Dynamic mechanisms for membrane skeleton transitions.

The plasma membrane and the underlying skeleton form a protective barrier for eukaryotic cells. The molecules forming this complex composite material constantly rearrange under mechanical stress to confer this protective capacity. One of those molecules, spectrin, is ubiquitous in the membrane skeleton and primarily located proximal to the inner leaflet of the plasma membrane and engages in protein-lipid interactions via a set of membrane-anchoring domains. Spectrin is linked by short actin filaments and its conformation varies in different types of cells. In this work, we developed a generalized network model for the membrane skeleton integrated with myosin contractility and membrane mechanics to investigate the response of the spectrin meshwork to mechanical loading. We observed that the force generated by membrane bending is important to maintain a smooth skeletal structure. This suggests that the membrane is not just supported by the skeleton, but has an active contribution to the stability of the cell structure. We found that spectrin and myosin turnover are necessary for the transition between stress and rest states in the skeleton. Our model reveals that the actin-spectrin meshwork dynamics are balanced by the membrane forces with area constraint and volume restriction promoting the stability of the membrane skeleton. Furthermore, we showed that cell attachment to the substrate promotes shape stabilization. Thus, our proposed model gives insight into the shared mechanisms of the membrane skeleton associated with myosin and membrane that can be tested in different types of cells.

Pediatric Cardiology Fellowship Standards for Training in Exercise Medicine and Curriculum Outline.

Over the past 2 decades, fundamentals of exercise medicine, including clinical exercise testing, assessment and promotion of physical activity, exercise prescription, and supervised exercise training/rehabilitation programming have demonstrated considerable clinical value in the management of children and adolescents with congenital and acquired heart disease. Although the principles of exercise medicine have become an integral component in pediatric cardiology, there are no standardized training recommendations for exercise physiology during pediatric cardiology fellowship at this time. Thus, the Pediatric Cardiology Exercise Medicine Curriculum Committee (PCEMCC) was formed to establish core and advanced exercise physiology training recommendations for pediatric cardiology trainees. The PCEMCC includes a diverse group of pediatric cardiologists, exercise physiologists, and fellowship program directors. The expert consensus training recommendations are by no means a mandate and are summarized herein, including suggestions for achieving the minimum knowledge and training needed for general pediatric cardiology practice.

New directions in the analysis of buried interfaces for device technology by hard X-ray photoemission.

Photoelectron spectroscopy is a characterization technique which plays a key role in device technology, a field requiring, very often, a reliable and reproducible analysis of buried, critical interfaces. The recent advent of laboratory hard X-ray spectrometers opens new perspectives toward routine studies of technologically-relevant samples for the qualification of processes and materials. In this review, the status of hard X-ray photoelectron spectroscopy (HAXPES) implemented with chromium Kα excitation (5.414 keV) and applied to technological research in nanoelectronics is presented. After an account of the role of synchrotron HAXPES and the specific effects to care about at the practical level, different aspects are developed, first for illustrating the benefits of the technique through specific application cases in the field of resistive memories and power transistors. Then, we provide a status update on quantification in HAXPES, both from core-level intensities and inelastic background analysis. Finally, we present preliminary results in a novel analytical field, operando HAXPES, where a prototypical device is operated in situ during the laboratory HAXPES experiment, opening up the possibility of unravelling the mechanisms occurring at buried interfaces and governing device operation.

Design and optimization of an experimental maintenance system for yellow clam broodstock Amarilladesma mactroides (Reeve, 1854) / Desenvolvimento e otimização de um sistema de manutenção experimental para reprodutores de marisco branco Amarilladesma mactroides (Reeve, 1854)

The yellow clam is a sand-burrowing bivalve that inhabits the dissipative beaches from southern Brazil to the north coast of Argentina. In the last decades, populations of this species have been impacted by mass mortality events, overfishing and other anthropogenic activities. The production of juveniles in captivity would allow feasibility studies to be carried out to restore the natural stock as well as the production in aquaculture systems. Given the scarcity of studies on the maintenance of this species in captivity, a culture system and a management protocol were developed and tested. Wild-caught clams (total length ≥50 mm) were used in a series of 14 day-long trials. Survival was higher in clams that were allowed to bury into the sand. A permanent ink marker covered with a thin layer of a quick-hardening adhesive proved to be a reliable method to tag clams. The maintenance of yellow clams in this system resulted in high survival and growth, increases in the condition factor and oocyte diameter, and a relative advancement of gonadal development.

O marisco branco é um bivalve de areia que habita as praias dissipativas do sul do Brasil até a costa norte da Argentina. Nas últimas décadas, as populações desta espécie têm sido afetadas por eventos de mortalidade maciça, sobrepesca e outras atividades antropogênicas. A produção de juvenis em cativeiro permitiria a realização de estudos de viabilidade para restaurar o estoque natural, assim como a produção em sistemas de aquicultura. Dada a escassez de estudos sobre a manutenção desta espécie em cativeiro, um sistema de cultivo e um protocolo de manejo foram desenvolvidos e testados. Mariscos branco selvagens (comprimento total ≥50 mm) foram utilizados em uma série de ensaios de 14 dias de duração. A sobrevivência foi maior nos mariscos que podiam ser enterrados na areia. Um marcador de tinta permanente coberto com uma fina camada de adesivo de endurecimento rápido provou ser um método confiável para marcar os mariscos. A manutenção dos mariscos neste sistema resultou em alta sobrevivência e crescimento, aumento do fator de condição e do diâmetro do ovócito, e um relativo avanço do desenvolvimento gonadal.

Design and optimization of an experimental maintenance system for yellow clam broodstock Amarilladesma mactroides (Reeve, 1854) / Desenvolvimento e otimização de um sistema de manutenção experimental para reprodutores de marisco branco Amarilladesma mactroides (Reeve, 1854)

The yellow clam is a sand-burrowing bivalve that inhabits the dissipative beaches from southern Brazil to the north coast of Argentina. In the last decades, populations of this species have been impacted by mass mortality events, overfishing and other anthropogenic activities. The production of juveniles in captivity would allow feasibility studies to be carried out to restore the natural stock as well as the production in aquaculture systems. Given the scarcity of studies on the maintenance of this species in captivity, a culture system and a management protocol were developed and tested. Wild-caught clams (total length ≥50 mm) were used in a series of 14 day-long trials. Survival was higher in clams that were allowed to bury into the sand. A permanent ink marker covered with a thin layer of a quick-hardening adhesive proved to be a reliable method to tag clams. The maintenance of yellow clams in this system resulted in high survival and growth, increases in the condition factor and oocyte diameter, and a relative advancement of gonadal development.

O marisco branco é um bivalve de areia que habita as praias dissipativas do sul do Brasil até a costa norte da Argentina. Nas últimas décadas, as populações desta espécie têm sido afetadas por eventos de mortalidade maciça, sobrepesca e outras atividades antropogênicas. A produção de juvenis em cativeiro permitiria a realização de estudos de viabilidade para restaurar o estoque natural, assim como a produção em sistemas de aquicultura. Dada a escassez de estudos sobre a manutenção desta espécie em cativeiro, um sistema de cultivo e um protocolo de manejo foram desenvolvidos e testados. Mariscos branco selvagens (comprimento total ≥50 mm) foram utilizados em uma série de ensaios de 14 dias de duração. A sobrevivência foi maior nos mariscos que podiam ser enterrados na areia. Um marcador de tinta permanente coberto com uma fina camada de adesivo de endurecimento rápido provou ser um método confiável para marcar os mariscos. A manutenção dos mariscos neste sistema resultou em alta sobrevivência e crescimento, aumento do fator de condição e do diâmetro do ovócito, e um relativo avanço do desenvolvimento gonadal.

Design and optimization of an experimental maintenance system for yellow clam broodstock Amarilladesma mactroides (Reeve, 1854)

Abstract The yellow clam is a sand-burrowing bivalve that inhabits the dissipative beaches from southern Brazil to the north coast of Argentina. In the last decades, populations of this species have been impacted by mass mortality events, overfishing and other anthropogenic activities. The production of juveniles in captivity would allow feasibility studies to be carried out to restore the natural stock as well as the production in aquaculture systems. Given the scarcity of studies on the maintenance of this species in captivity, a culture system and a management protocol were developed and tested. Wild-caught clams (total length 50 mm) were used in a series of 14 day-long trials. Survival was higher in clams that were allowed to bury into the sand. A permanent ink marker covered with a thin layer of a quick-hardening adhesive proved to be a reliable method to tag clams. The maintenance of yellow clams in this system resulted in high survival and growth, increases in the condition factor and oocyte diameter, and a relative advancement of gonadal development.

Resumo O marisco branco é um bivalve de areia que habita as praias dissipativas do sul do Brasil até a costa norte da Argentina. Nas últimas décadas, as populações desta espécie têm sido afetadas por eventos de mortalidade maciça, sobrepesca e outras atividades antropogênicas. A produção de juvenis em cativeiro permitiria a realização de estudos de viabilidade para restaurar o estoque natural, assim como a produção em sistemas de aquicultura. Dada a escassez de estudos sobre a manutenção desta espécie em cativeiro, um sistema de cultivo e um protocolo de manejo foram desenvolvidos e testados. Mariscos branco selvagens (comprimento total 50 mm) foram utilizados em uma série de ensaios de 14 dias de duração. A sobrevivência foi maior nos mariscos que podiam ser enterrados na areia. Um marcador de tinta permanente coberto com uma fina camada de adesivo de endurecimento rápido provou ser um método confiável para marcar os mariscos. A manutenção dos mariscos neste sistema resultou em alta sobrevivência e crescimento, aumento do fator de condição e do diâmetro do ovócito, e um relativo avanço do desenvolvimento gonadal.

Design and optimization of an experimental maintenance system for yellow clam broodstock Amarilladesma mactroides (Reeve, 1854).

The yellow clam is a sand-burrowing bivalve that inhabits the dissipative beaches from southern Brazil to the north coast of Argentina. In the last decades, populations of this species have been impacted by mass mortality events, overfishing and other anthropogenic activities. The production of juveniles in captivity would allow feasibility studies to be carried out to restore the natural stock as well as the production in aquaculture systems. Given the scarcity of studies on the maintenance of this species in captivity, a culture system and a management protocol were developed and tested. Wild-caught clams (total length ≥50 mm) were used in a series of 14 day-long trials. Survival was higher in clams that were allowed to bury into the sand. A permanent ink marker covered with a thin layer of a quick-hardening adhesive proved to be a reliable method to tag clams. The maintenance of yellow clams in this system resulted in high survival and growth, increases in the condition factor and oocyte diameter, and a relative advancement of gonadal development.

Multicenter Evaluation of the Clinical Performance and the Neutralizing Antibody Activity Prediction Properties of 10 High-Throughput Serological Assays Used in Clinical Laboratories.

As the coronavirus disease 2019 (COVID-19) pandemic second wave is emerging, it is of the upmost importance to screen the population immunity in order to keep track of infected individuals. Consequently, immunoassays for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) with high specificity and positive predictive values are needed to obtain an accurate epidemiological picture. As more data accumulate about the immune responses and the kinetics of neutralizing-antibody (nAb) production in SARS-CoV-2-infected individuals, new applications are forecast for serological assays such as nAb activity prediction in convalescent-phase plasma from recovered patients. This multicenter study, involving six hospital centers, determined the baseline clinical performances, reproducibility, and nAb level correlations of 10 commercially available immunoassays. In addition, three lateral-flow chromatography assays were evaluated, as these devices can be used in logistically challenged areas. All assays were evaluated using the same patient panels in duplicate, thus enabling accurate comparison of the tests. Seven immunoassays examined in this study were shown to have excellent specificity (98 to 100%) and good to excellent positive predictive values (82 to 100%) when used in a low (5%)-seroprevalence setting. We observed sensitivities as low as 74% and as high as 95% at ≥15 days after symptom onset. The determination of optimized cutoff values through receiver operating characteristic (ROC) curve analyses had a significant impact on the diagnostic resolution of several enzyme immunoassays by increasing the sensitivity significantly without a large trade-off in specificity. We found that spike-based immunoassays seem to be better correlates of nAb activity. Finally, the results reported here will add to the general knowledge of the interlaboratory reproducibility of clinical performance parameters of immunoassays and provide new evidence about nAb activity prediction.

Study Protocol: A Cross-Sectional Examination of Socio-Demographic and Ecological Determinants of Nutrition and Disease Across Madagascar.

Madagascar has experienced significant environmental change since 1960, particularly through forest clearing for agricultural expansion. Climatic patterns are undergoing change in Madagascar as well, with increasing temperatures, droughts, and cyclonic activity. The impact of these environmental and climatic changes will pose threats to food availability, income generation, and local ecosystems, with significant potential effects on the spatial and temporal distribution of disease burden. This study seeks to describe the health status of a large sample of geographically and socially diverse Malagasy communities through multiple clinical measurements, detailed social surveys, and paired data on regional variation in local ecologies. With an increased understanding of the current patterns of variation in human health and nutrition, future studies will be better able to identify associations with climate and anticipate and mitigate the burdens expected from larger, longer-term changes. Our mixed-method approach included an observational cross-sectional study. Research subjects were men, women, and children from 1,125 households evenly distributed across 24 communities in four ecologically and socio-demographically distinct regions of Madagascar. For these 1,125 households, all persons of both sexes and all ages therein (for a total of 6,292 individuals) were recruited into the research study and a total of 5,882 individuals were enrolled. Through repeated social survey recalls and focus group meetings, we obtained social and demographic data, including broad categories of seasonal movements, and characterized the fluctuation of income generation, food production and dietary consumption. Through collection of clinical and biological samples for both point-of-care diagnoses and laboratory analyses, we obtained detailed occurrence (and importantly co-occurrence) data on micronutrient nutritional, infectious disease, and non-communicable disease status. Our research highlights the highly variable social, cultural, and environmental contexts of health conditions in Madagascar, and the tremendous inter-regional, inter-community, and intra-community variation in nutritional and disease status. More than 30% of the surveyed population was afflicted by anemia and 14% of the population had a current malaria infection. This type of rich metadata associated with a suite of biological samples and nutritional and disease outcome data should allow disentangling some of the underlying drivers of ill health across the changing landscapes of Madagascar.

Variation in Anopheles distribution and predictors of malaria infection risk across regions of Madagascar.

BACKGROUND: Deforestation and land use change is widespread in Madagascar, altering local ecosystems and creating opportunities for disease vectors, such as the Anopheles mosquito, to proliferate and more easily reach vulnerable, rural populations. Knowledge of risk factors associated with malaria infections is growing globally, but these associations remain understudied across Madagascar's diverse ecosystems experiencing rapid environmental change. This study aims to uncover socioeconomic, demographic, and ecological risk factors for malaria infection across regions through analysis of a large, cross-sectional dataset. METHODS: The objectives were to assess (1) the ecological correlates of malaria vector breeding through larval surveys, and (2) the socioeconomic, demographic, and ecological risk factors for malaria infection in four ecologically distinct regions of rural Madagascar. Risk factors were determined using multilevel models for the four regions included in the study. RESULTS: The presence of aquatic agriculture (both within and surrounding communities) is the strongest predictive factor of habitats containing Anopheles larvae across all regions. Ecological and socioeconomic risk factors for malaria infection vary dramatically across study regions and range in their complexity. CONCLUSIONS: Risk factors for malaria transmission differ dramatically across regions of Madagascar. These results may help stratifying current malaria control efforts in Madagascar beyond the scope of existing interventions.

Evolution of Magnetic Order from the Localized to the Itinerant Limit.

Quantum materials that feature magnetic long-range order often reveal complex phase diagrams when localized electrons become mobile. In many materials magnetism is rapidly suppressed as electronic charges dissolve into the conduction band. In materials where magnetism persists, it is unclear how the magnetic properties are affected. Here we study the evolution of the magnetic structure in Nd_{1-x}Ce_{x}CoIn_{5} from the localized to the highly itinerant limit. We observe two magnetic ground states inside a heavy-fermion phase that are detached from unconventional superconductivity. The presence of two different magnetic phases provides evidence that increasing charge delocalization affects the magnetic interactions via anisotropic band hybridization.

Patterns and drivers of genetic diversity and structure in the biological control parasitoid Habrobracon hebetor in Niger.

When a promising natural enemy of a key pest exists locally, it is a common practice in biological control (BC) to rear and release it for supplementary control in the targeted agroecosystem even though significant knowledge gaps concerning pre/post release may still exist. Incorporating genetic information into BC research fills some of these gaps. Habrobracon hebetor, a parasitoid of many economically important moths that infest stored and field crops worldwide is commonly used, particularly against the millet head miner (MHM), a key pest of millet in Sahelian countries. To advance our knowledge on how H. hebetor that occurs naturally in open-field cropping systems and grain stores as well as being mass-produced and released for MHM control, performs in millet agroecosystems in Niger we evaluated its population genetics using two mitochondrial and 21 microsatellite markers. The field samples were genetically more diverse and displayed heterozygote excess. Very few field samples had faced significant recent demographic bottlenecks. The mating system (i.e. nonrandom mating with complementary sex determination) of this species may be the major driver of these findings rather than bottlenecks caused by the small number of individuals released and the scarcity of hosts during the longlasting dry season in Niger. H. hebetor population structure was represented by several small patches and genetically distinct individuals. Gene flow occurred at local and regional scales through human-mediated and natural short-distance dispersal. These findings highlight the importance of the mating system in the genetic diversity and structure of H. hebetor populations, and contribute to our understanding of its reported efficacy against MHM in pearl millet fields.

Characterization of Colletotrichum Species Causing Bitter Rot of Apple in Kentucky Orchards.

Multiple species of Colletotrichum can cause bitter rot disease of apple, but the identities and relative representation of the species causing the disease in Kentucky are unknown. In total, 475 Colletotrichum isolates were collected from diseased apple fruit in 25 counties and characterized both morphologically and by using various molecular approaches. Multigene sequence analyses revealed that sample isolates belonged to several newly erected species within the Colletotrichum acutatum and C. gloeosporioides species complexes. The isolates were identified as C. fioriniae and C. nymphaeae, which reside within the C. acutatum species complex, and C. siamense, C. theobromicola, and C. fructicola, which are placed within the C. gloeosporioides species complex. C. fioriniae was the most common species causing bitter rot in Kentucky, comprising more than 70% of the isolates. Infectivity tests on detached fruit showed that C. gloeosporioides species-complex isolates were more aggressive than isolates in the C. acutatum species complex. However, isolates within the C. acutatum species complex produced more spores on lesions compared with isolates within the C. gloeosporioides species complex. Aggressiveness varied among individual species within a species complex. C. siamense was the most aggressive species identified in this study. Within the C. acutatum species complex, C. fioriniae was more aggressive than C. nymphaeae, causing larger, deeper lesions. Apple cultivar did not have a significant effect on lesion development. However, Colletotrichum spp. produced more spores on 'Red Stayman Winesap' than on 'Golden Delicious'. Fungicide sensitivity tests revealed that the C. acutatum species complex was more tolerant to thiophanate-methyl, myclobutanil, trifloxystrobin, and captan compared with the C. gloeosporioides species complex. The study also revealed that mycelial growth of C. siamense was more sensitive to tested fungicides compared with C. fructicola and C. theobromicola. These research findings emphasize the importance of accurate identification of Colletotrichum spp. within each species complex, because they exhibit differences in pathogenicity and fungicide sensitivity.

EPICC study: evaluation of pharmaceutical intervention in cancer care.

WHAT IS KNOWN AND OBJECTIVES: In cancer care, clinical pharmacists contribute to improving prevention and management of drug-related problems (DRPs). The 3-year EPICC study (Evaluation of Pharmaceutical Intervention in Cancer Care) aimed to collect and analyse pharmaceutical interventions (PIs) in oncology. METHODS: The free online version of the French Society of Clinical Pharmacy (SFPC) coding system, ACT-IP, was used, supplemented by a standardized dedicated cancer-care decision tree. RESULTS: A total of 29,589 medication orders (77,004 anticancer drug preparations) were analysed. Eight hundred and ninety-four PIs were recorded. ACT-IP identified 54·1% of DRPs as concerning over- or underdosage. The standardized dedicated cancer-care decision tree identified the three principal causes of dosage problems: 50·2% due to miscalculation, 20% to omission of dose adjustment and 12% to poor choice of antineoplastic regimen. About 13·8% of DRPs were adverse effects and 3·9% were drug-drug interactions. The decision tree showed that 22% of adverse events could be circumvented by a switch within the same drug family and 72% of drug-drug interactions would have led to increased neoplastic toxicity. DISCUSSION: Pharmaceutical analysis of prescription forms contributes to medication safety in cancer care, and the present dedicated decision tree highlights additional information about DRPs and PIs. The DRP rate (3% of prescriptions) was consistent with the literature. The pharmacist has a role to play in optimizing the management of patients with cancer in terms of dose adjustment, drug toxicity management, improvement of administration and drug-drug interactions. WHAT IS NEW AND CONCLUSION: This study, highlighting PIs in cancer care, is the first of this scale in terms of number of prescriptions analysed (nearly 30 000). Results demonstrated the specificity of DRPs and PIs for patients with cancer and the value of a dedicated coding system in cancer care.

First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky.

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5'-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.

SIMMEON-Prep study: SIMulation of Medication Errors in ONcology: prevention of antineoplastic preparation errors.

WHAT IS KNOWN AND OBJECTIVE: Medication errors (ME) in oncology are known to cause serious iatrogenic complications. However, MEs still occur at each step in the anticancer chemotherapy process, particularly when injections are prepared in the hospital pharmacy. This study assessed whether a ME simulation program would help prevent ME-associated iatrogenic complications. METHODS: The 5-month prospective study, consisting of three phases, was undertaken in the centralized pharmaceutical unit of a university hospital of Lyon, France. During the first simulation phase, 25 instruction sheets each containing one simulated error were inserted among various instruction sheets issued to blinded technicians. The second phase consisted of activity aimed at raising pharmacy technicians' awareness of risk of medication errors associated with antineoplastic drugs. The third phase consisted of re-enacting the error simulation process 3 months after the awareness campaign. The rate and severity of undetected medication errors were measured during the two simulation (first and third) phases. The potential seriousness of the ME was assessed using the NCC MERP(®) index. RESULTS AND DISCUSSION: The rate of undetected medication errors decreased from 12 in the first simulation phase (48%) to five in the second simulation phase (20%, P = 0.04). The number of potential deaths due to administration of a faulty preparation decreased from three to zero. Awareness of iatrogenic risk through error simulation allowed pharmacy technicians to improve their ability to identify errors. WHAT IS NEW AND CONCLUSION: This study is the first demonstration of the successful application of a simulation-based learning tool for reducing errors in the preparation of injectable anticancer drugs. Such a program should form part of the continuous quality improvement of risk management strategies for cancer patients.

'Rural' doesn't mean 'uniform': northern vs southern rural family physicians' workload and practice structures in Ontario.

INTRODUCTION: There is a tendency in health policy in Ontario, Canada, to conflate 'northern' with 'rural' and to equate northern rural settings with southern ones. Although previous research has identified some differences between rural and urban practitioners, these studies have not acknowledged the subtle nuances that make rural practice different in the north than in the south. This study looks more closely at practice patterns and compares number of hours worked per week, patient volume and practice type for rural northern, rural southern, urban northern and urban southern physicians. METHODS: This study utilized data from Ontario's medical regulatory authority's 2007 annual membership renewal survey. Descriptive statistics and χ(2) analyses were used to examine practice type (eg solo, clinical group), hours worked per week and number of patient visits per week for 10 968 primary care physicians in Ontario's rural north, rural south, urban north and urban south. RESULTS: Three key results emerged from the analyses: (1) physicians in rural northern Ontario worked more hours per week than their counterparts in other regions of the province, yet (2) they saw fewer patients per week, and (3) worked more frequently in clinical group-based practices. CONCLUSIONS: Rural northern physicians with different practice structures, different patient types, broader scope of services, and different encounter lengths indicate variations specific to locations and populations and communities. The interaction between the rural and northern context is unique and as such a blanket 'rural' or 'northern' approach to policy development is likely to be ineffective.

TRIM3, a tumor suppressor linked to regulation of p21(Waf1/Cip1.).

The TRIM family of genes is largely studied because of their roles in development, differentiation and host cell antiviral defenses; however, roles in cancer biology are emerging. Loss of heterozygosity of the TRIM3 locus in ∼20% of human glioblastomas raised the possibility that this NHL-domain containing member of the TRIM gene family might be a mammalian tumor suppressor. Consistent with this, reducing TRIM3 expression increased the incidence of and accelerated the development of platelet-derived growth factor -induced glioma in mice. Furthermore, TRIM3 can bind to the cdk inhibitor p21(WAF1/CIP1). Thus, we conclude that TRIM3 is a tumor suppressor mapping to chromosome 11p15.5 and that it might block tumor growth by sequestering p21 and preventing it from facilitating the accumulation of cyclin D1-cdk4.

First Report of QoI-Resistant Downy Mildew (Plasmopara viticola) of Grape (Vitis vinifera cv. Vidal Blanc) in Kentucky.

Fungicides in the quinone outside inhibitor class (QoI, also referred to as strobilurins, FRAC group 11) are relied upon for management of a wide range of diseases, including anthracnose, black rot, downy mildew, and powdery mildew on grape. In June 2012, a grape grower from Anderson County in central Kentucky reported a planting of grapevines (Vitis vinifera cv. Vidal Blanc) with 90% downy mildew (Plasmopara viticola) incidence that would not respond to applications of the QoI fungicide Abound 2.08F (22.9% azoxystrobin, Syngenta Crop) or the QoI-containing fungicide Pristine (12.8% pyraclostrobin + 25.2% boscalid, BASF Corporation). Symptoms included yellow irregular lesions or brownish red angular lesions with necrosis on upper sides of leaves. Undersides of leaves contained dense white sporulation. The grower confirmed usage of 4 to 5 applications each of Abound and Pristine fungicides between 2011 and 2012, which exceeded the maximum number of applications allowed per season, as expressed on individual labels. Samples were collected from throughout the 0.4-ha vineyard, and the pathogen was identified as Plasmopara viticola based on morphology of sporangia and sporangiophores (2). Fungicide sensitivity was determined using methods published by Wong and Wilcox (3). Leaves were selected from the 3rd to 6th leaf position from disease-free plants. Nine-millimeter leaf discs were surface disinfested and treated with fungicide concentrations ranging from one-half of the lowest labeled rate to twice the highest label rate (850, 170, 270, and 540 mg/l azoxystrobin and 40, 80, 120, and 240 mg/l pyraclostrobin). Leaf discs were inoculated by placing 10-µl droplets of sporangial suspensions (1 × 104 sporangia per ml) and then incubated at room temperature (22 to 24°C) under fluorescent lights with a 12-h photoperiod (1,3). Dense white fungal growth developed within 10 days; discs treated with water did not develop signs of disease. Fungicide sensitivity was evaluated by determination of the effective concentration (EC50) (3). Leaf discs were examined under a dissecting microscope after 14 days to determine presence of fungal growth; those with visible sporangia and/or sporangiophores were considered diseased. Resulting EC50 concentrations were 420 and 390 mg a.i./l for Abound (azoxystrobin) and Pristine (pyraclostrobin), respectively. This was higher than EC50 ranges of resistant isolates reported by Baudoin et al. (100 and 25 mg/l for azoxystrobin and pyraclostrobin, respectively) (1). Additionally, ranges were higher than EC50 values of isolates not exposed to QoI fungicides reported by Baudoin et al. (1) and higher (14× and 39×, respectively) than those previously determined from P. viticola from Kentucky that were not exposed to QoI fungicides (Ward, unpublished). These EC50 ranges were also much higher than recommended label application rates, which ranged from 170 to 270 mg a.i./l for Abound and from 80 to 120 mg a.i./l for Pristine. Results indicated that P. viticola from this vineyard became insensitive to the fungicides Abound and Pristine. This will lead to future fungicide failures and increased incidences of downy mildew in vineyards. Although QoI-resistant P. viticola has been reported in Europe and elsewhere in the United States, this is the first documented report of QoI-resistant P. viticola in Kentucky. A complete survey is necessary to determine whether this phenomenon is widespread within the state. References: (1) A. Baudoin et al. Plant Health Progress doi:10.1094/PHP-2008-0211-02-RS, 2008. (2) R. C. Pearson and A. C. Goheen, eds. Compendium of Grape Diseases, 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (3) F. P. Wong and W. F. Wilcox. Plant Dis. 84: 275, 2000.

Prognostication of cardiac CT angiography.

The rapidly emerging technique of cardiac computed tomography angiography (CTA) has enabled the anatomical assessment of coronary artery disease. CTA has very good diagnostic accuracy with the ability to detect nonobstructive from obstructive coronary artery disease and provides information on the presence of coronary artery calcification as well as on left ventricular function. Over the last few years, many prognostic studies have reviewed the outcome benefit of different scoring indices in predicting hard cardiac events. The following article will review the most recent literature available on the use of CTA in measuring luminal stenoses, identifying high-risk obstructive CAD, calcium plaque score, and LV function all in different models with their impact on the estimation of clinical risk. More recent data from a large multicenter registry supports the incremental benefit of CAD severity and LVEF as independent predictors of prognosis. Future directions and emerging applications such as the utility of CTA combined with perfusion analysis may lead to a new anatomical-functional diagnostic test that may provide optimal noninvasive assessment of coronary artery anatomy and be superior to invasive coronary angiography.