Shape-Morphing in Oxide Ceramic Kirigami Nanomembranes.

Interfacial strain engineering in ferroic nanomembranes can broaden the scope of ferroic nanomembrane assembly as well as facilitate the engineering of multiferroic-based devices with enhanced functionalities. Geometrical engineering in these material systems enables the realization of 3-D architectures with unconventional physical properties. Here, 3-D multiferroic architectures are introduced by incorporating barium titanate (BaTiO3, BTO) and cobalt ferrite (CoFe2O4, CFO) bilayer nanomembranes. Using photolithography and substrate etching techniques, complex 3-D microarchitectures including helices, arcs, and kirigami-inspired frames are developed. These 3-D architectures exhibit remarkable mechanical deformation capabilities, which can be attributed to the superelastic behavior of the membranes and geometric configurations. It is also demonstrated that dynamic shape reconfiguration of these nanomembrane architectures under electron beam exposure showcases their potential as electrically actuated microgrippers and for other micromechanical applications. This research highlights the versatility and promise of multi-dimensional ferroic nanomembrane architectures in the fields of micro actuation, soft robotics, and adaptive structures, paving the way for incorporating these architectures into stimulus-responsive materials and devices.

Shortwave Infrared Imaging of a Quantum Dot-Based Magnetic Guidewire Toward Non-Fluoroscopic Peripheral Vascular Interventions.

Peripheral vascular interventions (PVIs) offer several benefits to patients with lower extremity arterial diseases, including reduced pain, simpler anesthesia, and shorter recovery time, compared to open surgery. However, to monitor the endovascular tools inside the body, PVIs are conducted under X-ray fluoroscopy, which poses serious long-term health risks to physicians and patients. Shortwave infrared (SWIR) imaging of quantum dots (QDs) has shown great potential in bioimaging due to the non-ionizing penetration of SWIR light through tissues. In this paper, a QD-based magnetic guidewire and its system is introduced that allows X-ray-free detection under SWIR imaging and precise steering via magnetic manipulation. The QD magnetic guidewire contains a flexible silicone tube encapsulating a QD polydimethylsiloxane (PDMS) composite, where HgCdSe/HgS/CdS/CdZnS/ZnS/SiO2 core/multi-shell QDs are dispersed in the PDMS matrix for SWIR imaging upon near-infrared excitation, as well as a permanent magnet for magnetic steering. The SWIR penetration of the QD magnetic guidewire is investigated within an artificial tissue model (1% Intralipid) and explore the potential for non-fluoroscopic PVIs within a vascular phantom model. The QD magnetic guidewire is biocompatible in its entirety, with excellent resistance to photobleaching and chemical alteration, which is a promising sign for its future clinical implementation.

Magnetically Controlled Intraocular Delivery of Dexamethasone Using Silica-Coated Magnetic Nanoparticles.

Although the number of patients with eye diseases is increasing, efficient drug delivery to the posterior segment of the eyeball remains challenging. The reasons include the unique anatomy of the eyeball, the blood-aqueous barrier, the blood-retina barrier, and drug elimination via the anterior chamber and uveoscleral routes. Solutions to these obstacles for therapeutic delivery to the posterior segment will increase the efficacy, efficiency, and safety of ophthalmic treatment. Micro/nanorobots are promising tools to deliver therapeutics to the retina under the direction of an external magnetic field. Although many groups have evaluated potential uses of micro/nanorobots in retinal treatment, most experiments have been performed under idealized in vitro laboratory conditions and thus do not fully demonstrate the clinical feasibility of this approach. This study examined the use of magnetic nanoparticles (MNPs) to deliver dexamethasone, a drug widely used in retinal disease treatment. The MNPs allowed sustainable drug release and successful magnetic manipulation inside bovine vitreous humor and the vitreous humor of living rabbits. Therefore, controlled drug distribution via magnetic manipulation of MNPs is a promising strategy for targeted drug delivery to the retina.

Sialyllactose preserves residual hearing after cochlear implantation.

In individuals with hearing loss, protection of residual hearing is essential following cochlear implantation to facilitate acoustic and electric hearing. Hearing preservation requires slow insertion, atraumatic electrode and delivery of the optimal quantity of a pharmacological agent. Several studies have reported variable hearing outcomes with osmotic pump-mediated steroid delivery. New drugs, such as sialyllactose (SL) which have anti-inflammatory effect in many body parts, can prevent tissue overgrowth. In the present study, the positive effects of the pharmacological agent SL against insults were evaluated in vitro using HEI-OC1 cells. An animal model to simulate the damage due to electrode insertion during cochlear implantation was used. SL was delivered using osmotic pumps to prevent loss of the residual hearing in this animal model. Hearing deterioration, tissue fibrosis and ossification were confirmed in this animal model. Increased gene expressions of inflammatory cytokines were identified in the cochleae following dummy electrode insertion. Following the administration of SL, insertion led to a decrease in hearing threshold shifts, tissue reactions, and inflammatory markers. These results emphasize the possible role of SL in hearing preservation and improve our understanding of the mechanism underlying hearing loss after cochlear implantation.

Frequency-Selective, Multi-Channel, Self-Powered Artificial Basilar Membrane Sensor with a Spiral Shape and 24 Critical Bands Inspired by the Human Cochlea.

A spiral-artificial basilar membrane (S-ABM) sensor is reported that mimics the basilar membrane (BM) of the human cochlea and can detect sound by separating it into 24 sensing channels based on the frequency band. For this, an analytical function is proposed to design the width of the BM so that the frequency bands are linearly located along the length of the BM. To fabricate the S-ABM sensor, a spiral-shaped polyimide film is used as a vibrating membrane, with maximum displacement at locations corresponding to specific frequency bands of sound, and attach piezoelectric sensor modules made of poly(vinylidene fluoride-trifluoroethylene) film on top of the polyimide film to measure the vibration amplitude at each channel location. As the result, the S-ABM sensor implements a characteristic frequency band of 96-12,821 Hz and 24-independent critical bands. Using real-time signals from discriminate channels, it is demonstrated that the sensor can rapidly identify the operational noises from equipment processes as well as vehicle sounds from environmental noises on the road. The sensor can be used in a variety of applications, including speech recognition, dangerous situation recognition, hearing aids, and cochlear implants, and more.

Occurrence and Multiplex PCR Detection of Citrus Yellow Vein Clearing Virus in Korea.

Citrus yellow vein clearing virus (CYVCV) is a member of the Alphaflexiviridae family that causes yellow vein clearing symptoms on citrus leaves. A total of 118 leaf samples from nine regions of six provinces in Korea were collected from various citrus species in 2020 and 2021. Viral diagnosis using next-generation sequencing and reverse transcription polymerase chain reaction (RT-PCR) identified four viruses: citrus tristeza virus, citrus leaf blotch virus, citrus vein enation virus, and CYVCV. A CYVCV incidence of 9.3% was observed in six host plants, including calamansi, kumquat, Persian lime, and Eureka lemon. Among the citrus infected by CYVCV, only three samples showed a single infection; the other showed a mixed infection with other viruses. Eureka lemon and Persian lime exhibited yellow vein clearing, leaf distortion, and water-soak symptom underside of the leaves, while the other hosts showed only yellowing symptoms on the leaves. The complete genome sequences were obtained from five CYVCV isolates. Comparison of the isolates reported from the different geographical regions and hosts revealed the high sequence identity (95.2% to 98.8%). Phylogenetic analysis indicated that all the five isolates from Korea were clustered into same clade but were not distinctly apart from isolates from China, Pakistan, India, and Türkiye. To develop an efficient diagnosis system for the four viruses, a simultaneous detection method was constructed using multiplex RT-PCR. Sensitivity evaluation, simplex RT-PCR, and stability testing were conducted to verify the multiplex RT-PCR system developed in this study. This information will be useful for developing effective disease management strategies for citrus growers in Korea.

Recent Developments in Metallic Degradable Micromotors for Biomedical and Environmental Remediation Applications.

Synthetic micromotor has gained substantial attention in biomedicine and environmental remediation. Metal-based degradable micromotor composed of magnesium (Mg), zinc (Zn), and iron (Fe) have promise due to their nontoxic fuel-free propulsion, favorable biocompatibility, and safe excretion of degradation products Recent advances in degradable metallic micromotor have shown their fast movement in complex biological media, efficient cargo delivery and favorable biocompatibility. A noteworthy number of degradable metal-based micromotors employ bubble propulsion, utilizing water as fuel to generate hydrogen bubbles. This novel feature has projected degradable metallic micromotors for active in vivo drug delivery applications. In addition, understanding the degradation mechanism of these micromotors is also a key parameter for their design and performance. Its propulsion efficiency and life span govern the overall performance of a degradable metallic micromotor. Here we review the design and recent advancements of metallic degradable micromotors. Furthermore, we describe the controlled degradation, efficient in vivo drug delivery, and built-in acid neutralization capabilities of degradable micromotors with versatile biomedical applications. Moreover, we discuss micromotors' efficacy in detecting and destroying environmental pollutants. Finally, we address the limitations and future research directions of degradable metallic micromotors.

First report of konjac mosaic virus in Spuriopimpinella brachycarpa in Korea.

Spuriopimpinella brachycarpa Nakai (Common name, Chamnamul; family Apiaceae) is a plant whose leaves are consumed as a vegetable and used as a folk medicine in Korea (Kim et al., 2020). In February 2020, seven samples of S. brachycarpa leaf showing virus symptoms including yellowing, vein chlorosis, chlorotic lesions, and severe mottling were collected from a greenhouse in Busan, South Korea, to diagnose the potential disease (Fig. S1a, b). The disease incidence rate in the greenhouse was >10% (2,970 m2). To identify the causal virus, we analyzed leaf dip preparation and thin sections of the symptomatic leaves by transmission electron microscopy. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Fig. S1c, d). To confirm these results, the symptomatic leaf samples were further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using potyvirus universal primers (Table S2) and direct sequencing of the PCR products. All samples were positive for konjac mosaic virus (KoMV). To exclude the possibility of infection by multiple viruses, we performed high-throughput sequencing (HTS) on an Illumina NovaSeq 6000 system (Macrogen Inc., Seoul, South Korea). There were two contigs (9,267 and 2,851 nt) mapping to KoMV sequences. A large contig (9,267 nt; 705,967 mapped reads; mean read coverage of 11,351.4x) showed about 80% identity (93% coverage) with KoMV-F (GenBank accession no. NC_007913) isolated from Amorphophallus konjac in Japan (Nishiguchi et al., 2006). To isolate KoMV from S. brachycarpa, we mechanically inoculated leaf extracts from symptomatic samples onto Chenopodium quinoa as an assay host via three single-lesion passages, followed by propagation in Nicotiana benthamiana. In a bioassay of the KoMV isolate (KoMV-BS), we mechanically inoculated sap from infected N. benthamiana onto 31 indicator plants including Cryptotaenia japonica (Apiaceae), which is similar to S. brachycarpa (Table S3). KoMV-BS systemically induced vein chlorosis and/or leaf mottling in four Nicotiana species and C. japonica, and chlorotic local lesions in upper leaves of C. quinoa; no symptoms were observed in 25 other indicator plants. These results were confirmed by RT-PCR. Next, we obtained the complete genome sequence of KoMV-BS using HTS and 5' and 3' rapid amplification of cDNA ends, with newly designed primers (Table S2). The assembled full-length KoMV-BS genome sequence was 9,392 nt in length, excluding the poly(A) tail, and encoded a polyprotein composed of 3,060 amino acids. The sequence was deposited in GenBank (accession no. OR001914). BLAST analysis showed 84~88% and 90~98% identities at CP nucleotide and amino acid levels, respectively with the reported KoMV isolates, confirming the virus to be an isolate of KoMV (synonym; Japanese hornwort mosaic virus, zantedeschia mosaic virus) (Adams et al., 2005; Nishiguchi et al., 2006). KoMV infection was first reported in A. konjac from Japan (Shimoyama et al. 1992) and has been spread worldwide as one of the major causal agents of viral diseases in calla lily (Liao et al., 2020). To the best of our knowledge, this is the first report of KoMV infection in S. brachycarpa. To date, cucumber mosaic virus and tobacco mosaic virus have been reported to infect S. brachycarpa in Korea (Yoon et al., 2016; 2017). Our findings will be helpful for developing virus-management strategies to prevent yield and quality loss in S. brachycarpa.

Magnetically Enhanced Intracellular Uptake of Superparamagnetic Iron Oxide Nanoparticles for Antitumor Therapy.

Superparamagnetic iron oxide nanoparticles (SPIONs) have been widely employed in biomedical fields, including targeted delivery of antitumor therapy. Conventional magnetic tumor targeting has used simple static magnetic fields (SMFs), which cause SPIONs to linearly aggregate into a long chain-like shape. Such agglomeration greatly hinders the intracellular targeting of SPIONs into tumors, thus reducing the therapeutic efficacy. In this study, we investigated the enhancement of the intracellular uptake of SPIONs through the application of rotating magnetic fields (RMFs). Based on the physical principles of SPION chain disassembly, we investigated physical parameters to predict the chain length favorable for intracellular uptake. Our prediction was validated by clear visualization of the intracellular distributions of SPIONs in tumor cells at both cellular and three-dimensional microtissue levels. To identify the potential therapeutic effects of enhanced intracellular uptake, magnetic hyperthermia as antitumor therapy was investigated under varying conditions of magnetic hyperthermia and RMFs. The results showed that enhanced intracellular uptake reduced magnetic hyperthermia time and strength as well as particle concentration. The proposed method will be useful in the development of techniques to determine the optimized physical conditions for the enhanced intracellular uptake of SPIONs in antitumor therapy.

First report of beet western yellows virus in radish in Korea.

Radish (Raphanus sativus L.) is an important root vegetable widely consumed in kimchi in Korea. In October 2021, radish leaves with virus-like symptoms of mosaic and yellowing were collected in three fields around Naju, Korea (Fig. S1). A pooled sample (n = 24) was screened for causal viruses by high-throughput sequencing (HTS), with detection confirmed by reverse transcription (RT) PCR. Total RNA was extracted from symptomatic leaves using the Plant RNA Prep kit (Biocube System, Korea), and a cDNA library was constructed and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea). De novo transcriptome assembly yielded 63,708 contigs, which were analyzed against the viral reference genome database in GenBank by BLASTn and BLASTx searches. Two large contigs were clearly of viral origin. BLASTn analysis showed that a 9,842-bp contig (4,481,600 mapped reads, mean read coverage 68,758.6×) had 99% identity (99% coverage) with isolate CCLB of turnip mosaic virus (TuMV) from radish in China (KR153038). A second contig of 5,711 bp (7,185 mapped reads, mean read coverage 189.9×) had 97% identity (99% coverage) with isolate SDJN16 of beet western yellows virus (BWYV) from Capsicum annuum in China (MK307779). To confirm the presence of these viruses, total RNA extracted from 24 leaf samples was subjected to RT-PCR using primers specific for TuMV (N60_5'-ACATTGAAAAGCGTAACCA-3' and C30_5'-TCCCATAAGCGAGAATACTAACGA-3', amplicon 356 bp) and BWYV (95F_5'-CGAATCTTGAACACAGCAGAG-3' and 784R_5'-TGTGGG ATCTTGAAGGATAGG-3', amplicon 690 bp) for virus detection. Of the 24 samples, 22 were positive for TuMV and 7 were co-infected with BWYV. Single infection of BWYV was not detected. Infection with TuMV, the predominant virus in radish in Korea, was previously reported (Choi and Choi, 1992; Chung et al., 2015). To determine the complete genomic sequence of the BWYV isolate (BWYV-NJ22) from radish, RT-PCR was conducted using eight overlapping primer pairs designed according to the alignment of previously reported BWYV sequences (Table S2). Terminal sequences of the viral genome were analyzed by 5' and 3' rapid amplification of cDNA ends (RACE; Thermo Fisher Scientific Corp.). The assembled complete genome sequence of BWYV-NJ22 was 5,694 nt long and was deposited in GenBank (accession no. OQ625515). The Sanger sequences shared 96% nt identity with the HTS-derived sequence. BLASTn analysis showed that BWYV-NJ22 had high nucleotide identity (98%) at the complete genome level with a BWYV isolate (OL449448) from C. annuum in Korea. BWYV (genus Polerovirus, family Solemoviridae), is an aphid-borne virus with a host range that includes > 150 plant species and is one of the most important viruses causing yellowing and stunting of vegetable crops (Brunt et al., 1996; Duffus 1973). In Korea, BWYV was first reported to infect paprika, followed by pepper, motherwort, and figwort (Jeon et al., 2021; Kwon et al., 2016; 2018; Park et al., 2018). During fall and winter 2021, 675 radish plants with virus-like symptoms of mosaic, yellowing, and chlorosis were collected from 129 farms in major cultivation areas in Korea and analyzed by RT-PCR using the BWYV detection primers. The incidence of BWYV in radish plants was 4.7%, and all infections were mixed infections with TuMV. To our knowledge, this is the first report of BWYV infecting radish in Korea. The symptoms of single BWYV infection are unclear, as radish is a new host plant of BWYV in Korea. Further research on the pathogenicity and impact of this virus in radish is therefore needed.

Design and Synthesis of CdHgSe/HgS/CdZnS Core/Multi-Shell Quantum Dots Exhibiting High-Quantum-Yield Tissue-Penetrating Shortwave Infrared Luminescence.

Cdx Hg1- x Se/HgS/Cdy Zn1- y S core/multi-shell quantum dots (QDs) exhibiting bright tissue-penetrating shortwave infrared (SWIR; 1000-1700 nm) photoluminescence (PL) are engineered. The new structure consists of a quasi-type-II Cdx Hg1- x Se/HgS core/inner shell domain creating luminescent bandgap tunable across SWIR window and a wide-bandgap Cdy Zn1- y S outer shell boosting the PL quantum yield (QY). This compositional sequence also facilitates uniform and coherent shell growth by minimizing interfacial lattice mismatches, resulting in high QYs in both organic (40-80%) and aqueous (20-70%) solvents with maximum QYs of 87 and 73%, respectively, which are comparable to those of brightest visible-to-near infrared QDs. Moreover, they maintain bright PL in a photocurable resin (QY 40%, peak wavelength ≈ 1300 nm), enabling the fabrication of SWIR-luminescent composites of diverse morphology and concentration. These composites are used to localize controlled amounts of SWIR QDs inside artificial (Intralipid) and porcine tissues and quantitatively evaluate the applicability as luminescent probes for deep-tissue imaging.

Shape-memory effect in twisted ferroic nanocomposites.

The shape recovery ability of shape-memory alloys vanishes below a critical size (~50 nm), which prevents their practical applications at the nanoscale. In contrast, ferroic materials, even when scaled down to dimensions of a few nanometers, exhibit actuation strain through domain switching, though the generated strain is modest (~1%). Here, we develop freestanding twisted architectures of nanoscale ferroic oxides showing shape-memory effect with a giant recoverable strain (>8%). The twisted geometrical design amplifies the strain generated during ferroelectric domain switching, which cannot be achieved in bulk ceramics or substrate-bonded thin films. The twisted ferroic nanocomposites allow us to overcome the size limitations in traditional shape-memory alloys and open new avenues in engineering large-stroke shape-memory materials for small-scale actuating devices such as nanorobots and artificial muscle fibrils.

A Neurospheroid-Based Microrobot for Targeted Neural Connections in a Hippocampal Slice.

Functional restoration by the re-establishment of cellular or neural connections remains a major challenge in targeted cell therapy and regenerative medicine. Recent advances in magnetically powered microrobots have shown potential for use in controlled and targeted cell therapy. In this study, a magnetic neurospheroid (Mag-Neurobot) that can form both structural and functional connections with an organotypic hippocampal slice (OHS) is assessed using an ex vivo model as a bridge toward in vivo application. The Mag-Neurobot consists of hippocampal neurons and superparamagnetic nanoparticles (SPIONs); it is precisely and skillfully manipulated by an external magnetic field. Furthermore, the results of patch-clamp recordings of hippocampal neurons indicate that neither the neuronal excitabilities nor the synaptic functions of SPION-loaded cells are significantly affected. Analysis of neural activity propagation using high-density multi-electrode arrays shows that the delivered Mag-Neurobot is functionally connected with the OHS. The applications of this study include functional verification for targeted cell delivery through the characterization of novel synaptic connections and the functionalities of transported and transplanted cells. The success of the Mag-Neurobot opens up new avenues of research and application; it offers a test platform for functional neural connections and neural regenerative processes through cell transplantation.

A Microfluidic System for Investigating Anticipatory Medication Effects on Dopamine Homeostasis in Dopaminergic Cells.

Dopamine (DA) homeostasis influences emotions, neural circuit development, cognition, and the reward system. Dysfunctions in DA regulation can lead to neurological disorders, including depression, developmental disorders, and addiction. DA homeostasis disruption is a primary cause of Parkinson's Disease (PD). Therefore, understanding the relationship between DA homeostasis and PD progression may clarify the mechanisms for pharmacologically treating PD. This study developed a novel in vitro DA homeostasis platform which consists of three main parts: (1) a microfluidic device for culturing DAergic neurons, (2) an optical detection system for reading DA levels, and (3) an automatic closed-loop control system that establishes when and how much medication to infuse; this uses a microfluidic device that can cultivate DAergic neurons, perfuse solutions, perform in vitro PD modeling, and continuously monitor DA concentrations. The automatically controlled closed-loop control system simultaneously monitors pharmacological PD treatment to support long-term monitoring of DA homeostasis. SH-SY5Y neuroblastoma cells were chosen as DAergic neurons. They were cultivated in the microfluidic device, and real-time cellular DA level measurements successfully achieved long-term monitoring and modulation of DA homeostasis. When applied in combination with multiday cell culture, this advanced system can be used for drug screening and fundamental biological studies.

Fabrication and Underwater Testing of a Vector Hydrophone Comprising a Triaxial Piezoelectric Accelerometer and Spherical Hydrophone.

A vector hydrophone is an underwater acoustic sensor that can detect the direction of a sound source. Wide-band characteristics and high sensitivity enhance the performance of underwater surveillance systems in complex environments. A vector hydrophone comprising a triaxial piezoelectric accelerometer and spherical hydrophone was fabricated and tested in the air and underwater. The vector hydrophone was designed to exceed the quantitative figures of merit (i.e., receiving voltage sensitivity and bandwidth) of commercially available hydrophones. Accelerometer performance was enhanced by placing a pair of piezoelectric single crystals on each axis and modifying the seismic mass material. The receiving voltage sensitivity of the omnidirectional hydrophone was approximately −160 dB relative to 1 V/µPa with the amplifier in water; the sensitivity of the accelerometer exceeded 300 mV/g in air and −215 dB relative to 1 V/µPa underwater over the frequency range of interest. The receiving directivity of the vector hydrophone was validated underwater, which confirmed that it could detect the direction of a sound source.

Multi-target cell therapy using a magnetoelectric microscale biorobot for targeted delivery and selective differentiation of SH-SY5Y cells via magnetically driven cell stamping.

Cell therapy refers to a treatment that involves the delivery of cells or cellular material by means of injection, grafting, or implantation in order to replace damaged tissue and restore its function, or to aid the body in fighting disease. However, limitations include poor targeting delivery and low therapeutic efficacy due to low cell survival. Hence, novel approaches are required to increase cell delivery efficiency and enhance therapeutic efficacy via selective cell differentiation at target areas. Here, we present a stamping magnetoelectric microscale biorobot (SMMB) consisting of neuron-like cell spheroids loaded with magnetoelectric nanoparticles. The SMMB enables not only effective targeted delivery of cells to multiple target areas (via minimally invasive stamping employing magnetic actuation) but also facilitates selective neuronal differentiation via magnetoelectric (ME) stimulation. This ensures rapid colonization and enhances efficacy. SMMBs were fabricated using SH-SY5Y cells. Magnetoelectric nanoparticles for ME stimulation responded to an alternating magnetic field that ensured targeted cell differentiation. Multi-target cell therapy facilitated the targeted delivery and selective differentiation of SH-SY5Y cells to multiple regions using a single SMMB with rotating and alternating magnetic fields for delivery and ME stimulation. This promising tool may overcome the limitations of existing cell therapy for neurodegenerative diseases.

A Biodegradable Magnetic Microrobot Based on Gelatin Methacrylate for Precise Delivery of Stem Cells with Mass Production Capability.

A great deal of research has focused on small-scale robots for biomedical applications and minimally invasive delivery of therapeutics (e.g., cells, drugs, and genes) to a target area. Conventional fabrication methods, such as two-photon polymerization, can be used to build sophisticated micro- and nanorobots, but the long fabrication cycle for a single microrobot has limited its practical use. This study proposes a biodegradable spherical gelatin methacrylate (GelMA) microrobot for mass production in a microfluidic channel. The proposed microrobot is fabricated in a flow-focusing droplet generator by shearing a mixture of GelMA, photoinitiator, and superparamagnetic iron oxide nanoparticles (SPIONs) with a mixture of oil and surfactant. Human nasal turbinate stem cells (hNTSCs) are loaded on the GelMA microrobot, and the hNTSC-loaded microrobot shows precise rolling motion in response to an external rotating magnetic field. The microrobot is enzymatically degraded by collagenase, and released hNTSCs are proliferated and differentiated into neuronal cells. In addition, the feasibility of the GelMA microrobot as a cell therapeutic delivery system is investigated by measuring electrophysiological activity on a multielectrode array. Such a versatile and fully biodegradable microrobot has the potential for targeted stem cell delivery, proliferation, and differentiation for stem cell-based therapy.

Incidence and Molecular Identification of Begomoviruses Infecting Tomato and Pepper in Myanmar.

In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

First report of Ranunculus mild mosaic virus in Ranunculus asiaticus in Korea.

Ranunculus (Ranunculus asiaticus L.) is a popular ornamental plant mainly cultivated for cut flowers and flowering potted plants. In January 2021, a leaf sample of R. asiaticus that showed virus-like symptoms including mosaic, yellowing and malformation on leaves was collected from a greenhouse in Jangheung, South Korea for disease diagnosis (Fig. S1). Disease incidence was greater than 30% in the greenhouse (~1,000 m2). Transmission electron microscopy (TEM) of symptomatic leaves identified potyvirus-like filamentous virus particles of about 800 nm. To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for six potyviruses that infect R. asiaticus (Sacco et al., 2018). The sample was positive only for ranunculus mild mosaic virus (RanMMV). Additional analysis of nine symptomatic R. asiaticus plants from the infected greenhouse found that all samples were positive for RanMMV. To exclude the presence of the other viruses, next generation sequencing (NGS) was carried out. Total RNA was extracted from symptomatic leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and a transcriptome library was generated using the TruSeq Stranded Total RNA LT Sample Prep kit (Illumina, San Diego, CA) acccording to the recommended protocol. NGS was performed using an Illumina NovaSeq 6000 system (Macrogen Inc., Korea). A total of 75.58 million reads were obtained, and the reads were de novo assembled to contigs using Trinity software (Grabherr et al., 2011). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database identified the assembled large contig of 9,539 nt (5,321 mapped reads, mean read coverage of 84.2 times) as RanMMV. This sequence shared 98% nt identity (99% coverage) with the RanMMV NL isolate (acc. no. LC604020) isolated from an anemone plant (A. blanda cv. Charmer) from Netherlands. To obtain the complete genome sequence, the termini sequences were determined by 5' and 3' rapid amplification of cDNA ends (RACE) methods as reported recently (Imamura et al., 2021). The assembled full-length genome sequence of RanMMV-JH is 9,574 nt in length, excluding the poly(A) tail, and encoding a polyprotein of 3,074aa. The sequence was deposited in GenBank under the accession no. OL742438. RanMMV is transmitted by aphids in a nonpersistent manner and has very narrow host range. RanMMV, one of causative agents of ranunculus mosaic disease, has been problematic in ranunculus production area of Japan (Hayahi et al., 2018; Kamikawa et al., 2022). Recently, some perennial weeds from the Ranunculaceae family (e.g. R. japonicus, R. silerifolius and R. tachiroei) are known to may act as a virus reservoir (Kamikawa et al., 2022). As R. asiaticus is cultivated by vegetative propagation, there is need to develop certification system for producing virus-free R. asiaticus. To our knowledge, this is the first report of RanMMV infection in R. asiaticus in Korea.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.