RESUMEN
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMEN
Iodine is a trace element necessary for synthesizing thyroid hormones. It is especially crucial for the neurodevelopment and intellectual development of children. Preschool-age children admitted to the hospital tend to have more fragile physical and mental health, but few studies demonstrate their iodine status. Our study aimed to investigate the iodine status of hospitalized and healthy preschool-age children and to explore the factors influencing them. From January to December 2021, 426 children aged 3-6 years were admitted to the respiratory department for pneumonia, bronchopneumonia, or bronchiectasis, but they could eat normally and were recruited as hospitalized children. Six hundred ten healthy children aged 3-6 years were included. We collected anthropometric measurements and urine samples from hospitalized and healthy preschool-age children, and iodine status was assessed through urinary iodine concentration (UIC) and urinary iodine/creatinine ratio (UI/Cr). UIC was 40.1 and 166.1 µg/L for hospitalized and healthy preschool-age children, respectively (P < 0.001). Urinary creatinine concentration (UCr) was 0.2 and 0.8 g/L for hospitalized and healthy preschool-age children, respectively (P < 0.001). UIC decreased with increasing height z-scores in hospitalized children (Spearman's rho = -0.11, P = 0.022). A significantly increased risk of UIC < 100 µg/L was found in hospitalized children (OR = 9.1 (6.8, 12.2), P < 0.001) when compared to healthy children. In conclusion, hospitalized preschool-age children are likelier to have iodine insufficiency than healthy preschool-age children, especially those with good linear growth. Measures should be implemented to ensure adequate iodine intake of preschool-age children during hospitalization to avoid affecting their intellectual and physical development. Due to lower UCr in hospitalized children, creatinine is not appropriate for assessing iodine status in hospitalized children.
RESUMEN
This manuscript offers a comprehensive overview of nanotechnology's impact on the solubility and bioavailability of poorly soluble drugs, with a focus on BCS Class II and IV drugs. We explore various nanoscale drug delivery systems (NDDSs), including lipid-based, polymer-based, nanoemulsions, nanogels, and inorganic carriers. These systems offer improved drug efficacy, targeting, and reduced side effects. Emphasizing the crucial role of nanoparticle size and surface modifications, the review discusses the advancements in NDDSs for enhanced therapeutic outcomes. Challenges such as production cost and safety are acknowledged, yet the potential of NDDSs in transforming drug delivery methods is highlighted. This contribution underscores the importance of nanotechnology in pharmaceutical engineering, suggesting it as a significant advancement for medical applications and patient care.
Asunto(s)
Disponibilidad Biológica , Nanotecnología , Solubilidad , Humanos , Preparaciones Farmacéuticas/química , Preparaciones Farmacéuticas/administración & dosificación , Sistemas de Liberación de Medicamentos , Nanopartículas/química , Portadores de Fármacos/química , AnimalesRESUMEN
Neuronal ferroptosis plays a key role in neurologic deficits post intracerebral hemorrhage (ICH). However, the endogenous regulation of rescuing ferroptotic neurons is largely unexplored. Here, we analyzed the integrated alteration of metabolomic landscape after ICH using LC-MS and MALDI-TOF/TOF MS, and demonstrated that aconitate decarboxylase 1 (Irg1) and its product itaconate, a derivative of the tricarboxylic acid cycle, were protectively upregulated. Deficiency of Irg1 or depletion of neuronal Irg1 in striatal neurons was shown to exaggerate neuronal loss and behavioral dysfunction in an ICH mouse model using transgenic mice. Administration of 4-Octyl itaconate (4-OI), a cell-permeable itaconate derivative, and neuronal Irg1 overexpression protected neurons in vivo. In addition, itaconate inhibited ferroptosis in cortical neurons derived from mouse and human induced pluripotent stem cells in vitro. Mechanistically, we demonstrated that itaconate alkylated glutathione peroxidase 4 (GPx4) on its cysteine 66 and the modification allosterically enhanced GPx4's enzymatic activity by using a bioorthogonal probe, itaconate-alkyne (ITalk), and a GPx4 activity assay using phosphatidylcholine hydroperoxide. Altogether, our research suggested that Irg1/itaconate-GPx4 axis may be a future therapeutic strategy for protecting neurons from ferroptosis post ICH.
RESUMEN
Limited research exists regarding the effects of resistance exercise (RE) combined with whole body vibration (WBV), blood flow restriction (BFR), or both on the neuropsychological performance of working memory (WM) in late-middle-aged and older adults and regarding the physiological mechanisms underlying this effect. This study thus explored the acute molecular and neurophysiological mechanisms underlying WM performance following RE combined with WBV, BFR, or both. Sixty-six participants were randomly assigned into a WBV, BFR, or WBV + BFR group. Before and after the participants engaged in a single bout of isometric RE combined with WBV, BFR, or both, this study gathered data on several neurocognitive measures of WM performance, namely, accuracy rate (AR), reaction time (RT), and brain event-related potential (specifically P3 latency and amplitude), and data on biochemical indices, such as the levels of insulin-like growth factor-1 (IGF-1), norepinephrine (NE), and brain-derived neurotrophic factor (BDNF). Although none of the RE modalities significantly affected RTs and P3 latencies, ARs and P3 amplitudes significantly improved in the WBV and WBV + BFR groups. The WBV + BFR group exhibited greater improvements than the WBV group did. Following acute RE combined with WBV, BFR, or both, IGF-1 and NE levels significantly increased in all groups, whereas BDNF levels did not change. Crucially, only the changes in NE levels were significantly correlated with improvements in ARs in the WBV + BFR and WBV groups. The findings suggest that combining acute RE with WBV, BFR, or both could distinctively mitigate neurocognitive decline in late-middle-aged and older adults.
RESUMEN
Type 2 diabetes mellitus is regarded as a chronic metabolic disease characterized by hyperglycemia. Long-term hyperglycemia may result in oxidative stress, damage pancreatic ß-cell function and induce insulin resistance. Herein we explored the anti-hypoglycemic effects and mechanisms of action of N-p-coumaroyloctopamine (N-p-CO) in vitro and in vivo. N-p-CO exhibited high antioxidant activity, as indicated by the increased activity of SOD, GSH and GSH-Px in HL-7702 cells induced by both high glucose (HG) and palmitic acid (PA). N-p-CO treatment significantly augmented glucose uptake and glycogen synthesis in HG/PA-treated HL-7702 cells. Moreover, administration of N-p-CO in diabetic mice induced by both high-fat diet (HFD) and streptozotocin (STZ) not only significantly increased the antioxidant levels of GSH-PX, SOD and GSH, but also dramatically alleviated hyperglycemia and hepatic glucose metabolism in a dose-dependent manner. More importantly, N-p-CO upregulated the expressions of PI3K, AKT and GSK3ß proteins in both HG/PA-induced HL-7702 cells and HFD/STZ-induced mice. These findings clearly suggest that N-p-CO exerts anti-hypoglycemic and anti-oxidant effects, most probably via the regulation of a PI3K/AKT/GSK3ß signaling pathway. Thus, N-p-CO may have high potentials as a new candidate for the prevention and treatment of diabetes.
RESUMEN
Binasal quadrantanopia is a rare type of visual field defect characteristic of vision loss in either the upper or lower quadrants of both nasal visual fields. The affected individuals often exhibit impairments in peripheral vision, leading to difficulties in various daily activities such as navigation, object recognition, and hazard avoidance. The consequences of binasal quadrantanopia can be profound, affecting the individual's quality of life and functional independence. However, due to its atypical presentation and overlapping clinical features with other visual field defects, accurately pinpointing the lesion's precise location for further management becomes a complex task. Here, we present an unusual case of binasal quadrantanopia caused by bilateral anterior ischemic optic neuropathy (AION) and aim to explore the unique characteristics, etiology, and diagnostic approaches associated with binasal quadrantanopia, shedding light on the challenges encountered in lesion localization.
RESUMEN
Cinnamomum kanehirae Hayata, belonging to Lauraceae family, is an indigenous and endangered species of considerable economic importance in Taiwan. It plays a crucial role as the host for the economically valuable saprotrophic fungus, Taiwanofungus camphorates. However, accurate species identification poses a challenge due to the similarity in morphological features and frequent natural hybridization with closely related species. Acquiring high-quality and pure leaf oils becomes imperative for precise species identification and producing superior goods. In this study, our objective was to establish methodologies for analyzing the chemical composition of leaf essential oils and subsequently apply this knowledge to differentiate among three Cinnamomum species. Gas chromatography-mass spectrometry (GC/MS) was employed to scrutinize the chemical makeup of leaf essential oils from three closely related species: C. kanehirae, C. micranthum, and C. camphora. We utilized Steam Distillation (SD) and steam distillation-solvent extraction (SDSE) methods, with the SDSE-Hexane approach chosen for optimization, enhancing extraction efficiency and ensuring essential oil purity. Through the SDSE-Hexane method, we identified seventy-four compounds distributed across three major classes: monoterpenes hydrocarbons (0.0-7.0 %), oxygenated monoterpenes (3.8-90.9 %), sesquiterpenes hydrocarbons (0.0-28.3 %), and oxygenated sesquiterpenes (1.6-88.1 %). Our findings indicated the presence of more than one chemotype in both C. kanehirae and C. camphora, whereas no specific chemotype could be discerned in C. micranthum. Furthermore, clustering based on chemotypes allowed for the differentiation of samples from the three species. Notably, we demonstrated that the chemical compositions of grafted C. kanehirae remained largely unaffected by the rootstock. Conversely, natural hybrids between C. kanehirae and C. camphora exhibited profiles more closely aligned with C. kanehirae. The optimized extraction method and the chemotype-based classification system established in this study present valuable tools for essential oil preparation, species identification, and further exploration into the genetic variation of Cinnamomum.
RESUMEN
The selection of the finest possible embryo in in-vitro fertilization (IVF) was crucial and revolutionary, particularly when just one embryo is transplanted to lessen the possibility of multiple pregnancies. However, practical usefulness of currently used methodologies may be constrained. Here, we established a novel non-invasive embryo evaluation method that combines non-invasive chromosomal screening (NICS) and Timelapse system along with artificial intelligence algorithms. With an area under the curve (AUC) of 0.94 and an accuracy of 0.88, the NICS-Timelapse model was able to predict blastocyst euploidy. The performance of the model was further evaluated using 75 patients in various clinical settings. The clinical pregnancy and live birth rates of embryos predicted by the NICS-Timelapse model, showing that embryos with higher euploid probabilities were associated with higher clinical pregnancy and live birth rates. These results demonstrated the NICS-Timelapse model's significantly wider application in clinical IVF due to its excellent accuracy and noninvasiveness.
RESUMEN
OBJECTIVE: Explore organ-specific SLE burden by assessing health-related quality of life (HRQoL) and fatigue changes associated with Safety of Estrogens in Lupus Erythematosus National Assessment-Systemic Lupus Erythematosus Disease Activity Index (SELENA-SLEDAI) organ system response (score improvement) and belimumab treatment. METHODS: Data from four phase III belimumab trials were pooled for post hoc analysis (GSK Study 217382): BLISS-52 (NCT00424476), BLISS-76 (NCT00410384), BLISS-SC (NCT01484496) and EMBRACE (NCT01632241). Patients with baseline organ system involvement were classed as organ system responders if SELENA-SLEDAI scores for that organ system decreased at any post-baseline visit. HRQoL (36-Item Short Form Health Survey version 2 (SF-36v2)) and fatigue (Functional Assessment of Chronic Illness Therapy-Fatigue (FACIT-Fatigue)) changes over 52 weeks were compared between organ system responders and non-responders, and separately between belimumab versus placebo treatment arms among organ system responders. Group-level differences were compared using analysis of variance; differences were interpreted using published group-level minimal important difference (MID). RESULTS: In these post hoc analyses, musculoskeletal and mucocutaneous organ system responders had greater SF-36v2 improvements than non-responders across most SF-36v2 domains, but differences were largely
Asunto(s)
Anticuerpos Monoclonales Humanizados , Fatiga , Lupus Eritematoso Sistémico , Calidad de Vida , Índice de Severidad de la Enfermedad , Humanos , Anticuerpos Monoclonales Humanizados/uso terapéutico , Lupus Eritematoso Sistémico/tratamiento farmacológico , Lupus Eritematoso Sistémico/complicaciones , Fatiga/tratamiento farmacológico , Fatiga/etiología , Femenino , Adulto , Masculino , Persona de Mediana Edad , Inmunosupresores/uso terapéutico , Resultado del Tratamiento , Ensayos Clínicos Fase III como AsuntoRESUMEN
Background and objective: It remains uncertain if the addition of Saccharomyces boulardii (S. boulardii) to bismuth quadruple therapy (BQT) recommended in the current guidelines can enhance the Helicobacter pylori (H. pylori) eradication rate and decrease the incidence of adverse events. We therefore conducted a meta-analysis of randomized controlled trials (RCTs) to address this issue. Methods: We performed comprehensive searches in PubMed, Embase, Web of Science, and Cochrane library databases from the inception of the databases through to November 1, 2023. A meta-analysis was conducted to determine the pooled relative risk (RR) with 95% confidence intervals (CI) using a random-effects model. We utilized the revised Cochrane Risk of Bias Tool to assess the risk of bias of included studies. Results: A total of six RCTs (1,404 patients) included in this meta-analysis. The results of the intention-to-treat analysis showed that the combination of S. boulardii with BQT had a higher eradication rate than BQT alone (87.0% versus 83.3%), with a pooled RR of 1.05 (95% CI: 1.00-1.10, p = 0.03). In the per-protocol analysis, however, there was no statistical significance between the two groups in the eradication rate (93.7% versus 91.0%, RR = 1.03, 95% CI: 1.00-1.06, p = 0.07). The combination of S. boulardii and BQT had a significantly lower rate of overall adverse events (22% vs. 39%, RR = 0.56, 95% CI: 0.44-0.70, p < 0.00001), diarrhea (7.9% vs. 25.7%, RR = 0.29, 95% CI: 0.17-0.48, p < 0.00001), constipation (2.9% vs. 8.4%, RR = 0.35, 95% CI: 0.14-0.88, p = 0.03) and abdominal distention (4.9% vs. 12.7%, RR = 0.41, 95% CI: 0.23-0.72, p = 0.002) than BQT alone. For the assessment of risk of bias, five studies were deemed to have some concerns, while one study was judged to have a low risk. Conclusion: Current evidence suggests that supplementation with S. boulardii in BQT may not have a major effect on the H. pylori eradication rate, but significantly reduces the incidence of overall adverse events, diarrhea, abdominal distention and constipation. Combining S. Boulardii with BQT can help alleviate symptoms, potentially improving patient adherence. Systematic review registration: https://osf.io/n9z7c.
RESUMEN
Introduction: Taurine has a prominent lipid-lowering effect on hyperlipidemia. However, a comprehensive analysis of the effects of taurine on endogenous metabolites in hyperlipidemia has not been documented. This study aimed to explore the impact of taurine on multiple metabolites associated with hyperlipidemia. Methods: The hyperlipidemic mouse model was induced by high-fat diet (HFD). Taurine was administered via oral gavage at doses of 700 mg/kg/day for 14 weeks. Evaluation of body weight, serum lipid levels, and histopathology of the liver and adipose tissue was performed to confirm the lipid-lowering effect of taurine. Ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS)-based metabonomics analyses of serum, urine, feces, and liver, coupled with multivariate data analysis, were conducted to assess changes in the endogenous metabolites. Results and discussion: Biochemical and histological examinations demonstrated that taurine administration prevented weight gain and dyslipidemia, and alleviated lipid deposition in the liver and adipose tissue in hyperlipidemic mice. A total of 76 differential metabolites were identified by UPLC-MS-based metabolomics approach, mainly involving BAs, GPs, SMs, DGs, TGs, PUFAs and amino acids. Taurine was found to partially prevent HFDinduced abnormalities in the aforementioned metabolites. Using KEGG database and MetaboAnalyst software, it was determined that taurine effectively alleviates metabolic abnormalities caused by HFD, including fatty acid metabolism, sphingolipid metabolism, glycerophospholipid metabolism, diacylglycerol metabolism, amino acid metabolism, bile acid and taurine metabolism, taurine and hypotaurine metabolism. Moreover, DGs, GPs and SMs, and taurine itself may serve as active metabolites in facilitating various anti-hyperlipidemia signal pathways associated with taurine. This study provides new evidence for taurine to prevent hyperlipidemia.
RESUMEN
A novel strategy combining ferulic acid and glucose was proposed to reduce ß-lactoglobulin (BLG) allergenicity and investigate whether the reduction in allergenicity was associated with gut microbiome and serum metabolism. As a result, the multistructure of BLG changed, and the modified BLG decreased significantly the contents of IgE, IgG, IgG1, and mMCP-1 in serum, improved the diversity and structural composition of gut microbiota, and increased the content of short-chain fatty acids (SCFAs) in allergic mice. Meanwhile, allergic mice induced by BLG affected arachidonic acid, tryptophan, and other metabolic pathways in serum, the modified BLG inhibited the production of metabolites in arachidonic acid metabolism pathway and significantly increased tryptophan metabolites, and this contribution helps in reducing BLG allergenicity. Overall, reduced allergenicity of BLG after ferulic acid was combined with glucose modification by regulating gut microbiota, the metabolic pathways of arachidonic acid and tryptophan. The results may offer new thoughts alleviating the allergy risk of allergenic proteins.
Asunto(s)
Alérgenos , Ácidos Cumáricos , Microbioma Gastrointestinal , Glucosa , Lactoglobulinas , Ácidos Cumáricos/metabolismo , Ácidos Cumáricos/química , Animales , Lactoglobulinas/inmunología , Lactoglobulinas/química , Lactoglobulinas/metabolismo , Ratones , Humanos , Alérgenos/inmunología , Alérgenos/química , Alérgenos/metabolismo , Glucosa/metabolismo , Femenino , Bacterias/inmunología , Bacterias/metabolismo , Bacterias/clasificación , Bacterias/genética , Ratones Endogámicos BALB C , Inmunoglobulina E/inmunología , Inmunoglobulina E/sangre , Ácidos Grasos Volátiles/metabolismo , Bovinos , Inmunoglobulina G/inmunología , Inmunoglobulina G/sangre , Hipersensibilidad a la Leche/inmunologíaRESUMEN
INTRODUCTION: Traumatic brain injury (TBI) is a major cause of neurodisability worldwide, with notably high disability rates among moderately severe TBI cases. Extensive previous research emphasizes the critical need for early initiation of rehabilitation interventions for these cases. However, the optimal timing and methodology of early mobilization in TBI remain to be conclusively determined. Therefore, we explored the impact of early progressive mobilization (EPM) protocols on the functional outcomes of ICU-admitted patients with moderate to severe TBI. METHODS: This randomized controlled trial was conducted at a trauma ICU of a medical center; 65 patients were randomly assigned to either the EPM group or the early progressive upright positioning (EPUP) group. The EPM group received early out-of-bed mobilization therapy within seven days after injury, while the EPUP group underwent early in-bed upright position rehabilitation. The primary outcome was the Perme ICU Mobility Score and secondary outcomes included Functional Independence Measure motor domain (FIM-motor) score, phase angle (PhA), skeletal muscle index (SMI), the length of stay in the intensive care unit (ICU), and duration of ventilation. RESULTS: Among 65 randomized patients, 33 were assigned to EPM and 32 to EPUP group. The EPM group significantly outperformed the EPUP group in the Perme ICU Mobility and FIM-motor scores, with a notably shorter ICU stay by 5.9 days (p < 0.001) and ventilation duration by 6.7 days (p = 0.001). However, no significant differences were observed in PhAs. CONCLUSION: The early progressive out-of-bed mobilization protocol can enhance mobility and functional outcomes and shorten ICU stay and ventilation duration of patients with moderate-to-severe TBI. Our study's results support further investigation of EPM through larger, randomized clinical trials. Clinical trial registration ClinicalTrials.gov NCT04810273 . Registered 13 March 2021.
Asunto(s)
Lesiones Traumáticas del Encéfalo , Ambulación Precoz , Unidades de Cuidados Intensivos , Humanos , Lesiones Traumáticas del Encéfalo/fisiopatología , Lesiones Traumáticas del Encéfalo/rehabilitación , Lesiones Traumáticas del Encéfalo/terapia , Femenino , Masculino , Adulto , Persona de Mediana Edad , Ambulación Precoz/métodos , Ambulación Precoz/estadística & datos numéricos , Ambulación Precoz/tendencias , Unidades de Cuidados Intensivos/organización & administración , Unidades de Cuidados Intensivos/estadística & datos numéricosRESUMEN
Background and Objectives: The Alberta Stroke Program CT Score (ASPECTS) is a widely used rating system for assessing infarct extent and location. We aimed to investigate the prognostic value of ASPECTS subregions' involvement in the long-term functional outcomes of acute ischemic stroke (AIS). Materials and Methods: Consecutive patients with AIS and anterior circulation large-vessel stenosis and occlusion between January 2019 and December 2020 were included. The ASPECTS score and subregion involvement for each patient was assessed using posttreatment magnetic resonance diffusion-weighted imaging. Univariate and multivariable regression analyses were conducted to identify subregions related to 3-month poor functional outcome (modified Rankin Scale scores, 3-6) in the reperfusion and medical therapy cohorts, respectively. In addition, prognostic efficiency between the region-based ASPECTS and ASPECTS score methods were compared using receiver operating characteristic curves and DeLong's test. Results: A total of 365 patients (median age, 64 years; 70% men) were included, of whom 169 had poor outcomes. In the reperfusion therapy cohort, multivariable regression analyses revealed that the involvement of the left M4 cortical region in left-hemisphere stroke (adjusted odds ratio [aOR] 5.39, 95% confidence interval [CI] 1.53-19.02) and the involvement of the right M3 cortical region in right-hemisphere stroke (aOR 4.21, 95% CI 1.05-16.78) were independently associated with poor functional outcomes. In the medical therapy cohort, left-hemisphere stroke with left M5 cortical region (aOR 2.87, 95% CI 1.08-7.59) and caudate nucleus (aOR 3.14, 95% CI 1.00-9.85) involved and right-hemisphere stroke with right M3 cortical region (aOR 4.15, 95% CI 1.29-8.18) and internal capsule (aOR 3.94, 95% CI 1.22-12.78) affected were related to the increased risks of poststroke disability. In addition, region-based ASPECTS significantly improved the prognostic efficiency compared with the conventional ASPECTS score method. Conclusion: The involvement of specific ASPECTS subregions depending on the affected hemisphere was associated with worse functional outcomes 3 months after stroke, and the critical subregion distribution varied by clinical management. Therefore, region-based ASPECTS could provide additional value in guiding individual decision making and neurological recovery in patients with AIS.
RESUMEN
Polycyclic aromatic hydrocarbons (PAHs) with the properties of structural stability, semi-volatility, and hydrophobicity are toxic and persistent in environments; thus, their transport and fate in agroecosystems is essential for reducing PAH accumulation in the edible parts of crops. Here, we cultivated cabbages (Brassica pekinensis L.) and carrots (Daucus carota L.) in PAH-contaminated soils under the greenhouse and field conditions. After harvesting, we observed a 9.5-46% reduction in soil ∑PAH concentrations. There were 37% of bioconcentration factors (BCFbs) > 1 and 93% of translocation factors (TFab) > 1, while low-molecular-weight (LMW) PAHs had higher BCFbs than high-molecular-weight (HMW) PAHs. The PAH concentrations showed significant and positive correlations among soils, the belowground parts, and the aboveground parts. The toxicity equivalent concentration (TEQBaP) followed the order of cabbage (greenhouse) > cabbage (field) > carrot (greenhouse) > carrot (field), suggesting potentially higher health risks in cabbage relative to carrot and vegetables under the greenhouse relative to field condition. Our study suggested growing carrots under field conditions as a management strategy for reducing the risks of vegetables grown in PAH-contaminated soils.
RESUMEN
Spermatogenic cell heterogeneity is determined by the complex process of spermatogenesis differentiation. However, effectively revealing the regulatory mechanisms underlying mammalian spermatogenic cell development and differentiation via traditional methods is difficult. Advances in technology have led to the emergence of many single-cell transcriptome sequencing protocols, which have partially addressed these challenges. In this review, we detail the principles of 10x Genomics technology and summarize the methods for downstream analysis of single-cell transcriptome sequencing data. Furthermore, we explore the role of single-cell transcriptome sequencing in revealing the heterogeneity of testicular ecological niche cells, delineating the establishment and disruption of testicular immune homeostasis during human spermatogenesis, investigating abnormal spermatogenesis in humans, and, ultimately, elucidating the molecular evolution of mammalian spermatogenesis.
Asunto(s)
Evolución Molecular , Análisis de Secuencia de ARN , Análisis de la Célula Individual , Espermatogénesis , Espermatogénesis/genética , Animales , Análisis de la Célula Individual/métodos , Masculino , Análisis de Secuencia de ARN/métodos , Humanos , Transcriptoma , TestículoRESUMEN
Neoadjuvant tyrosine kinase inhibitor (TKI) therapy is an important treatment option for advanced renal cell carcinoma (RCC). Many RCC patients may fail to respond or be resistant to TKI therapy. We aimed to explore the key mechanisms of neoadjuvant therapy résistance. We obtained tumor samples from matched pre-treatment biopsy and post-treatment surgical samples and performed single-cell RNA sequencing. Sunitinib-resistant ccRCC cell lines were established. Ferroptosis was detected by ferrous ion and lipid peroxidation levels. Tumor growth and resistance to Sunitinib was validated in vitro and vivo. Immunohistochemistry was used to validate the levels key genes and lipid peroxidation. Multi-center cohorts were included, including TCGA, ICGC, Checkmate-025 and IMmotion151 clinical trial. Survival analysis was performed to identify the associated clinical and genomic variables. Intratumoral heterogeneity was first described in the whole neoadjuvant management. The signature of endothelial cells was correlated with drug sensitivity and progression-free survival. Ferroptosis was shown to be the key biological program in malignant cell resistance. We observed tissue lipid peroxidation was negatively correlated with IL6 and tumor response. TKI-resistant cell line was established. SLC7A11 knockdown promoted cell growth and lipid peroxidation, increased the ferroptosis level, and suppressed the growth of tumor xenografts significantly (P<0.01). IL6 could reverse the ferroptosis and malignant behavior caused by SLC7A11(-) via JAK2/STAT3 pathway, which was rescued by the ferroptosis inducer Erastin. Our data indicate that ferroptosis is a novel strategy for advanced RCC treatment, which activated by IL6, providing a new idea for resistance to TKIs.
RESUMEN
Patients diagnosed with advanced prostate cancer (PCa) often experience incurable bone metastases; however, a lack of relevant experimental models has hampered the study of disease mechanisms and the development of therapeutic strategies. In this study, we employed the recently established Temperature-based Easy-separable (TempEasy) 3D cell coculture system to investigate PCa bone metastasis. Through coculturing PCa and bone cells for 7 days, our results showed a reduction in PCa cell proliferation, an increase in neovascularization, and an enhanced metastasis potential when cocultured with bone cells. Additionally, we observed increased cell proliferation, higher stemness, and decreased bone matrix protein expression in bone cells when cocultured with PCa cells. Furthermore, we demonstrated that the stiffness of the extracellular matrix had a negligible impact on molecular responses in both primary (PCa cells) and distant malignant (bone cells) sites. The TempEasy 3D hydrogel coculture system is an easy-to-use and versatile coculture system that provides valuable insights into the mechanisms of cell-cell communication and interaction in cancer metastasis.