Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 262
Filtrar
1.
Arch Virol ; 169(7): 141, 2024 Jun 08.
Artículo en Inglés | MEDLINE | ID: mdl-38850364

RESUMEN

The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.


Asunto(s)
Genoma Viral , Hemípteros , Sistemas de Lectura Abierta , Filogenia , Virus ARN , ARN Viral , Animales , Hemípteros/virología , Genoma Viral/genética , ARN Viral/genética , Virus ARN/genética , Virus ARN/clasificación , Virus ARN/aislamiento & purificación , Enfermedades de las Plantas/virología , Oryza/virología , Secuenciación Completa del Genoma , ARN Interferente Pequeño/genética
2.
Plant Dis ; 2024 Apr 03.
Artículo en Inglés | MEDLINE | ID: mdl-38568794

RESUMEN

Green-stem forsythia (Forsythia viridissima), also known as golden bell, is cultivated widely in China as an early spring flowering shrub. In July 2020, yellow or white vein clearing symptoms on leaves were observed in approximate 15% golden bell plants along a landscape river in Ningbo city, Zhejiang province, China. Symptomatic leaves from six different plants were collected and pooled. Total RNA was extracted from about 200 mg pooled sample using TRIzol Reagent (Invitrogen, Carlsbad, USA) and used for high-throughput sequencing (HTS). The cDNA library was constructed using a TruSeq RNA Sample Preparation Kit (Illumina) and an Illumina NovaSeq 6000 platform was utilized to yield 150 nt paired-end reads. CLC Genomic Workbench 11 (QIAGEN) with default parameters were used for data analysis. A total of 41,604,174 paired-end reads were obtained, and 156,853 contigs (16 - 26,665 nt) were generated de novo and compared with sequences in the NCBI nt and nr database using BLASTn and BLASTx, respectively. A total of 197,277 reads were mapped to the citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae) genome with an average coverage of 3191×. A contig of 8783 nt (excluding the poly(A) tail) was aligned to CLBV isolate Vib (accession No. OP751940) by BLASTn with the highest nt sequence identity of 99.7% and 99% query coverage, suggesting that the samples were infected with CLBV (Myung-Hwi Kim et al. 2023). No other virus was detected by this analysis. Subsequently, leaves of the six plants collected above, three plants with mild chlorotic symptoms and three plants without obvious symptoms were tested separately by RT-PCR and all were positive for CLBV. Sap from multiple symptomatic F. viridissima leaves was mechanically inoculated to Nicotiana benthamiana, N. tabacum and Datura stramonium in sextuplicate, but after two months, none of the inoculated plants had obvious symptoms and all of them tested negative for CLBV using RT-PCR. To determine the genome sequence of CLBV present in F. viridissima, a single sample from one plant was selected for genome validtion. The contig sequence was confirmed by Sanger sequencing of RT-PCR products amplified using CLBV-specific primers, and the 5' terminal sequence of the virus was determined using a commercial SUPERSWITCH RACE cDNA Synthesis Kit (Tiosbio, Beijing, China). The complete genomic sequence of CLBV isolated from F. viridissima was 8787 nts long, excluding the poly(A) tail, has the expected three predicted ORFs and was deposited in the GenBank database (accession no. OR766026). Phylogenetic analysis of different CLBV genome sequences from fruit trees and other hosts in GenBank using MEGA11 showed that the golden bell isolate was most closely related to isolate Vib (OP751940) from Viburnum lentago in South Korea, with which it was almost identical (99.7% complete nt sequence identity and >99% aa sequence identity in each of the three ORFs). Ten viruses have been previously reported from Forsythia spp. (Kaminska, M. 1985; Lee et al. 1997), but this is the first report of CLBV in this host. CLBV mainly infects citrus, kiwifruit and apple causing mosaic, chlorosis or yellow vein clearing symptoms, however, bud union disorder was observed in 'Nagami' kumquat infected by CLBV, which caused serious production losses (Cao et al. 2017; Li et al. 2018; Liu et al. 2019; Galipienso et al. 2001). Therefore, further investigation is needed to assess if F. viridissima can be an intermediate host to transfer CLBV to other crops.

3.
World J Gastrointest Oncol ; 16(4): 1192-1203, 2024 Apr 15.
Artículo en Inglés | MEDLINE | ID: mdl-38660657

RESUMEN

BACKGROUND: Indentifying predictive factors for postoperative recurrence of hepatocellular carcinoma (HCC) has great significance for patient prognosis. AIM: To explore the value of gadolinium ethoxybenzyl diethylenetriamine pentaacetic acid (Gd-EOB-DTPA) enhanced magnetic resonance imaging (MRI) combined with clinical features in predicting early recurrence of HCC after resection. METHODS: A total of 161 patients with pathologically confirmed HCC were enrolled. The patients were divided into early recurrence and non-early recurrence group based on the follow-up results. The clinical, laboratory, pathological results and Gd-EOB-DTPA enhanced MRI imaging features were analyzed. RESULTS: Of 161 patients, 73 had early recurrence and 88 were had non-early recurrence. Univariate analysis showed that patient age, gender, serum alpha-fetoprotein level, the Barcelona Clinic Liver Cancer stage, China liver cancer (CNLC) stage, microvascular invasion (MVI), pathological satellite focus, tumor size, tumor number, tumor boundary, tumor capsule, intratumoral necrosis, portal vein tumor thrombus, large vessel invasion, nonperipheral washout, peritumoral enhancement, hepatobiliary phase (HBP)/tumor signal intensity (SI)/peritumoral SI, HBP peritumoral low signal and peritumoral delay enhancement were significantly associated with early recurrence of HCC after operation. Multivariate logistic regression analysis showed that patient age, MVI, CNLC stage, tumor boundary and large vessel invasion were independent predictive factors. External data validation indicated that the area under the curve of the combined predictors was 0.861, suggesting that multivariate logistic regression was a reasonable predictive model for early recurrence of HCC. CONCLUSION: Gd-EOB-DTPA enhanced MRI combined with clinical features would help predicting the early recurrence of HCC after operation.

4.
Sci Adv ; 10(17): eadk3852, 2024 Apr 26.
Artículo en Inglés | MEDLINE | ID: mdl-38657063

RESUMEN

Many insect pests, including the brown planthopper (BPH), undergo windborne migration that is challenging to observe and track. It remains controversial about their migration patterns and largely unknown regarding the underlying genetic basis. By analyzing 360 whole genomes from around the globe, we clarify the genetic sources of worldwide BPHs and illuminate a landscape of BPH migration showing that East Asian populations perform closed-circuit journeys between Indochina and the Far East, while populations of Malay Archipelago and South Asia undergo one-way migration to Indochina. We further find round-trip migration accelerates population differentiation, with highly diverged regions enriching in a gene desert chromosome that is simultaneously the speciation hotspot between BPH and related species. This study not only shows the power of applying genomic approaches to demystify the migration in windborne migrants but also enhances our understanding of how seasonal movements affect speciation and evolution in insects.


Asunto(s)
Migración Animal , Genómica , Viento , Animales , Genómica/métodos , Hemípteros/genética , Genoma de los Insectos , Genética de Población
5.
Proc Natl Acad Sci U S A ; 121(16): e2318783121, 2024 Apr 16.
Artículo en Inglés | MEDLINE | ID: mdl-38588412

RESUMEN

Communication between insects and plants relies on the exchange of bioactive molecules that traverse the species interface. Although proteinic effectors have been extensively studied, our knowledge of other molecules involved in this process remains limited. In this study, we investigate the role of salivary microRNAs (miRNAs) from the rice planthopper Nilaparvata lugens in suppressing plant immunity. A total of three miRNAs were confirmed to be secreted into host plants during insect feeding. Notably, the sequence-conserved miR-7-5P is specifically expressed in the salivary glands of N. lugens and is secreted into saliva, distinguishing it significantly from homologues found in other insects. Silencing miR-7-5P negatively affects N. lugens feeding on rice plants, but not on artificial diets. The impaired feeding performance of miR-7-5P-silenced insects can be rescued by transgenic plants overexpressing miR-7-5P. Through target prediction and experimental testing, we demonstrate that miR-7-5P targets multiple plant genes, including the immune-associated bZIP transcription factor 43 (OsbZIP43). Infestation of rice plants by miR-7-5P-silenced insects leads to the increased expression of OsbZIP43, while the presence of miR-7-5P counteracts this upregulation effect. Furthermore, overexpressing OsbZIP43 confers plant resistance against insects which can be subverted by miR-7-5P. Our findings suggest a mechanism by which herbivorous insects have evolved salivary miRNAs to suppress plant immunity, expanding our understanding of cross-kingdom RNA interference between interacting organisms.


Asunto(s)
Hemípteros , MicroARNs , Oryza , Animales , Interferencia de ARN , MicroARNs/genética , MicroARNs/metabolismo , Saliva , Hemípteros/fisiología , Inmunidad de la Planta/genética , Oryza/genética
6.
J Gen Virol ; 105(4)2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38602389

RESUMEN

A negative-strand symbiotic RNA virus, tentatively named Nilaparvata lugens Bunyavirus (NLBV), was identified in the brown planthopper (BPH, Nilaparvata lugens). Phylogenetic analysis indicated that NLBV is a member of the genus Mobuvirus (family Phenuiviridae, order Bunyavirales). Analysis of virus-derived small interfering RNA suggested that antiviral immunity of BPH was successfully activated by NLBV infection. Tissue-specific investigation showed that NLBV was mainly accumulated in the fat-body of BPH adults. Moreover, NLBV was detected in eggs of viruliferous female BPHs, suggesting the possibility of vertical transmission of NLBV in BPH. Additionally, no significant differences were observed for the biological properties between NLBV-infected and NLBV-free BPHs. Finally, analysis of geographic distribution indicated that NLBV may be prevalent in Southeast Asia. This study provided a comprehensive characterization on the molecular and biological properties of a symbiotic virus in BPH, which will contribute to our understanding of the increasingly discovered RNA viruses in insects.


Asunto(s)
Hemípteros , Orthobunyavirus , Virus ARN , Animales , Femenino , Filogenia , Insectos , Virus ARN/genética
7.
Arch Virol ; 169(5): 90, 2024 Apr 05.
Artículo en Inglés | MEDLINE | ID: mdl-38578314

RESUMEN

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.


Asunto(s)
Virus ARN , Viburnum , Viburnum/genética , ARN Viral/genética , Filogenia , Genoma Viral , Virus ARN/genética , Sistemas de Lectura Abierta
8.
Proc Natl Acad Sci U S A ; 121(14): e2315982121, 2024 Apr 02.
Artículo en Inglés | MEDLINE | ID: mdl-38536757

RESUMEN

Throughout evolution, arboviruses have developed various strategies to counteract the host's innate immune defenses to maintain persistent transmission. Recent studies have shown that, in addition to bacteria and fungi, the innate Toll-Dorsal immune system also plays an essential role in preventing viral infections in invertebrates. However, whether the classical Toll immune pathway is involved in maintaining the homeostatic process to ensure the persistent and propagative transmission of arboviruses in insect vectors remain unclear. In this study, we revealed that the transcription factor Dorsal is actively involved in the antiviral defense of an insect vector (Laodelphax striatellus) by regulating the target gene, zinc finger protein 708 (LsZN708), which mediates downstream immune-related effectors against infection with the plant virus (Rice stripe virus, RSV). In contrast, an antidefense strategy involving the use of the nonstructural-protein (NS4) to antagonize host antiviral defense through competitive binding to Dorsal from the MSK2 kinase was employed by RSV; this competitive binding inhibited Dorsal phosphorylation and reduced the antiviral response of the host insect. Our study revealed the molecular mechanism through which Toll-Dorsal-ZN708 mediates the maintenance of an arbovirus homeostasis in insect vectors. Specifically, ZN708 is a newly documented zinc finger protein targeted by Dorsal that mediates the downstream antiviral response. This study will contribute to our understanding of the successful transmission and spread of arboviruses in plant or invertebrate hosts.


Asunto(s)
Arbovirus , Hemípteros , Oryza , Tenuivirus , Animales , Arbovirus/genética , Hemípteros/fisiología , Tenuivirus/fisiología , Insectos Vectores , Antivirales/metabolismo , Oryza/genética , Enfermedades de las Plantas
9.
Chem Commun (Camb) ; 60(28): 3854-3857, 2024 Apr 02.
Artículo en Inglés | MEDLINE | ID: mdl-38497353

RESUMEN

In contrast to the well-established enzymatic enantioselective decarboxylative protonation (EDP), the corresponding chemocatalytic reactions of acyclic malonic acid derivatives remain challenging. Herein, we developed a biomimetic EDP of α-alkyl-α-aryl malonate monoesters using a chiral 1,2-trans-diaminocyclohexane-based N-sulfonamide as an organocatalyst. The method demonstrates excellent chemical yields, good enantioselectivity, mild reaction conditions, and the generation of only CO2 as waste.

10.
Commun Biol ; 7(1): 257, 2024 Mar 02.
Artículo en Inglés | MEDLINE | ID: mdl-38431762

RESUMEN

Herbivorous insects employ an array of salivary proteins to aid feeding. However, the mechanisms behind the recruitment and evolution of these genes to mediate plant-insect interactions remain poorly understood. Here, we report a potential horizontal gene transfer (HGT) event from bacteria to an ancestral bug of Eutrichophora. The acquired genes subsequently underwent duplications and evolved through co-option. We annotated them as horizontal-transferred, Eutrichophora-specific salivary protein (HESPs) according to their origin and function. In Riptortus pedestris (Coreoidea), all nine HESPs are secreted into plants during feeding. The RpHESP4 to RpHESP8 are recently duplicated and found to be indispensable for salivary sheath formation. Silencing of RpHESP4-8 increases the difficulty of R. pedestris in probing the soybean, and the treated insects display a decreased survivability. Although silencing the other RpHESPs does not affect the salivary sheath formation, negative effects are also observed. In Pyrrhocoris apterus (Pyrrhocoroidea), five out of six PaHESPs are secretory salivary proteins, with PaHESP3 being critical for insect survival. The PaHESP5, while important for insects, no longer functions as a salivary protein. Our results provide insight into the potential origin of insect saliva and shed light on the evolution of salivary proteins.


Asunto(s)
Transferencia de Gen Horizontal , Heterópteros , Animales , Proteínas de Insectos/genética , Proteínas de Insectos/metabolismo , Heterópteros/genética , Heterópteros/metabolismo , Proteínas y Péptidos Salivales/genética , Proteínas y Péptidos Salivales/metabolismo
11.
J Colloid Interface Sci ; 665: 399-412, 2024 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-38537588

RESUMEN

Photocatalytic selective oxidation plays an important role in developing green chemistry. However, it is challenging to design an efficient photocatalyst for controlling the selectivity of photocatalytic oxidation reaction and exploring its detailed mechanism. Here, we synthesized three conjugated microporous polymers (CMPs) with D-A structures, named M-SATE-CMPs (MZn, Cu and Co), with different d-band centers based on different metal centers, resulting in the discrepancy in adsorption and activation capacities for the reactants, which produces the selectivity of ß-keto esters being catalyzed into α-hydroperoxide ß-keto esters (ROOH) or to α-hydroxyl ß-keto esters (ROH). Density functional theory (DFT) calculations also demonstrate that the adsorption and activation capacities of the metal active centers in M-SATE-CMPs (MZn, Cu and Co) for ROOH are the key factors to influence the photocatalytic selective oxidation of ß-keto ester. This study provides a promising strategy for designing a metallaphotoredox catalyst whose photocatalytic selectivity depends on the d-band center of metal site in the catalyst.

12.
Insects ; 15(3)2024 Feb 22.
Artículo en Inglés | MEDLINE | ID: mdl-38535345

RESUMEN

Many hosts utilize the ubiquitin system to defend against viral infection. As a key subunit of the ubiquitin system, the role of polyubiquitin in the viral infection of insects is unclear. Here, we identified the full-length cDNA of the polyubiquitin-C (UBC) gene in Laodelphax striatellus, the small brown planthopper (SBPH). LsUBC was expressed in various tissues and was highly expressed in salivary glands, midgut, and reproductive systems. Furthermore, the LsUBC expression profiles in the developmental stages showed that LsUBC was ubiquitously expressed in seven developmental stages and was highest expressed in female adults with SBPH. qRT-PCR analyses indicated that rice stripe virus (RSV) infection promoted the LsUBC expression. Knockdown of LsUBC mRNA via RNA interference increased RSV accumulation. These findings suggest that LsUBC inhibits RSV accumulation in L. striatellus.

13.
Plant Pathol J ; 40(1): 73-82, 2024 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-38326960

RESUMEN

Gardenia (Gardenia jasminoides) is a popular and economically vital plant known for its ornamental and medicinal properties. Despite its widespread cultivation, there has been no documentation of plant viruses on gardenia yet. In the present study, gardenia leaves exhibiting symptoms of plant viral diseases were sampled and sequenced by both metatranscriptome and small RNA sequencing. As a consequence, bean common mosaic virus (BCMV) was identified in gardenia for the first time and named BCMV-gardenia. The full genome sequence of BCMV-gardenia is 10,054 nucleotides (nt) in length (excluding the poly (A) at the 3' termini), encoding a large polyprotein of 3,222 amino acids. Sequence analysis showed that the N-termini of the polyprotein encoded by BCMV-gardenia is less conserved when compared to other BCMV isolates, whereas the C-termini is the most conserved. Maximum likelihood phylogenetic analysis showed that BCMV-gardenia was clustered closely with other BCMV isolates identified outside the leguminous plants. Our results indicated that the majority of BCMV-gardenia virus-derived small interfering RNAs (vsiRNAs) were 21 nt and 22 nt, with 21 nt being more abundant. The first nucleotide at the 5' termini of vsiRNAs derived from BCMV-gardenia preferred U and A. The ratio of vsiRNAs derived from sense (51.1%) and antisense (48.9%) strands is approaching, and the distribution of vsiRNAs along the viral genome is generally even, with some hot spots forming in local regions. Our findings could provide new insights into the diversity, evolution, and host expansion of BCMV and contribute to the prevention and treatment of this virus.

14.
Arch Virol ; 169(1): 19, 2024 Jan 05.
Artículo en Inglés | MEDLINE | ID: mdl-38180588

RESUMEN

The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.


Asunto(s)
Flexiviridae , Mentha , Filogenia , Genómica , Secuenciación de Nucleótidos de Alto Rendimiento , ARN Mensajero , ARN Interferente Pequeño/genética
15.
BMC Genomics ; 25(1): 53, 2024 Jan 11.
Artículo en Inglés | MEDLINE | ID: mdl-38212677

RESUMEN

BACKGROUND: Saliva plays a crucial role in shaping the feeding behavior of insects, involving processes such as food digestion and the regulation of interactions between insects and their hosts. Cyrtorhinus lividipennis serves as a predominant natural enemy of rice pests, while Apolygus lucorum, exhibiting phytozoophagous feeding behavior, is a destructive agricultural pest. In this study, a comparative transcriptome analysis, incorporating the published genomes of C.lividipennis and A.lucorum, was conducted to reveal the role of salivary secretion in host adaptation. RESULTS: In contrast to A.lucorum, C.lividipennis is a zoophytophagous insect. A de novo genome analysis of C.lividipennis yielded 19,706 unigenes, including 16,217 annotated ones. On the other hand, A.lucorum had altogether 20,111 annotated genes, as obtained from the published official gene set (20,353 unigenes). Functional analysis of the top 1,000 salivary gland (SG)-abundant genes in both insects revealed that the SG was a dynamically active tissue engaged in protein synthesis and secretion. Predictions of other tissues and signal peptides were compared. As a result, 94 and 157 salivary proteins were identified in C.lividipennis and A.lucorum, respectively, and were categorized into 68 and 81 orthogroups. Among them, 26 orthogroups were shared, potentially playing common roles in digestion and detoxification, including several venom serine proteases. Furthermore, 42 and 55 orthogroups were exclusive in C.lividipennis and A.lucorum, respectively, which were exemplified by a hyaluronidase in C.lividipennis that was associated with predation, while polygalacturonases in A.lucorum were involved in mesophyll-feeding patterns. CONCLUSIONS: Findings in this study provide a comprehensive insight into saliva secretions in C.lividipennis and A.lucorum via a transcriptome approach, reflecting the intricate connections between saliva secretions and feeding behaviors. It is found that conserved salivary secretions are involved in shaping the overlapping feeding patterns, while a plethora of unique salivary secretions may drive the evolution of specific feeding behaviors crucial for their survival. These results enhance our understanding of the feeding mechanisms in different insects from the perspective of saliva and contribute to future environmentally friendly pest control by utilizing predatory insects.


Asunto(s)
Heterópteros , Transcriptoma , Animales , Heterópteros/genética , Glándulas Salivales , Perfilación de la Expresión Génica/métodos , Saliva
16.
Insect Sci ; 31(1): 91-105, 2024 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-37334667

RESUMEN

Apolipoprotein D (ApoD), a member of the lipocalin superfamily of proteins, is involved in lipid transport and stress resistance. Whereas only a single copy of the ApoD gene is found in humans and some other vertebrates, there are typically several ApoD-like genes in insects. To date, there have been relatively few studies that have examined the evolution and functional differentiation of ApoD-like genes in insects, particularly hemi-metabolous insects. In this study, we identified 10 ApoD-like genes (NlApoD1-10) with distinct spatiotemporal expression patterns in Nilaparvata lugens (BPH), which is an important pest of rice. NlApoD1-10 were found to be distributed on 3 chromosomes in a tandem array of NlApoD1/2, NlApoD3-5, and NlApoD7/8, and show sequence and gene structural divergence in the coding regions, indicating that multiple gene duplication events occurred during evolution. Phylogenetic analysis revealed that NlApoD1-10 can be clustered into 5 clades, with NlApoD3-5 and NlApoD7/8 potentially evolving exclusively in the Delphacidae family. Functional screening using an RNA interference approach revealed that only NlApoD2 was essential for BPH development and survival, whereas NlApoD4/5 are highly expressed in testes, and might play roles in reproduction. Moreover, stress response analysis revealed that NlApoD3-5/9, NlApoD3-5, and NlApoD9 were up-regulated after treatment with lipopolysaccharide, H2 O2 , and ultraviolet-C, respectively, indicating their potential roles in stress resistance.


Asunto(s)
Hemípteros , Animales , Apolipoproteínas D/genética , Apolipoproteínas D/metabolismo , Hemípteros/fisiología , Filogenia , Interferencia de ARN
17.
Plant Dis ; 2023 Nov 15.
Artículo en Inglés | MEDLINE | ID: mdl-37966476

RESUMEN

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

18.
Curr Neuropharmacol ; 2023 Oct 25.
Artículo en Inglés | MEDLINE | ID: mdl-37921169

RESUMEN

Humans have long been combating chronic pain. In clinical practice, opioids are first- choice analgesics, but long-term use of these drugs can lead to serious adverse reactions. Finding new, safe and effective pain relievers that are useful treatments for chronic pain is an urgent medical need. Based on accumulating evidence from numerous studies, excess reactive oxygen species (ROS) contribute to the development and maintenance of chronic pain. Some antioxidants are potentially beneficial analgesics in the clinic, but ROS-dependent pathways are completely inhibited only by scavenging ROS directly targeting cellular or subcellular sites. Unfortunately, current antioxidant treatments donot achieve this effect. Furthermore, some antioxidants interfere with physiological redox signaling pathways and fail to reverse oxidative damage. Therefore, the key upstream processes and mechanisms of ROS production that lead to chronic pain in vivo must be identified to discover potential therapeutic targets related to the pathways that control ROS production in vivo. In this review, we summarize the sites and pathways involved in analgesia based on the three main mechanisms by which ROS are generated in vivo, discuss the preclinical evidence for the therapeutic potential of targeting these pathways in chronic pain, note the shortcomings of current research and highlight possible future research directions to provide new targets and evidence for the development of clinical analgesics.

19.
Nat Commun ; 14(1): 7264, 2023 11 09.
Artículo en Inglés | MEDLINE | ID: mdl-37945658

RESUMEN

Non-retroviral endogenous viral elements (nrEVEs) are widely dispersed throughout the genomes of eukaryotes. Although nrEVEs are known to be involved in host antiviral immunity, it remains an open question whether they can be domesticated as functional proteins to serve cellular innovations in arthropods. In this study, we found that endogenous toti-like viral elements (ToEVEs) are ubiquitously integrated into the genomes of three planthopper species, with highly variable distributions and polymorphism levels in planthopper populations. Three ToEVEs display exon‒intron structures and active transcription, suggesting that they might have been domesticated by planthoppers. CRISPR/Cas9 experiments revealed that one ToEVE in Nilaparvata lugens, NlToEVE14, has been co-opted by its host and plays essential roles in planthopper development and fecundity. Large-scale analysis of ToEVEs in arthropod genomes indicated that the number of arthropod nrEVEs is currently underestimated and that they may contribute to the functional diversity of arthropod genes.


Asunto(s)
Artrópodos , Hemípteros , Animales , Artrópodos/genética , Hemípteros/genética , Retroviridae
20.
Insects ; 14(10)2023 Sep 26.
Artículo en Inglés | MEDLINE | ID: mdl-37887796

RESUMEN

Brochosomes, unique coatings on the integuments of Cicadellidae, are synthesized in specialized glandular sections of Malpighian tubules. However, limited knowledge exists regarding the protein composition of brochosomes. In this study, we conducted transcriptomic and proteomic profiling to characterize the brochosome protein composition in the rice green leafhopper Nephotettix cincticeps. Brochosomes were collected from the forewings of leafhoppers using ultrasonic treatment, allowing for more effective brochosome collection and shaking treatment, resulting in purer brochosomes. Transcriptome sequencing analysis identified 106 genes specifically expressed in the Malpighian tubules; combined with proteomic data, we identified 22 candidate brochosome proteins. These proteins were classified into 12 brochosomins (BSM) and 10 brochosome-associated proteins (BSAP) based on previous research. Conserved motif analysis and functional predictions unveiled unique motifs in each BSM, while BSAP appeared to play a crucial role in BSM folding and pathogen resistance. Comparative analysis of other Hemiptera species demonstrated that all BSM and some BSAP are specific to the Cicadellidae family. Our findings could contribute to understanding the mechanism of brochosome synthesis, its function, and evolutionary genesis.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA