the molecular origins underlying the relatively weak temperature and urea dependences of the m-values of globular proteins. Our combined experimental and computational results collectively paint a picture in which the relative independence of protein m-values of urea concentration originates from fortuitous compensatory effects of a progressive increase in the solvent-accessible surface area of the unfolded state and a slightly higher urea binding constant of the unfolded state relative to the folded state. Other denaturing cosolvents which lack such a compensation make poor candidates for linear extrapolation model-based protein stability determination studies. The observed diminution in m-values with increasing temperature reflects, in addition to the aforementioned compensatory effects, a decrease in protein-urea binding constants with temperature in accordance with the negative sign of the binding enthalpy.

On empirical decomposition of volumetric data.

Volumetric characterization of proteins and their recognition events has been instrumental in providing information on the role of intra- and intermolecular interactions, including hydration, in stabilizing biomolecules. The credibility of molecular models and interpretation schemes used to rationalize experimental data are essential for the validity of microscopic insights derived from volumetric results. Current empirical schemes used to interpret volumetric data suffer from a lack of theoretical and computational substantiation. In this contribution, we take advantage age of recent MD simulations of proteins in solution coupled with Voronoi-Delaunay tessellation of simulated structures that have provided an exceptional level of structural detail on the nature of protein-water interfaces. We use these structural insights to re-evaluate empirical frameworks used for interpretation of volumetric data. An important issue in this respect is the actual dividing surface between water and protein atoms that is used in volumetric studies when the solute and solvent are treated as hard spheres enclosed within their respective van der Waals surfaces. In one development, using Voronoi tessellation of MD simulated protein-water systems the dividing surface has been defined as the points equidistant from the water and protein atoms. The interstitial void volume between the solute and the dividing surface corresponds to thermal volume envisaged by Scaled Particle Theory. In this communication, we explicitly account for the contributions of thermal volume to the partial molar volume, compressibility, and expansibility of proteins and re-examine and redefine the intrinsic and hydration volumetric contributions. We discuss the implications of our results for protein transitions and association events.

Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study.

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ KS, of 12 ± 7 cm3 mol-1 bar and (73 ± 8) × 10-4 cm3 mol-1 bar-1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, Δ Shyd, and configurational, Δ Sconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, Δ Sconf, is nearly compensated by a favorable change in the hydration contribution, Δ Shyd.

Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

Effect of Urea on G-Quadruplex Stability.

G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G3T2A)3G3] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔSA, is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the G-quadruplex and duplex conformations is a step toward elucidation of the modulating influence of different types of cosolvents on duplex-G-quadruplex molecular switches triggering genomic events.

Effect of urea on protein-ligand association.

We combine experimental and theoretical approaches to investigate the influence of a cosolvent on a ligand-protein association event. We apply fluorescence measurements to determining the affinity of the inhibitor tri-N-acetylglucosamine [(GlcNAc)3] for lysozyme at urea concentrations ranging from 0 to 8M. Notwithstanding that, at room temperature and neutral pH, lysozyme retains its native conformation up to the solubility limit of urea, the affinity of (GlcNAc)3 for the protein steadily decreases as the concentration of urea increases. We analyze the urea dependence of the binding free energy within the framework of a simplified statistical thermodynamics-based model that accounts for the excluded volume effect and direct solute-solvent interactions. The analysis reveals that the detrimental action of urea on the inhibitor-lysozyme binding originates from competition between the free energy contributions of the excluded volume effect and direct solute-solvent interactions. The free energy contribution of direct urea-solute interactions narrowly overcomes the excluded volume contribution thereby resulting in urea weakening the protein-ligand association. More broadly, the successful application of the simple model employed in this work points to the possibility of its use in quantifying the stabilizing/destabilizing action of individual cosolvents on biochemical folding and binding reactions.

Volumetrically Derived Thermodynamic Profile of Interactions of Urea with a Native Protein.

We report the first experimental characterization of the full thermodynamic profile for binding of urea to a native protein. We measured the volumetric parameters of lysozyme at pH 7.0 as a function of urea within a temperature range of 18-45 °C. At neutral pH, lysozyme retains its native conformation between 0 and 8 M urea over the entire range of temperatures studied. Consequently, our measured volumetric properties reflect solely the interactions of urea with the native protein and do not involve contributions from urea-induced conformational transitions. We analyzed our data within the framework of a statistical thermodynamic analytical model in which urea-protein interactions are viewed as solvent exchange in the vicinity of the protein. The analysis produced the equilibrium constant, k, for an elementary reaction of urea-protein binding with a change in standard state free energy (ΔG° = -RT ln k) at each experimental temperature. We used the van't Hoff equation to compute from the temperature dependence of the equilibrium constant, k, changes in enthalpy, ΔH°, and entropy, ΔS°, accompanying binding. The thermodynamic profile of urea-protein interactions, in conjunction with published molecular dynamics simulation results, is consistent with the picture in which urea molecules, being underhydrated in the bulk, form strong, enthalpically favorable interactions with the surface protein groups while paying a high entropic price. We discuss ramifications of our results for providing insights into the combined effects of urea, temperature, and pressure on the conformational preferences of proteins.

Thermodynamic linkage analysis of pH-induced folding and unfolding transitions of i-motifs.

We describe the pH-induced folding/unfolding transitions of i-motifs by a linkage thermodynamics-based formalism in terms of three pKa's of cytosines, namely, an apparent pKa in the unfolded conformation, pKau, and two apparent pKa's in the folded state, pKaf1 and pKaf2. For the 5'-TTACCCACCCTACCCACCCTCA-3' sequence from the human c-MYC oncogene promoter region, the values of pKau, pKaf1, and pKaf2 are 4.8, 6.0, and 3.6, respectively. With these pKa's, we calculate the differential number of protons bound to the folded and unfolded states as a function of pH. Analysis along these lines offers an alternative interpretation to the experimentally observed shift in the pH-induced unfolded-to-i-motif transitions to neutral pH in the presence of cosolvents and crowders.

Ionic Effects on VEGF G-Quadruplex Stability.

In a potassium solution, a modified 22-meric DNA sequence Pu22-T12T13 from a region proximal to the transcription initiation site of the human VEGF gene adopts a single parallel-stranded G-quadruplex conformation with a 1:4:1 loop-size arrangement. We measured the thermal stability, TM, of the K(+)-stabilized Pu22-T12T13 G-quadruplex as a function of stabilizing K(+) ions and nonstabilizing Cs(+) and TMA(+) ions. The thermal stability, TM, of the Pu22-T12T13 G-quadruplex increases with the concentration of the stabilizing potassium ions, while it sharply decreases upon the addition of the nonstabilizing cations. We interpret these results as underscoring the opposing effects of internal binding and counterion condensation on the stability of the Pu22-T12T13 G-quadruplex. While centrally bound ions stabilize the G-quadruplex conformation, counterion condensation destabilizes it, favoring the coil conformation. From the initial slopes of the dependences of TM on the concentration of Cs(+) and TMA(+) cations, we estimate that the deleterious effect of counterion condensation stems from roughly one extra counterion associated with the coil relative to the G-quadruplex state of Pu22-T12T13. The reduced accumulation of counterions around the G-quadruplex state of Pu22-T12T13 relative to its coil state is due to the low surface charge density of the G-quadruplex reflecting its structural characteristics. On the basis of the analysis of our data along with the results of a previous study, we propose that the differential effect of internally (stabilizing) and externally (destabilizing) bound cations may be a general feature of parallel intramolecular G-quadruplexes.

Excluded volume contribution to cosolvent-mediated modulation of macromolecular folding and binding reactions.

Water-miscible cosolvents may stabilize or destabilize proteins, nucleic acids, and their complexes or may exert no influence. The mode of action of a specific cosolvent is determined by the interplay between the excluded volume effect and direct solute-cosolvent interactions. Excluded volume refers to the steric exclusion of water and cosolvent molecules from the space occupied by solute, an event accompanied by a decrease in translational entropy. In thermodynamic terms, the excluded volume effect is modeled by creating a cavity which is sufficiently large to accommodate the solute and which is inaccessible to surrounding molecules of water and cosolvent(s). An understanding of the relationship between the energetic contributions of cavity formation and direct solute-cosolvent interactions is required for elucidating the molecular origins of the stabilizing or destabilizing influence of specific cosolvents. In this work, we employed the concepts of scaled particle theory to compute changes in free energy of cavity formation, ∆∆GC, accompanying the ligand-protein binding, protein dimerization, protein folding, and DNA duplex formation events. The computations were performed as a function of the concentration of methanol, urea, ethanol, ethylene glycol, and glycine betaine. Resulting data were used in conjunction with a previously developed statistical thermodynamic algorithm to estimate the excluded volume contribution to changes in preferential hydration, ∆Γ21, and interaction, ∆Γ23, parameters and m-values associated with the reactions under study. The excluded volume contributions to ∆Γ21, ∆Γ23, and m-values are very significant ranging from 30 to 70% correlating with the size of the cosolvent molecule. Our results suggest that a pair of "fully excluded cosolvents" with negligible solute-solvent interactions may differ significantly with respect to their excluded volume contributions to ∆Γ21, ∆Γ23, and m-values thereby differently influencing the equilibrium of the reaction being sampled. This notion has implications for understanding the long-standing observation that, in osmotic stress studies, various osmolytes may produce significantly distinct estimates of hydration/dehydration for the same reaction.

Driving Forces in Pressure-Induced Protein Transitions.

The molecular mechanisms underlying pressure-induced protein denaturation can be analyzed based on the pressure-dependent differences in the apparent volume occupied by amino acids inside the protein and when exposed to water in an unfolded conformation. This chapter presents a volumetric analysis of the peptide group and the 20 naturally occurring amino acid side chains in the interior of the native state, the micelle-like interior of the pressure-induced denatured state, and in the unfolded conformation modeled by low-molecular analogs of proteins. The transfer of a peptide group from the protein interior to water becomes increasingly favorable as pressure increases. This observation classifies solvation of peptide groups as a major driving force in pressure-induced protein denaturation. Polar side chains do not appear to exhibit significant pressure-dependent changes in their preference for the protein interior or solvent. The transfer of nonpolar side chains from the protein interior to water becomes more unfavorable as pressure increases. An inference can be drawn that a sizeable population of nonpolar side chains remains buried inside a solvent-inaccessible core of the pressure-induced denatured state. At elevated pressures this core, owing to the absence of structural constraints, may become packed almost as tightly as the interior of the native state. The presence and partial disappearance of large intraglobular voids is another driving force facilitating pressure-induced protein denaturation. Volumetric data presented here have implications for the kinetics of protein folding and shed light on the nature of the folding transition state ensembles.

Effects of Salt on the Stability of a G-Quadruplex from the Human c-MYC Promoter.

In an atmosphere of potassium ions, a modified c-MYC NHE III1 sequence with two G-to-T mutations (MYC22-G14T/G23T) forms a highly stable parallel-stranded G-quadruplex. The G-quadruplex exhibits a steady increase in its melting temperature, T(M), with an increase in the concentration of the stabilizing cation K(+). On the other hand, an increase in the concentration of nonstabilizing Cs(+) or TMA(+) cations at a constant concentration of K(+) causes a sharp decline in T(M) followed by a leveling off at ∼200 mM Cs(+) or TMA(+). At 51 °C and 600 µM K(+), an increase in Cs(+) concentration from 0 to 800 mM leads to a complete unfolding of the G-quadruplex. These observations are consistent with the picture in which more counterions accumulate in the vicinity of the unfolded state of MYC22-G14T/G23T (nonspecific ion binding) than in that of the G-quadruplex state. We estimate that the unfolded state condenses one extra counterion compared to the G-quadruplex state. Taken together with our earlier results, our data suggest that sodium or potassium cations sequestered inside the central cavity stabilize the G-quadruplex conformation acting as specifically bound ligands. Nonspecifically bound (condensed) counterions may slightly stabilize, exert no influence (human telomeric G-quadruplexes), or strongly destabilize (MYC22-G14T/G23T) the G-quadruplex conformation. We offer a structural rationalization for the enhanced thermal stability of the MYC22-G14T/G23T G-quadruplex.