Transcutaneous Electrical Stimulation for Neurogenic Bladder After Spinal Cord Injury: A Systematic Review and Meta-Analysis.

OBJECTIVES: This review aims to assess the efficacy of transcutaneous electrical nerve stimulation (TENS) for neurogenic bladder after spinal cord injury (SCI). MATERIALS AND METHODS: A systematic search was conducted of seven electronic data bases from inception to Dec 31, 2022, to identify randomized controlled trials that studied TENS for neurogenic bladder after SCI. The primary outcomes were maximum cystometric capacity (MCC) and residual urine volume (RUV). Secondary outcomes included maximum detrusor pressure, flow rate, and bladder diary. Random effects models were used in all analyses. RESULTS: Eleven trials involving 881 participants were included. Meta-analysis showed that TENS in addition to conventional treatment had larger MCC (mean difference [MD] 50.55 ml, 95% CI 27.81-73.29, p＜0.0001) and lower RUV (MD -22.96 ml, 95% CI -33.45 to -12.47, p＜0.0001) than did conventional treatment only. Compared with magnetic stimulation, no differences were observed with TENS for MCC (MD -14.49 ml, 95% CI -48.97 to 19.98, p = 0.41) and RUV (MD 25 ml, 95% CI -61.79 to 111.79, p = 0.57). There also were no differences in MCC (MD -7.2 ml, 95% CI -14.56 to 0.16, p= 0.06) and (MD -5.2 ml, 95% CI -60.00 to 49.60, p = 0.851) when compared with solifenacin succinate and pelvic floor biofeedback, respectively. CONCLUSIONS: TENS may be an effective treatment option for neurogenic bladder after SCI.

Cloning, expression and mutation of a triazophos hydrolase gene from Burkholderia sp. SZL-1.

Triazophos is a broad-spectrum and highly effective insecticide, and the residues of triazophos have been frequently detected in the environment. A triazophos-degrading bacterium, Burkholderia sp. SZL-1, was isolated from a long-term triazophos-polluted soil. Strain SZL-1 could hydrolyze triazophos to 1-phenyl-3-hydroxy-1,2,4-triazole, which was further utilized as the carbon sources for growth. The triazophos hydrolase gene trhA, cloned from strain SZL-1, was expressed and homogenously purified using Ni-nitrilotriacetic acid affinity chromatography. TrhA is 55 kDa and displays maximum activity at 25°C, pH 8.0. This enzyme still has nearly 60% activity at the range of 15°C-50°C for 30 min. TrhA was mutated by sequential error prone PCR and screened for improved activity for triazophos degradation. One purified variant protein (Val89-Gly89) named TrhA-M1 showed up to 3-fold improvement in specific activity against triazophos, and the specificity constants of Kcat and Kcat/Km for TrhA-M1 were improved up to 2.3- and 8.28-fold, respectively, compared to the wild-type enzyme. The results in this paper provided potential material for the contaminated soil remediation and hydrolase genetic structure research.

PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Pedobacter nanyangensis sp. nov., isolated from herbicide-contaminated soil.

A Gram-stain-negative, strictly aerobic, non-spore-forming, motile, rod-shaped bacterium, designated Q-4T, was isolated from a herbicide-contaminated soil sample in Nanyang, Henan province, China. Strain Q-4T grew optimally in the LB medium without NaCl supplement at a pH range of 6.0­7.0 and a temperature of 30 °C. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain Q-4T was most closely related to 'Pedobacter zeaxanthinifaciens' TDMA-5 (97.4 % 16S rRNA gene sequence similarity), followed by Pedobacter xixiisoli S27T (95.8 %). The genomic DNA G+C content of strain Q-4T was 41.8 mol%. MK-7 was the major respiratory quinone. Phosphatidylethanolamine and phosphoaminolipid were the major polar lipids. The major fatty acids were iso-C15 : 0, iso-C17 : 0 3-OH, C16 : 1ω6c and/or C16 : 1ω7c (summed feature 3) and C16 : 1ω7c/C16 : 1ω6c (summed feature 3). Strain Q-4T showed low DNA­DNA relatedness with 'P. zeaxanthinifaciens' TDMA-5 (21.4 ± 0.6 %). Physiological and biochemical characteristics are able to distinguish strain Q-4T from the most closely related species of the genus Pedobacter. On the basis of genotypic and phenotypic data, strain Q-4T is considered to represent a novel species of the genus Pedobacter, for which the name Pedobacter nanyangensis sp. nov. is proposed. The type strain is Q-4T ( = KCTC 42442T = ACCC 19798T).

Ferrovibrio xuzhouensis sp. nov., a cyhalothrin-degrading bacterium isolated from cyhalothrin contaminated wastewater.

A novel cyhalothrin-degrading strain, designated as LM-6(T), was isolated from a cyhalothrin contaminated wastewater sample. The bacterium was found to be Gram stain-negative, non-spore-forming, vibrio-shaped, and motile with a single polar flagellum. Strain LM-6(T) was observed to grow optimally at 28-30 °C, pH 6.0 and in the absence of NaCl. Phylogenetic analysis based on 16S rRNA gene sequence comparisons revealed that strain LM-6(T) is a member of the genus Ferrovibrio, and showed the highest sequence similarity with Ferrovibrio denitrificans Sp-1(T) (97.7 %), followed by Taonella mepensis H1(T) (93.3 %). The major fatty acids of strain LM-6(T) (>5 %) were determined to be C18:1 ω7c and/or C18:1 ω6c, C16:0, C18:1 2-OH and C17:1 iso I and/or anteiso B. The major polar lipids were identified to be phosphatidylglycerol, phosphatidylethanolamine and phosphatidylmethylethanolamine. The major respiratory quinone was determined to be ubiquinone-10. The genomic DNA G+C content of strain LM-6(T) is 66.5 mol %. Strain LM-6(T) showed low DNA-DNA relatedness with F. denitrificans Sp-1(T) (53.1 ± 0.5 %). On the basis of phylogenetic, genomic, phenotypic and chemotaxonomic data, strain LM-6(T) is considered to represent a novel species of the genus Ferrovibrio, for which the name Ferrovibrio xuzhouensis sp. nov. is proposed. The type strain is Ferrovibrio xuzhouensis LM-6(T) (=KCTC 42182(T) = ACCC 19710(T)).

Mangrovibacter yixingensis sp. nov., isolated from farmland soil.

A Gram-staining-negative, facultatively anaerobic, rod-shaped, nitrogen-fixing bacterial strain, designated TULL-AT, was isolated from a farmland soil sample in Yixing, China. The optimal conditions for growth were 30 °C, pH 7.0-8.0 and 0% (w/v) NaCl. Q8 was the dominant respiratory quinone and the major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and aminophospholipid. Phylogenetic analysis of 16S rRNA gene sequences showed that strain TULL-AT was most closely related to Mangrovibacter plantisponsor MSSRF40T (99.6%), followed by Salmonella enterica subsp. diarizonae DSM 14847T (96.8%) and Cronobacter condimenti 1330T (96.8 %). Sequence analysis of the genes rpoB, gyrB and hsp60 revealed that those of strain TULL-AT also exhibit high sequence similarity with those of the species M. plantisponsor MSSRF40T (95.5, 94.1 and 93.4%). The genomic DNA G+C content was 52 mol%. The major fatty acids of strain TULL-AT were C16 : 0, C16 : 1ω7c and/or C16 : 1ω6c, C18 : 1ω7c /C18 : 1ω6c, C14 : 0, C14 : 0 3-OH/iso-C16 : 1 I and iso-C17 : 1 I and/or anteiso-C17 : 1 B. Strain TULL-AT showed low DNA-DNA relatedness with M. plantisponsor MSSRF40T (35.10 ± 1.41%). Based on the multiple genotypic and phenotypic data, strain TULL-AT is considered to represent a novel species of the genus Mangrovibacter, for which the name Mangrovibacter yixingensis sp. nov. is proposed. The type strain is TULL-AT ( = ACCC 19709T = KCTC 42181T).

Flavobacterium suzhouense sp. nov., isolated from farmland river sludge.

A Gram-stain-negative bacterium, designated XIN-1(T), was isolated from a farmland river sludge sample in Suzhou, China. Cells of strain XIN-1(T) were strictly aerobic, non-motile and rod-shaped. Strain XIN-1(T) grew optimally at pH 7.0 and 28 °C. Phylogenetic analysis of the 16S rRNA gene sequences showed that strain XIN-1(T) was most closely related to Flavobacterium hauense BX12(T) (98.2 % sequence similarity), followed by Flavobacterium beibuense F44-8(T) (96.3 %). The major respiratory quinone was menaquinone-6 and the major polar lipid was phosphatidylethanolamine. The major fatty acids (>5 %) were summed feature 3 (comprising C16 : 1ω7c and/or C16 : 1ω6c), summed feature 4 (comprising iso-C17 : 1 I and/or anteiso-C17 : 1 B), iso-C15 : 0, C16 : 0 and iso-C17 : 0 3-OH. The genomic DNA G+C content of strain XIN-1(T) was 39.8 mol%. Strain XIN-1(T) showed low DNA-DNA relatedness with F. hauense BX12(T) (38.7±0.5 %). On the basis of genotypic and phenotypic data, strain XIN-1(T) is considered to represent a novel species of the genus Flavobacterium, for which the name Flavobacterium suzhouense sp. nov. is proposed. The type strain is XIN-1(T) ( = CCTCC AB 2014200(T) = KCTC 42107(T)).