Effect of dexmedetomidine infusion on postoperative sleep disturbances in women with breast cancer: A monocentric randomized-controlled double-blind trial.

BACKGROUND: Most women with breast cancer are prone to postoperative sleep disturbances (POSD). Little is known about the differences between sevoflurane and propofol combined with dexmedetomidine on POSD in the same context. We investigated the effect of intra-operative sevoflurane or propofol combined with intravenous dexmedetomidine on the incidence of POSD and postoperative sleep structures. METHODS: A monocentric, randomized-controlled, double-blind trial. Female patients undergoing radical surgery for breast cancer were randomly assigned to receive sevoflurane and placebo, sevoflurane and dexmedetomidine, propofol and placebo, or propofol and dexmedetomidine. Dexmedetomidine was administered at 1.0 µg kg-1 infusion 15 min before induction, then infused at 0.4 µg kg-1 h-1 until the surgical drain started to be placed. The primary outcome was the incidence of POSD within the postoperative first three days (defined as an Athens Insomnia Scale score ≥ 6 points on at least one day of postoperative first three days). The secondary outcome was the duration of sleep structures, collected from the Fitbit Charge 2® smart bracelet (Fitbit, Inc., San Francisco, CA, USA). RESULTS: There were 188 women analyzed with the modified intention-to-treat method. The incidences of POSD in the dexmedetomidine and placebo groups were similar (p = 0.649). In the sevoflurane sedation strategy, dexmedetomidine decreased nocturnal wakefulness on postoperative first day (p = 0.001). In the propofol sedation strategy, dexmedetomidine increased nocturnal deep sleep on postoperative first (p < 0.001) and third (p < 0.001) days. CONCLUSION: Intra-operative infusion of dexmedetomidine had no significant effect on POSD but decreased nocturnal wakefulness in the sevoflurane group and increased nocturnal deep sleep in the propofol group. TRIAL REGISTRATION: Registered at www.chictr.org.cn (ChiCTR2300070136).

Fe3O4-lignin@Pd-NPs: A highly active, stable and broad-spectrum nanocomposite for water treatment.

In this work, we report an environmentally friendly renewable nanocomposite magnetic lignin-based palladium nanoparticles (Fe3O4-lignin@Pd-NPs) for efficient wastewater treatment by decorating palladium nanoparticles without using any toxic reducing agents on the magnetic lignin abstracted from Poplar. The structure of composite Fe3O4-lignin@Pd-NPs was unambiguously confirmed by XRD, SEM, TEM, EDS, FTIR, and Zeta potential. After systematic evaluation of the use and efficiency of the composite to remove toxic organic dyes in wastewater, some promising results were observed as follows: Fe3O4-lignin@Pd-NPs exhibits highly active and efficient performance in the removal of toxic methylene blue (MB) (up to 99.8 %) wastewater in 2 min at different concentrations of MB and different pH values. Moreover, except for toxic MB, the other organic dyes including Rhodamine B (RhB), Rhodamine 6G (Rh6G), and Methyl Orange (MO) can also be removed efficiently by the composite. Finally, the easily recovered composite Fe3O4-lignin@Pd-NPs exhibits well stability and reusability, and catalytic efficiency is maintained well after ten cycles. In conclusion, the lignin-based magnetism Pd composite exhibits powerful potential practical application in industrial wastewater treatment.

Effects of Baking and Frying on the Protein Oxidation of Wheat Dough.

Protein oxidation caused by food processing is harmful to human health. A large number of studies have focused on the effects of hot processing on protein oxidation of meat products. As an important protein source for human beings, the effects of hot processing on protein oxidation in flour products are also worthy of further study. This study investigated the influences on the protein oxidation of wheat dough under baking (0-30 min, 200 °C or 20 min, 80-230 °C) and frying (0-18 min, 180 °C or 10 min, 140-200 °C). With the increase in baking and frying time and temperature, we found that the color of the dough deepened, the secondary structure of the protein changed from α-helix to ß-sheet and ß-turn, the content of carbonyl and advanced glycation end products (AGEs) increased, and the content of free sulfhydryl (SH) and free amino groups decreased. Furthermore, baking and frying resulted in a decrease in some special amino acid components in the dough, and an increase in the content of amino acid oxidation products, dityrosine, kynurenine, and N'-formylkynurenine. Moreover, the nutritional value evaluation results showed that excessive baking and frying reduced the free radical scavenging rate and digestibility of the dough. These results suggest that frying and baking can cause protein oxidation in the dough, resulting in the accumulation of protein oxidation products and decreased nutritional value. Therefore, it is necessary to reduce excessive processing or take reasonable intervention measures to reduce the effects of thermal processing on protein oxidation of flour products.

G-Quadruplexes Formation by the C9orf72 Nucleotide Repeat Expansion d(GGGGCC)n and Conformation Regulation by Fangchinoline.

The G-quadruplex (GQ)-forming hexanucleotide repeat expansion (HRE) in the C9orf72 (C9) gene has been found to be the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (collectively, C9ALS/FTD), implying the great significance of modulating C9-HRE GQ structures in C9ALS/FTD therapeutic treatment strategies. In this study, we investigated the GQ structures formed by varied lengths of C9-HRE DNA sequences d(GGGGCC)4 (C9-24mer) and d(GGGGCC)8 (C9-48mer), and found that the C9-24mer forms anti-parallel GQ (AP-GQ) in the presence of potassium ions, while the long C9-48mer bearing eight guanine tracts forms unstacked tandem GQ consisting of two C9-24mer unimolecular AP-GQs. Moreover, the natural small molecule Fangchinoline was screened out in order to be able to stabilize and alter the C9-HRE DNA to parallel GQ topology. Further study of the interaction of Fangchinoline with the C9-HRE RNA GQ unit r(GGGGCC)4 (C9-RNA) revealed that it can also recognize and improve the thermal stability of C9-HRE RNA GQ. Finally, use of AutoDock simulation results indicated that Fangchinoline binds to the groove regions of the parallel C9-HRE GQs. These findings pave the way for further studies of GQ structures formed by pathologically related long C9-HRE sequences, and also provide a natural small-molecule ligand that modulates the structure and stability of C9-HRE GQ, both in DNA and RNA levels. Altogether, this work may contribute to therapeutic approaches of C9ALS/FTD which take the upstream C9-HRE DNA region, as well as the toxic C9-HRE RNA, as targets.

Effect of Different Doses of Butorphanol on Postoperative Shivering in Elderly Patients: A Randomized, Double-Blind, Placebo-Controlled Trial.

Purpose: This study was designed to investigate the effects of different doses of butorphanol on postoperative shivering and quality of recovery in elderly patients. Patients and Methods: A total of 147 elderly patients (aged 60 or older) scheduled for elective transurethral resection of the prostate were enrolled in the current study. Patients were randomly and evenly assigned into four groups: Group C (0.9% normal saline), Group B1 (butorphanol 0.01 mg/kg), Group B2 (butorphanol 0.02 mg/kg) and Group B3 (butorphanol 0.03 mg/kg). All drugs were diluted to 5mL and injected intravenously slowly 5 min before induction of anesthesia. The primary outcome measure was the incidence of postoperative shivering in the post-anesthesia care unit. Quality of Recovery-40 (QoR-40) scores were assessed on postoperative day (POD) 1, 2 and 3. Perioperative core and skin temperature, extubation time and adverse events were also recorded. Results: Patients among the four groups had comparable baseline characteristics. Compared with Group C, the incidence of shivering was significantly lower in Group B2 and B3 (P = 0.006 and P = 0.005, respectively). The QoR-40 scores on POD1 were significantly higher in all butorphanol groups than that in Group C (P < 0.0083). In Group B2 and B3, patients experienced lower pain intensity (P < 0.001). In addition, the incidence of catheter-related bladder discomfort (CRBD) was lower in all butorphanol groups than in Group C (P < 0.0083). Conclusion: Butorphanol 0.02 or 0.03 mg/kg could effectively prevent the occurrence of postoperative shivering in elderly patients scheduled for transurethral resection of the prostate, provided effective postoperative recovery and postoperative analgesia.

Unexpected Cascade Dehydrogenation Triggered by Pd/Cu-Catalyzed C(sp3)-H Arylation/Intramolecular C-N Coupling of Amides: Facile Access to 1,2-Dihydroquinolines.

In this work, we successfully explored an unexpected dehydrogenation triggered by Pd/Cu-catalyzed C(sp3)-H arylation and intramolecular C-N coupling of amides to synthesize the bioactive 1,2-dihydroquinoline scaffold with good regioselectivity and good compatibility of functional groups. This strategy provides an alternative route to realize molecular complexity and diversity from simple and readily available molecules via multiple C-H bond activation. Preliminary mechanistic studies demonstrated that ß,γ-dehydrogenation is triggered by the arylation of the C(sp3)-H bond and the intramolecular C-N coupling.

Formation, structure and stability of high internal phase Pickering emulsions stabilized by BSPI-C3G covalent complexes.

Food-grade high internal phase Pickering emulsions (HIPPEs) are stabilized by protein-based particles, which have attracted extensive attention due to their good gel-like structure. The black soybean isolate protein/cyanidin-3-O-glucoside (BSPI-C3G) covalent particles were used as a particulate emulsifier to form stable HIPPEs with oil phase fractions (74 % v/v) and low particle concentrations (0.5 %-3 % w/v) The particle size distribution and microstructure demonstrated that the BSPI-C3G covalent particles acted as an interfacial layer and surrounded the oil droplets. As the concentration of BSPI-C3G particles increased from 0.5 % to 3 %, the droplet size, elasticity, antioxidant capacity of the heated or stored HIPPEs more stable. So, the HIPPEs had the best stability with the BSPI-C3G particle at 3 % (w/v) concentration. These findings may extend the application of BSPI and C3G in foods and provide the guidelines for the rational design of food-grade HIPPEs stabilized by protein/anthocyanin complexes.

Integrated bioinformatics analysis uncovers characteristic genes and molecular subtyping system for endometriosis.

Objective: Endometriosis is a chronic inflammatory estrogen-dependent disease with the growth of endometrial tissues outside the uterine cavity. Nevertheless, the etiology of endometriosis is still unclear. Integrated bioinformatics analysis was implemented to reveal the molecular mechanisms underlying this disease. Methods: A total of four gene expression datasets (GSE7305, GSE11691, GSE23339, and GSE25628) were retrieved from the GEO, which were merged into a meta-dataset, followed by the removal of batch effects via the sva package. Weighted gene co-expression network analysis (WGCNA) was implemented, and endometriosis-related genes were screened under normal and endometriosis conditions. Thereafter, characteristic genes were determined via Lasso analysis. The diagnostic performance was estimated via receiver operating characteristic curves, and epigenetic and post-transcriptional modifications were analyzed. Small molecular compounds were predicted. Unsupervised clustering analysis was conducted via non-negative matrix factorization algorithm. The enriched pathways were analyzed via gene set enrichment analysis or GSVA. Immune features were evaluated according to immune-checkpoints, HLA, receptors, chemokines, and immune cells. Results: In total, four characteristic genes (BGN, AQP1, ELMO1, and DDR2) were determined for endometriosis, all of which exhibited the favorable efficacy in diagnosing endometriosis. Their aberrant levels were modulated by epigenetic and post-transcriptional modifications. In total, 51 potential drugs were predicted against endometriosis. The characteristic genes exhibited remarkable associations with immunological function. Three subtypes were classified across endometriosis, with different mechanisms and immune features. Conclusion: Our study reveals the characteristic genes and novel molecular subtyping of endometriosis, contributing to the early diagnosis and intervention in endometriosis.

MicroRNA-409-5p inhibits cell proliferation, and induces G2/M phase arrest and apoptosis by targeting DLGAP5 in ovarian cancer cells.

MicroRNA (miRNA/miR)-409-5p has been reported to be implicated in prostate and breast cancers; however, its functional role in ovarian cancer (OC) remains unclear. Therefore the aim of the present study was to investigate the clinical significance and biological function of miR-409-5p in OC. Here, reverse transcription-quantitative PCR analysis was performed to detect miR-409-5p expression in OC tissues and cell lines. The association between miR-409-5p expression and the clinicopathological characteristics of patients with OC was assessed using the Fisher's exact test. Furthermore, the Cell Counting Kit-8 assay was performed to assess cell proliferation. Cell cycle distribution and apoptosis were evaluated via flow cytometric analysis, and the target gene of miR-409-5p was validated via the dual-luciferase reporter assay. The results demonstrated that miR-409-5p expression was significantly downregulated in OC tissues and cell lines compared with adjacent normal tissues and epithelial cells, respectively. In addition, low miR-409-5p expression was significantly associated with tumor size (P=0.044) and the International Federation of Gynecology and Obstetrics staging system (P=0.005). Notably, overexpression of miR-409-5p suppressed cell proliferation, and induced G2/M phase arrest and apoptosis of OC cells. Mechanistically, discs large-associated protein 5 (DLGAP5) was identified as a novel target of miR-409-5p, which was negatively regulated by miR-409-5p. DLGAP5 expression was significantly upregulated in OC tissues and cell lines compared with adjacent normal tissues and epithelial cells, respectively. Furthermore, overexpression of DLGAP5 reversed the effects of miR-409-5p on SKOV-3 cell proliferation, and G2/M phase and apoptosis. Taken together, these results suggest that miR-409-5p acts as a tumor suppressor in OC by modulating DLGAP5 expression.

Effect of Systemic Lidocaine on Postoperative Early Recovery Quality in Patients Undergoing Supratentorial Tumor Resection.

Purpose: Lidocaine has been gradually used in general anesthesia. This study was designed to investigate the effect of systemic lidocaine on postoperative quality of recovery (QoR) in patients undergoing supratentorial tumor resection, and to explore its brain-injury alleviation effect in neurosurgical anesthesia. Patients and Methods: Sixty adult patients undergoing elective supratentorial tumor resection. Patients were randomly assigned either to receive lidocaine (Group L: 1.5 mg/kg bolus completed 10 min before anesthesia induction followed by an infusion at 2.0 mg/kg/h) or to receive normal saline (Group C: received volume-matched normal saline at the same infusion rate). Primary outcome measures were Quality of Recovery-40 (QoR-40) scores on postoperative day (POD) 1 and 2. Plasma concentrations of S100B protein (S100B), neuron specific enolase (NSE), interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) before anesthesia induction and at the end of surgery were assessed. Visual Analogue Scale (VAS) scores were assessed at 1, 2, 6, 12, 24 and 48 h after surgery. Perioperative parameters and adverse events were also recorded. Results: Patients between two groups had comparable baseline characteristics. Global QoR-40 scores on POD 1 and POD 2 were significantly higher (P <0.001) in group L (165.5±3.8 vs 173.7±4.7) than those in group C (155.6±4.0 vs 163.2±4.5); and scores of physical comfort, emotional state, and pain in group L were superior to those in group C (P <0.05). In group L, patients possessed lower plasma concentration of pro-inflammatory factors (IL-6, TNF-α) and brain injury-related factors (S100B, NSE) (P <0.05), consumed less remifentanil and propofol, and experienced lower pain intensity. Multiple linear regression analysis demonstrated age and pain were correlated with postperative recovery quality. Conclusion: Systemic lidocaine improved early recovery quality after supratentorial tumor resection with general anesthesia, and had certain brain-injury alleviation effects. These benefits may be attributed to the inflammation-alleviating and analgesic properties of lidocaine.

Design of a High-Sensitivity Dimeric G-Quadruplex/Hemin DNAzyme Biosensor for Norovirus Detection.

G-quadruplexes can bind with hemin to form peroxidase-like DNAzymes that are widely used in the design of biosensors. However, the catalytic activity of G-quadruplex/hemin DNAzyme is relatively low compared with natural peroxidase, which hampers its sensitivity and, thus, its application in the detection of nucleic acids. In this study, we developed a high-sensitivity biosensor targeting norovirus nucleic acids through rationally introducing a dimeric G-quadruplex structure into the DNAzyme. In this strategy, two separate molecular beacons each having a G-quadruplex-forming sequence embedded in the stem structure are brought together through hybridization with a target DNA strand, and thus forms a three-way junction architecture and allows a dimeric G-quadruplex to form, which, upon binding with hemin, has a synergistic enhancement of catalytic activities. This provides a high-sensitivity colorimetric readout by the catalyzing H2O2-mediated oxidation of 2,2'-azino-bis(3-ethylbenzothiazoline -6-sulfonic acid) diammonium salt (ABTS). Up to 10 nM of target DNA can be detected through colorimetric observation with the naked eye using our strategy. Hence, our approach provides a non-amplifying, non-labeling, simple-operating, cost-effective colorimetric biosensing method for target nucleic acids, such as norovirus-conserved sequence detection, and highlights the further implication of higher-order multimerized G-quadruplex structures in the design of high-sensitivity biosensors.

Preliminary quantitative analysis of vertebral microenvironment changes in type 2 diabetes mellitus using FOCUS IVIM-DWI and IDEAL-IQ sequences.

PURPOSE: To explore the application of intravoxel incoherent motion diffusion-weighted imaging(IVIM-DWI) on account of field-of-view optimized and constrained undistorted single shot (FOCUS) and iteraterative decomposition of water and fat with echo asymmetry and least-squares estimation quantitation(IDEAL-IQ) sequences in evaluating the vertebral microenvironment changes of type 2 diabetes mellitus(T2DM) patients and the correlation with bone mineral density(BMD). METHOD: 128 T2DM patients (mean age 63.4 ± 5.28 years) underwent both dual-energy X-ray absorptiometry (DEXA) and spine MRI. The FOCUS IVIM-DWI and IDEAL-IQ derived parameters of the vertebral body(L1, L2, L3, L4)were measured on corresponding maps of the lumbar spine. The subjects were divided into 3 groups according to T-scores as follows: normal (n = 37), osteopenia (n = 43), and osteoporosis(n = 48) group.One-way analysis of variance (ANOVA) were used to compare the vertebral parameters(ADCslow, ADCfast, f, FF, R2*) among three BMD cohorts.Receiver operating characteristic (ROC) analyses and Spearman's rank correlation were performed to test the diagnostic performance and the correlation between them respectively. RESULTS: There were significant differences in vertebral ADCslow, ADCfast, FF and R2* between the three groups (P < 0.05).Statistically, BMD was moderately negatively correlated with FF (r = -0.584, P < 0.001) and weakly positively with ADCslow (r = 0.334, P < 0.001), meanwhile moderately positively correlated with R2*(r = 0.509, P < 0.001) and ADCfast(0.545, P < 0.001).ADCfast was moderately negatively correlated with FF (r = -0.417, P < 0.001), weakly positively correlated with R2*(0.359, P < 0.001).Compared with the area under the curve (AUC) of ADCslow, ADCfast, FF and R2*, the AUC of ADCfast was higher in identifying between normal and abnormal(osteopenia and osteoporosis), normal from osteopenia, while the AUC of FF was higher in identifying osteopenia from osteoporosis. CONCLUSIONS: FOCUS IVIM-DWI and IDEAL-IQ of lumbar spine might be useful to evaluate the vertebral microenvironment changes of T2DM patients.

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cß can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

Non-Canonical G-quadruplexes cause the hCEB1 minisatellite instability in Saccharomyces cerevisiae.

G-quadruplexes (G4) are polymorphic four-stranded structures formed by certain G-rich nucleic acids in vitro, but the sequence and structural features dictating their formation and function in vivo remains uncertain. Here we report a structure-function analysis of the complex hCEB1 G4-forming sequence. We isolated four G4 conformations in vitro, all of which bear unusual structural features: Form 1 bears a V-shaped loop and a snapback guanine; Form 2 contains a terminal G-triad; Form 3 bears a zero-nucleotide loop; and Form 4 is a zero-nucleotide loop monomer or an interlocked dimer. In vivo, Form 1 and Form 2 differently account for 2/3rd of the genomic instability of hCEB1 in two G4-stabilizing conditions. Form 3 and an unidentified form contribute to the remaining instability, while Form 4 has no detectable effect. This work underscores the structural polymorphisms originated from a single highly G-rich sequence and demonstrates the existence of non-canonical G4s in cells, thus broadening the definition of G4-forming sequences.

ESI mass spectrometric exploration of selective recognition of G-quadruplex in c-myb oncogene promoter using a novel flexible cyclic polyamide.

In this research, electrospray ionization mass spectrometry (ESI-MS) was used to probe the binding selectivity of a flexible cyclic polyamide (cß) to G-quadruplexes from the long G-rich sequences in the c-myb oncogene promoter. The results show that three G-rich sequences, including d[(GGA)3GGTCAC(GGA)4], d[(GGA)4GAA(GGA)4], and d[(GGA)3GGTCAC(GGA)4GAA(GGA)4] species in the c-myb promoter can form parallel G-quadruplexes, and cß selectively binds towards these G-quadruplexes over both several other G-quadruplexes and the duplex DNA. These properties of cß have profound implications on future studies of the regulation of c-myb oncogene expression.

Exploring the formation and recognition of an important G-quadruplex in a HIF1α promoter and its transcriptional inhibition by a benzo[c]phenanthridine derivative.

Four putative G-quadruplex sequences (PGSs) in the HIF1α promoter and the 5'UTR were evaluated for their G-quadruplex-forming potential using ESI-MS, CD, FRET, DMS footprinting, and a polymerase stop assay. An important G-quadruplex (S1) has been proven to inhibit HIF1α transcription by blocking AP2 binding. A benzo[c]phenanthridine derivative was found to target the S1 G-quadruplex and induce its conformational conversion from antiparallel to parallel orientation. The transcriptional suppression of HIF1α by this compound was demonstrated using western blotting, Q-RT-PCR, luciferase assay, and ChIP. Our new findings provided a novel strategy for HIF1α regulation and potential insight for cancer therapy.

Convenient method for the synthesis of a flexible cyclic polyamide for selective targeting of c-myb G-quadruplex DNA.

A convenient efficient method for synthesis of a flexible cyclic polyamide (cß, 1) was developed through cyclodimerization. Electrospray ionization mass spectrometry and nuclear magnetic resonance results showed that 1 selectively binds to the c-myb G-quadruplex with high affinity, and there was no binding with the ILPR, bcl-2, and c-kit G-quadruplexes. This is the first time that a flexible cyclic polyamide was found to have high selectivity for the c-myb G-quadruplex.

Investigation of non-covalent interaction of natural flexible cyclic molecules with telomeric RNA G-quadruplexes by electrospray ionization mass spectrometry.

RATIONALE: Recently, human telomeric DNA was found to be transcribed into RNA transcripts composing of tandem repeats of r(UUAGGG) which can form G-quadruplex structures. Studies have shown that human telomeric RNA is associated with the telomerase activity in vitro. Finding high affinity small molecule ligands binding to the telomeric RNA G-quadruplex may facilitate the regulation of the telomerase activity. METHODS: The 12-mer and 24-mer telomeric RNA sequences, r(UAGGGUUAGGGU) and r(UAGGGUUAGGGUUAGGGUUAGGGU), were synthesized by TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa, Dalian) with high-performance liquid chromatography (HPLC) purification. Electrospray ionization ion-trap mass spectrometry was used to evaluate the binding affinities of three natural flexible cyclic molecules, tetrandrine, fangchinoline and cepharanthine, with the telomeric RNA G-quadruplexes. The fragmentation pathways of the G-quadruplexes and G-quadruplex-ligand complexes were investigated by tandem mass spectrometry. RESULTS: the natural flexible cyclic molecules were found to have high binding affinities to the 12-mer and 24-mer RNA G-quadruplexes with stoichiometry of 1:1 to 3:1. Collision-induced dissociation tandem mass spectrometry shows that the G-quadruplex-ligand complexes lose neutral ammoniums first and the small molecule ligand subsequently. Besides, among the three flexible cyclic molecules, cepharanthine binds most tightly to the RNA G-quadruplexes than tetandrine and fangchinoline. CONCLUSIONS: Three flexible cyclic small molecules were found to be potential telomeric RNA G-quadruplex ligands, especially cepharanthine, which has high affinity and binds most tightly to the RNA G-quadruplexes. These findings may provide further implications in the regulation of telomeric RNA and telomerase activity.

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products.

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.

The formation and stabilization of a novel G-quadruplex in the 5'-flanking region of the relaxin gene.

It has been reported that binding of STAT3 protein to the 5'-flanking region of the relaxin gene may result in downregulation of the relaxin expression. There is a Guanine(G)-rich segment located in about 3.8 Kb upstream of the relaxin gene and very close to the STAT3's binding site. In our study, NMR spectroscopy revealed the formation of G-quadruplex by this G-rich strand, and the result was confirmed by ESI mass spectrometry and CD spectroscopy. The theoretical structure of RLX G-quadruplex was constructed and refined by molecular modeling. When this relaxin G-quadruplex was stabilized by berberine(ΔTm = 10°C), a natural alkaloid from a Chinese herb, the gene expression could be up-regulated in a dose-dependent manner which was proved by luciferase assay. This result is different from the general G-quadruplex function that inhibiting the telomere replication or down-regulating many oncogenes expression. Therefore, our study reported a novel G-quadruplex in the relaxin gene and complemented the regulation mechanism about gene expression by G-quadruplexes.