Recent selection and introgression facilitated high-altitude adaptation in cattle.

During the past 3000 years, cattle on the Qinghai-Xizang Plateau have developed adaptive phenotypes under the selective pressure of hypoxia, ultraviolet (UV) radiation, and extreme cold. The genetic mechanism underlying this rapid adaptation is not yet well understood. Here, we present whole-genome resequencing data for 258 cattle from 32 cattle breeds/populations, including 89 Tibetan cattle representing eight populations distributed at altitudes ranging from 3400 m to 4300 m. Our genomic analysis revealed that Tibetan cattle exhibited a continuous phylogeographic cline from the East Asian taurine to the South Asian indicine ancestries. We found that recently selected genes in Tibetan cattle were related to body size (HMGA2 and NCAPG) and energy expenditure (DUOXA2). We identified signals of sympatric introgression from yak into Tibetan cattle at different altitudes, covering 0.64%-3.26% of their genomes, which included introgressed genes responsible for hypoxia response (EGLN1), cold adaptation (LRP11), DNA damage repair (LATS1), and UV radiation resistance (GNPAT). We observed that introgressed yak alleles were associated with noncoding variants, including those in present EGLN1. In Tibetan cattle, three yak introgressed SNPs in the EGLN1 promoter region reduced the expression of EGLN1, suggesting that these genomic variants enhance hypoxia tolerance. Taken together, our results indicated complex adaptation processes in Tibetan cattle, where recently selected genes and introgressed yak alleles jointly facilitated rapid adaptation to high-altitude environments.

Genome-wide analyses based on a novel donkey 40K liquid chip reveal the gene responsible for coat color diversity in Chinese Dezhou donkey.

Dezhou donkey is one of the representative local breeds in China, which is mainly divided into two strains: Sanfen and Wutou. There are obvious differences in coat color between the two strains. The former shows light points around the eyes, around the muzzle and under the belly, while the latter is completely solid black. In this study, genome-wide association analysis was performed for the differences in coat color traits between the Sanfen (n = 97) and Wutou (n = 108) strains using a novel donkey 40K liquid chip developed based on GenoBaits technology, to identify genomic regions and causal genes that could explain this variation. We also used FST and The cross-population composite likelihood ratio test (XPCLR) analyses to explore selected regions related to coat color differences. We identified one significant region on chromosome 15, with the most significant SNP located within the agouti signaling protein (ASIP) gene. At the same time, both FST and XPCLR methods detected the same selected region on chromosome 15, and ASIP was the gene with the strongest signal. ASIP and melanocortin 1 receptor (MC1R) control the ratio of eumelanin to pheomelanin through their protein activity. They are deeply involved in the process of melanosome organation and melanogenesis, thus affecting mammals' coat color variation. We used a range of genome-wide approach to identify the genetic basis of coat color variation in Dezhou donkeys. The results provide a supplement to the color variation study in Chinese donkeys at the genome-wide level, and preliminarily verified the reliability of the Molbreeding Donkey No. 1 40K liquid chip.

Global genetic diversity, introgression, and evolutionary adaptation of indicine cattle revealed by whole genome sequencing.

Indicine cattle, also referred to as zebu (Bos taurus indicus), play a central role in pastoral communities across a wide range of agro-ecosystems, from extremely hot semiarid regions to hot humid tropical regions. However, their adaptive genetic changes following their dispersal into East Asia from the Indian subcontinent have remained poorly documented. Here, we characterize their global genetic diversity using high-quality whole-genome sequencing data from 354 indicine cattle of 57 breeds/populations, including major indicine phylogeographic groups worldwide. We reveal their probable migration into East Asia was along a coastal route rather than inland routes and we detected introgression from other bovine species. Genomic regions carrying morphology-, immune-, and heat-tolerance-related genes underwent divergent selection according to Asian agro-ecologies. We identify distinct sets of loci that contain promising candidate variants for adaptation to hot semi-arid and hot humid tropical ecosystems. Our results indicate that the rapid and successful adaptation of East Asian indicine cattle to hot humid environments was promoted by localized introgression from banteng and/or gaur. Our findings provide insights into the history and environmental adaptation of indicine cattle.

Comparative Genomics Identifies the Evolutionarily Conserved Gene TPM3 as a Target of eca-miR-1 Involved in the Skeletal Muscle Development of Donkeys.

Species within the genus Equus are valued for their draft ability. Skeletal muscle forms the foundation of the draft ability of Equus species; however, skeletal muscle development-related conserved genes and their target miRNAs are rarely reported for Equus. In this study, a comparative genomics analysis was performed among five species (horse, donkey, zebra, cattle, and goat), and the results showed that a total of 15,262 (47.43%) genes formed the core gene set of the five species. Only nine chromosomes (Chr01, Chr02, Chr03, Chr06, Chr10, Chr18, Chr22, Chr27, Chr29, and Chr30) exhibited a good collinearity relationship among Equus species. The micro-synteny analysis results showed that TPM3 was evolutionarily conserved in chromosome 1 in Equus. Furthermore, donkeys were used as the model species for Equus to investigate the genetic role of TPM3 in muscle development. Interestingly, the results of comparative transcriptomics showed that the TPM3 gene was differentially expressed in donkey skeletal muscle S1 (2 months old) and S2 (24 months old), as verified via RT-PCR. Dual-luciferase test analysis showed that the TPM3 gene was targeted by differentially expressed miRNA (eca-miR-1). Furthermore, a total of 17 TPM3 gene family members were identified in the whole genome of donkey, and a heatmap analysis showed that EaTPM3-5 was a key member of the TPM3 gene family, which is involved in skeletal muscle development. In conclusion, the TPM3 gene was conserved in Equus, and EaTPM3-5 was targeted by eca-miR-1, which is involved in skeletal muscle development in donkeys.

mRNA sequencing provides new insights into the pathogenesis of Hirschsprung's disease in mice.

PURPOSE: The aim of this study is to use RNA sequencing and RT-qPCR to identify the main susceptibility genes linked to the occurrence and development of Hirschsprung disease in the colonic tissues of EDNRBm1yzcm and wild mice. METHODS: RNA was extracted from colon tissues of 3 mutant homozygous mice and 3 wild mice. RNA degradation, contamination concentration, and integrity were then measured. The extracted RNA was then sequenced using the Illumina platform. The obtained sequence data are filtered to ensure data quality and compared to the reference genome for further analysis. DESeq2 was used for gene expression analysis of the raw data. In addition, graphene oxide enrichment analysis and RT-qPCR validation were also performed. RESULTS: This study identified 8354 differentially expressed genes in EDNRBm1yzcm and wild mouse colon tissues by RNA sequencing, including 4346 upregulated genes and 4005 downregulated genes. Correspondingly, the results of RT-qPCR analysis showed good correlation with the transcriptome data. In addition, GO and KEGG enrichment results suggested that there were 8103 terms and 320 pathways in all DEGs. When P < 0.05, 1081 GO terms and 320 KEGG pathways reached a significant level. Finally, through the existing studies and the enrichment results of differentially expressed genes, it was determined that axon guidance and the focal adhesion pathway may be closely related to the occurrence of HSCR. CONCLUSIONS: This study analyzed and identified the differential genes in colonic tissues between EDNRBm1yzcm mice and wild mice, which provided new insight for further mining the potential pathogenic genes of Hirschsprung's disease.

Bta-miR-127 inhibits secretion, proliferation and promotes apoptosis by targeting ITGA6 in bovine Sertoli cell.

Sertoli cell (SC) play a critical role in the spermatogenesis process involved in male fecundity and reproductive potential. SC development is regulated by microRNAs (miRNAs). However, the effect and molecular mechanism of miRNAs and target genes on bovine immature SC remains poorly understood. In this study, bta-miR-127 overexpression in SC inhibited cell secretion, proliferation, cell viability, and S-phase cells number. However, inhibition of bta-miR-127 had the opposite effect. An over-expression of bta-miR-127 significantly promotes SC apoptosis, and bta-miR-127 inhibition can significantly inhibit this process. These results reveal that bta-miR-127 is an inhibitor of SC proliferation and secretion. A combination of transcriptome sequencing, bioinformatics analysis, and dual-luciferase reporter assay showed that ITGA6 was targeted by bta-miR-127. The small interfering RNA of ITGA6 (si-ITGA6) inhibits SC proliferation and secretion, as well as promotes apoptosis. The SC proliferation and secretion marker genes, cell viability, and S phase cell number in co-transfected si-ITGA6 + miR-127 inhibitor was significantly lower than those of the bta-miR-127 inhibitor group. These results further confirmed that bta-miR-127 targeting ITGA6 inhibits the SC proliferation and secretion, and promotes SC apoptosis. These findings proposed a novel miRNA (bta-miR-127) that impeded bovine SC proliferation and promoted SC apoptosis through downregulation of ITGA6.

Structural variation and introgression from wild populations in East Asian cattle genomes confer adaptation to local environment.

BACKGROUND: Structural variations (SVs) in individual genomes are major determinants of complex traits, including adaptability to environmental variables. The Mongolian and Hainan cattle breeds in East Asia are of taurine and indicine origins that have evolved to adapt to cold and hot environments, respectively. However, few studies have investigated SVs in East Asian cattle genomes and their roles in environmental adaptation, and little is known about adaptively introgressed SVs in East Asian cattle. RESULTS: In this study, we examine the roles of SVs in the climate adaptation of these two cattle lineages by generating highly contiguous chromosome-scale genome assemblies. Comparison of the two assemblies along with 18 Mongolian and Hainan cattle genomes obtained by long-read sequencing data provides a catalog of 123,898 nonredundant SVs. Several SVs detected from long reads are in exons of genes associated with epidermal differentiation, skin barrier, and bovine tuberculosis resistance. Functional investigations show that a 108-bp exonic insertion in SPN may affect the uptake of Mycobacterium tuberculosis by macrophages, which might contribute to the low susceptibility of Hainan cattle to bovine tuberculosis. Genotyping of 373 whole genomes from 39 breeds identifies 2610 SVs that are differentiated along a "north-south" gradient in China and overlap with 862 related genes that are enriched in pathways related to environmental adaptation. We identify 1457 Chinese indicine-stratified SVs that possibly originate from banteng and are frequent in Chinese indicine cattle. CONCLUSIONS: Our findings highlight the unique contribution of SVs in East Asian cattle to environmental adaptation and disease resistance.

Transcriptional and open chromatin analysis of bovine skeletal muscle development by single-cell sequencing.

Skeletal muscle is a complex heterogeneous tissue and characterizing its cellular heterogeneity and transcriptional and epigenetic signatures are important for understanding the details of its ontogeny. In our study, we applied scRNA-seq and scATAC-seq to investigate the cell types, molecular features, transcriptional and epigenetic regulation, and patterns of developing bovine skeletal muscle from gestational, lactational and adult stages. Detailed molecular analyses were used to dissect cellular heterogeneity, and we deduced the differentiation trajectory of myogenic cells and uncovered their dynamic gene expression profiles. SCENIC analysis was performed to demonstrate key regulons during cell fate decisions. We explored the future expression states of these heterogeneous cells by RNA velocity analysis and found extensive networks of intercellular communication using the toolkit CellChat. Moreover, the transcriptomic and chromatin accessibility modalities were confirmed to be highly concordant, and integrative analysis of chromatin accessibility and gene expression revealed key transcriptional regulators acting during myogenesis. In bovine skeletal muscle, by scRNA-seq and scATAC-seq analysis, different cell types such as adipocytes, endothelial cells, fibroblasts, lymphocytes, monocytes, pericyte cells and eight skeletal myogenic subpopulations were identified at the three developmental stages. The pseudotime trajectory exhibited a distinct sequential ordering for these myogenic subpopulations and eight distinct gene clusters were observed according to their expression pattern. Moreover, specifically expressed TFs (such as MSC, MYF5, MYOD1, FOXP3, ESRRA, BACH1, SIX2 and ATF4) associated with muscle development were predicted, and likely future transcriptional states of individual cells and the developmental dynamics of differentiation among neighbouring cells were predicted. CellChat analysis on the scRNA-seq data set then classified many ligand-receptor pairs among these cell clusters, which were further categorized into significant signalling pathways, including BMP, IGF, WNT, MSTN, ANGPTL, TGFB, TNF, VEGF and FGF. Finally, scRNA-seq and scATAC-seq results were successfully integrated to reveal a series of specifically expressed TFs that are likely to be candidates for the promotion of cell fate transition during bovine skeletal muscle development. Overall, our results outline a single-cell dynamic chromatin/transcriptional landscape for normal bovine skeletal muscle development; these provide an important resource for understanding the structure and function of mammalian skeletal muscle, which will promote research into its biology.

Analysis of lncRNA and mRNA expression profiling in immature and mature DeZhou donkey (equine Taurus) testes.

Testicular development and spermatogenesis are tightly regulated by the number of genes and noncoding genes, and mRNAs and lncRNAs play vital roles in regulating posttranscriptional gene expression. However, mRNAs and lncRNAs have not been systematically identified in the testes of donkeys. In this study, mRNA and lncRNA expression profiles in the testes of DeZhou donkeys between 2 months and 2 years of age were comprehensively analysed by RNA sequencing. We identified 56,605 lncRNAs and 61,857 mRNAs by gene expression analysis, and 21,845 lncRNAs (p < .05) and 14,109 mRNAs (p < .05) were differentially expressed in the immature (2-month-old, n = 3, noADGW) and mature (2-year-old, n = 3, ADGW) stages. In addition, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that the predicted target genes were enriched in the adherens junction, cell cycle, propanoate metabolism and cell adhesion molecule pathways. This study identified and analysed a comprehensive catalogue of lncRNAs and mRNAs in donkey testes, which provides a useful resource for further investigation of biological function in donkey lncRNAs.

Association analysis of IGF2 gene polymorphisms with growth traits of Dezhou donkey.

IGF2 is an insulin-like growth factor that plays an important role in the development of animal embryos. In order to determine whether IGF2 gene is associated with important economic characteristics of donkeys, we investigated the association between single nucleotide polymorphisms (SNPs) of IGF2 gene and body size traits of Chinese Dezhou donkeys and analyzed the expression level of IGF2 gene in different tissues of juvenile and adult Dezhou donkeys. In this study, two SNPs (g.281766 G > A and g.291322 C > T) were detected in IGF2 gene, both of which were in Hardy-Weinberg equilibrium (P > 0.05) and were moderately polymorphic (0.25 < PIC < 0.50). Association analysis showed that the two SNP loci were significantly correlated with body length and rump height (p < 0.05) of female Dezhou donkeys. Quantitative results showed that the expression of IGF2 gene was higher in heart, liver, spleen, lung, kidney, stomach and muscle tissues of juvenile donkeys than that of adult donkeys. Together, IGF2 can be considered as a candidate gene for growth and development of female Dezhou donkey, and its polymorphism can be used as a molecular marker for the Dezhou donkey breeding.

A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.

Identification of Dezhou donkey muscle development-related genes and long non-coding RNA based on differential expression analysis.

Long non-coding RNAs (lncRNAs) play a critical role in the development of muscles. However, the role of lncRNAs in regulating skeletal muscle development has not been studied systematically in the donkey. In this study, we performed the RNA sequencing for different stages of muscles in donkeys, and investigate their expression profile, which showed that 3215 mRNAs (p-adjust <0.05) and 471 lncRNAs (p-value <0.05) were significantly differently expressed (DE) verified by RT-qPCR. GO and KEGG enrichment analysis indicated that DE genes and target genes of DE lncRNAs were associated with muscle development in the donkey. We also found these four target genes (DCN, ITM2A, MUSTN1, ARRDC2) involved in skeletal muscle growth and development. Combined with transcriptome data, network, and RT-qPCR results showed that four co-expression networks of DCN and lnc-008278, ITM2A and lnc_017247, MUSTN1 and lnc_030153, and ARRDC2 and lnc_033914, which may play an important role in the formation and development of muscle in the donkey.

TMT-based comparative proteomic analysis of Dezhou donkey spermatozoa related to freezability.

The freezability difference between donkey ejaculates is a limiting factor of sperm cryopreservation. Our recent study shows that the freezability of donkey semen is related to the seminal plasma proteome. In this study, we aimed to identify the different abundance sperm proteins in good freezability ejaculates (GFEs) and poor freezability ejaculates (PFEs) using a Tandem Mass Tag (TMT) peptide labeling coupled with LC-MS/MS approach. A total of 2682 proteins were identified, among which 58 were significantly up-regulated in GFEs and 16 were down-regulated compared with PFEs. Bioinformatic analysis results revealed that the majority of different abundance proteins (DAPs) participated in copper and calcium binding, regulation of RNA biosynthetic process, positive regulation of innate immune response, and negative regulation of programmed cell death. KEGG pathway enrichment analysis showed the up-regulated proteins in GF group were mainly involved in N-Glycan biosynthesis and protein processing in endoplasmic reticulum. Our study was the first to analyze the proteome of sperm from donkey ejaculates with different freezabilities. The identified candidate proteins might be used to explore the molecular mechanism related to donkey sperm cryotolerance and might improve the screening of jacks with good sperm freezability. SIGNIFICANCE: Cryopreserved semen has been widely used in assisted reproductive technology. However, semen cryopreservation is a damaging process, which can cause oxidative stress, reduce sperm motility and motility. There are differences in sperm freezability reported to exist between or within breeds, and even between fractions coming from the same ejaculate. The freezability difference between donkey ejaculates is a limiting factor of sperm cryopreservation. The mechanisms that affect the freezing difference in sperm quality remain to be investigated, and freezability differences was found to be related to protein composition of spermatozoa. Some protein markers that can indicate good freezability or poor freezability semen have been identified in mammals. Until now, there is no information about the relationship between donkey spermatozoa proteome and freezability. Additional novel biomarkers of semen freezability in donkey spermatozoa are also needed. The identified candidate proteins might be used to explore the molecular mechanism related to donkey sperm cryotolerance and might improve the screening of jacks with good sperm freezability.

Genome-wide analysis reveals selection signatures for body size and drought adaptation in Liangzhou donkey.

Liangzhou donkey is a domestic animal breed distributed on the edge of the Tengger Desert in Gansu Province of China. It has small body size and strong adaptability to dry environments. Here, we sequenced 10 Liangzhou donkey genomes and compared them to the 55 genomes of 8 representative donkey breeds worldwide. The population structure analysis revealed that Liangzhou donkey harboured the ancestry with the Asian domestic donkeys (0.863) and European domestic donkeys (0.137). Three methods (nucleotide diversity, linkage disequilibrium decay and runs of homozygosity) implied the genetic diversity in Liangzhou donkey. In addition, we analyzed the genetic basis of the small body size and drought adaptation of Liangzhou donkey by using Fst, θπ-ratio, XP-EHH, CLR and θπ methods. We found that the NCAPG-LCORL on chromosome 3 may be a candidate region for small body size trait of Liangzhou donkey. The CYP4A11 gene located on chromosome 5 showed strong sign of selection sweep. CYP4A11 can convert arachidonic acid into 19(S)-HETE, which can promote water reabsorption in renal tubule and enhance the ability of Liangzhou donkey to adapt to dry environment. These results contribute to a better understanding of the underlying population structure of Liangzhou donkeys and provides a valuable resource for future research on donkey breeding in response to climate change.

Changes in sperm metabolites of Dezhou donkey after cryopreservation.

Sperm cryopreservation technology has laid the foundation for promoting the popularity of artificial insemination in donkey reproduction, but the freeze-thaw process can cause sperm damage, and the viability of frozen sperm is greatly reduced, resulting in low insemination ability. Sperm metabolites play an important role in the freezing process of spermatozoa and have a major influence on the freezability of spermatozoa. The aim of this study was to explore the differential metabolites in donkey spermatozoa before and after cryopreservation by liquid chromatography-tandem mass spectrometry (LC-MS/MS). We analysed ejaculate samples from male donkeys obtained before and after freezing and identified 1323 metabolites. Compared with fresh sperm (F), the metabolites of cryopreserved sperm (CRY) were significantly changed, and 570 metabolites were significantly different between the two groups (p < .05). Among them, 277 metabolites were higher in frozen sperm, while the opposite was true for 293 metabolites. These metabolites mainly include phospholipids, lysophospholipids and amino acids., most of which are associated with oxidative stress and sperm capacitation. We describe significantly different metabolites before and after freezing that are significantly associated with decreased sperm motility post-freezing and can be used as biomarkers of decreased sperm motility post-freezing.

Metabolomic profiling of Dezhou donkey seminal plasma related to freezability.

Donkeys are indispensable livestock in China because they have transport function and medicinal value. With the popularization of artificial insemination on donkeys, semen cryopreservation technology has gradually become a research hotspot. Seminal plasma is a necessary medium for transporting sperm and provides energy and nutrition for sperm. Seminal plasma metabolites play an important role in the process of sperm freezing, and also have an important impact on sperm motility and fertilization rate after freezing and thawing. In this study, liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was used to compare the metabolic characteristics of seminal plasma of high freezability (HF) and low freezability (LF) male donkeys. We identified 672 metabolites from donkey seminal plasma, of which 33 metabolites were significantly different between the two groups. Metabolites were identified and categorized according to their major chemical classes, including homogeneous non-metal compounds, nucleosides, nucleotides, and analogues, organosulphur compounds, phenylpropanoids and polyketide, organoheterocyclic compounds, organic oxygen compounds, benzenoids, organic acids and derivatives, lipids and lipid-like molecules, organooxygen compounds, alkaloids and derivatives, organic nitrogen compounds. The results showed that the contents of phosphatidylcholine, piceatannol and enkephalin in donkey semen of HF group were significantly higher than those of LF group (p < .05), while the contents of taurocholic and lysophosphatidic acid were significantly lower than those of LF group (p < .05). The different metabolites were mainly related to sperm biological pathway response and oxidative stress. These metabolites may be considered as candidate biomarkers for different fertility in jacks.

MiR-24-3p Conservatively Regulates Muscle Cell Proliferation and Apoptosis by Targeting Common Gene CAMK2B in Rat and Cattle.

Skeletal muscle plays an important role in the growth and development of meat animals. MicroRNAs (miRNAs) can participate in the regulation of muscle development-related functions; however, there have been few reports on whether there are related miRNAs that conservatively regulate muscle development among different species. In this study, the miRNA transcriptome sequencing data of the muscle tissue of cattle, rat, goat, and pig showed that miR-24-3p may conservatively regulate muscle development in these species. Furthermore, mmu-miR-24-3p can positively regulate C2C12 cell proliferation and apoptosis by regulating key proliferation and apoptosis genes in muscle development, which was verified by CCK-8 and RT-qPCR. Bta-miR-24-3p can also positively regulate the proliferation and apoptosis of bovine muscle primary cells by regulating key proliferation and apoptosis genes in the process of muscle development, as verified by CCK-8 and RT-qPCR. The target genes of miR-24-3p in cattle, rat, goat, and pig, which include a large proportion of target genes shared among the four species, are enriched in multiple cell functions and signal pathways that are closely related to muscle development, as revealed by GO and KEGG enrichment analysis. A double luciferase test showed that the shared target genes WNT4, CAMK2B, and TCF7 were targeted by mmu-miR-24-3p in rat and bta-miR-24-3p in cattle. These three shared target genes WNT4, CAMK2B, and TCF7 are involved in the Wnt signaling pathway, which showed that miR-24-3p plays an important role in rat and cattle. The shared target gene (CAMK2B) in rat and cattle increased significantly after the inhibition of miR-24-3p by RT-qPCR. The findings of this study contribute to a better understanding of the role of miR-24-3p in the regulation of muscle development.

Metabolomic profiling of Dezhou donkey sperm associated with freezability.

The cryopreservation technology of sperm has promoted the popularization of artificial insemination in the reproductive process of donkeys to a certain extent, but the freezing-thawing process would bring damage to the sperm, and the vitality of the sperm would be greatly reduced after freezing. Sperm metabolites play an important role in the process of sperm freezing, and also have an important impact on the vitality and fertilization rate of sperm after freezing-thawing. In this study, the LC-MS/MS analysis method was used to compare the metabolic profiles of high freezability (HF) and low freezability (LF) male donkey sperm after freezing-thawing. We identified 1323 metabolites in total, of which 17 metabolites are significantly different between the two groups. Most of these metabolites belong to fatty acids and phospholipids, including phosphatidylcholine, stearic acid and so on. These different metabolites are mostly related to the plasma membrane fatty acids of sperm and oxidative stress. Our results illustrate several metabolites related to sperm freezability and provide corresponding biomarkers.

Corrigendum: Novel lncRNA lncFAM200B: Molecular Characteristics and Effects of Genetic Variants on Promoter Activity and Cattle Body Measurement Traits.

[This corrects the article DOI: 10.3389/fgene.2019.00968.].

Genomic analyses reveal distinct genetic architectures and selective pressures in Chinese donkeys.

Donkey (Equus asinus) is an important livestock animal in China because of its draft and medicinal value. After a long period of natural and artificial selection, the variety and phenotype of donkeys have become abundant. We clarified the genetic and demographic characteristics of Chinese domestic donkeys and the selection pressures by analyzing 78 whole genomes from 12 breeds. According to population structure, most Chinese domestic donkeys showed a dominant ancestral type. However, the Chinese donkeys still represented a significant geographical distribution trend. In the selective sweep, gene annotation, functional enrichment, and differential expression analyses between large and small donkey groups, we identified selective signals, including NCAPG and LCORL, which are related to rapid growth and large body size. Our findings elucidate the evolutionary history and formation of different donkey breeds and provide theoretical insights into the genetic mechanism underlying breed characteristics and molecular breeding programs of donkey clades.