Cyclic AMP is dispensable for allorecognition in Dictyostelium cells overexpressing PKA-C.

Allorecognition and tissue formation are interconnected processes that require signaling between matching pairs of the polymorphic transmembrane proteins TgrB1 and TgrC1 in Dictyostelium. Extracellular and intracellular cAMP signaling are essential to many developmental processes. The three adenylate cyclase genes, acaA, acrA and acgA are required for aggregation, culmination and spore dormancy, respectively, and some of their functions can be suppressed by activation of the cAMP-dependent protein kinase PKA. Previous studies have suggested that cAMP signaling might be dispensable for allorecognition and tissue formation, while others have argued that it is essential throughout development. Here, we show that allorecognition and tissue formation do not require cAMP production as long as PKA is active. We eliminated cAMP production by deleting the three adenylate cyclases and overexpressed PKA-C to enable aggregation. The cells exhibited cell polarization, tissue formation and cooperation with allotype-compatible wild-type cells, but not with incompatible cells. Therefore, TgrB1-TgrC1 signaling controls allorecognition and tissue formation, while cAMP is dispensable as long as PKA-C is overexpressed.

Transcriptional milestones in Dictyostelium development.

Dictyostelium development begins with single-cell starvation and ends with multicellular fruiting bodies. Developmental morphogenesis is accompanied by sweeping transcriptional changes, encompassing nearly half of the 13,000 genes in the genome. We performed time-series RNA-sequencing analyses of the wild type and 20 mutants to explore the relationships between transcription and morphogenesis. These strains show developmental arrest at different stages, accelerated development, or atypical morphologies. Considering eight major morphological transitions, we identified 1371 milestone genes whose expression changes sharply between consecutive transitions. We also identified 1099 genes as members of 21 regulons, which are groups of genes that remain coordinately regulated despite the genetic, temporal, and developmental perturbations. The gene annotations in these groups validate known transitions and reveal new developmental events. For example, DNA replication genes are tightly coregulated with cell division genes, so they are expressed in mid-development although chromosomal DNA is not replicated. Our data set includes 486 transcriptional profiles that can help identify new relationships between transcription and development and improve gene annotations. We show its utility by showing that cycles of aggregation and disaggregation in allorecognition-defective mutants involve dedifferentiation. We also show sensitivity to genetic and developmental conditions in two commonly used actin genes, act6 and act15, and robustness of the coaA gene. Finally, we propose that gpdA is a better mRNA quantitation standard because it is less sensitive to external conditions than commonly used standards. The data set is available for democratized exploration through the web application dictyExpress and the data mining environment Orange.

A GoldenBraid cloning system for synthetic biology in social amoebae.

GoldenBraid is a rapid, modular, and robust cloning system used to assemble and combine genetic elements. Dictyostelium amoebae represent an intriguing synthetic biological chassis with tractable applications in development, chemotaxis, bacteria-host interactions, and allorecognition. We present GoldenBraid as a synthetic biological framework for Dictyostelium, including a library of 250 DNA parts and assemblies and a proof-of-concept strain that illustrates cAMP-chemotaxis with four fluorescent reporters coded by one plasmid.

Lectins modulate the microbiota of social amoebae.

The social amoeba Dictyostelium discoideum maintains a microbiome during multicellular development; bacteria are carried in migrating slugs and as endosymbionts within amoebae and spores. Bacterial carriage and endosymbiosis are induced by the secreted lectin discoidin I that binds bacteria, protects them from extracellular killing, and alters their retention within amoebae. This altered handling of bacteria also occurs with bacteria coated by plant lectins and leads to DNA transfer from bacteria to amoebae. Thus, lectins alter the cellular response of D. discoideum to bacteria to establish the amoebae's microbiome. Mammalian cells can also maintain intracellular bacteria when presented with bacteria coated with lectins, so heterologous lectins may induce endosymbiosis in animals. Our results suggest that endogenous or environmental lectins may influence microbiome homeostasis across eukaryotic phylogeny.

The polymorphic proteins TgrB1 and TgrC1 function as a ligand-receptor pair in Dictyostelium allorecognition.

Allorecognition is a key factor in Dictyostelium development and sociality. It is mediated by two polymorphic transmembrane proteins, TgrB1 and TgrC1, which contain extracellular immunoglobulin domains. TgrB1 and TgrC1 are necessary and sufficient for allorecognition, and they carry out separate albeit overlapping functions in development, but their mechanism of action is unknown. Here, we show that TgrB1 acts as a receptor with TgrC1 as its ligand in cooperative aggregation and differentiation. The proteins bind each other in a sequence-specific manner; TgrB1 exhibits a cell-autonomous function and TgrC1 acts non-cell-autonomously. The TgrB1 cytoplasmic tail is essential for its function and it becomes phosphorylated upon association with TgrC1. Dominant mutations in TgrB1 activate the receptor function and confer partial ligand independence. These roles in development and sociality suggest that allorecognition is crucial in the integration of individual cells into a coherent organism.

Allorecognition, via TgrB1 and TgrC1, mediates the transition from unicellularity to multicellularity in the social amoeba Dictyostelium discoideum.

The social amoeba Dictyostelium discoideum integrates into a multicellular organism when individual starving cells aggregate and form a mound. The cells then integrate into defined tissues and develop into a fruiting body that consists of a stalk and spores. Aggregation is initially orchestrated by waves of extracellular cyclic adenosine monophosphate (cAMP), and previous theory suggested that cAMP and other field-wide diffusible signals mediate tissue integration and terminal differentiation as well. Cooperation between cells depends on an allorecognition system comprising the polymorphic adhesion proteins TgrB1 and TgrC1. Binding between compatible TgrB1 and TgrC1 variants ensures that non-matching cells segregate into distinct aggregates prior to terminal development. Here, we have embedded a small number of cells with incompatible allotypes within fields of developing cells with compatible allotypes. We found that compatibility of the allotype encoded by the tgrB1 and tgrC1 genes is required for tissue integration, as manifested in cell polarization, coordinated movement and differentiation into prestalk and prespore cells. Our results show that the molecules that mediate allorecognition in D. discoideum also control the integration of individual cells into a unified developing organism, and this acts as a gating step for multicellularity.

Kin recognition protects cooperators against cheaters.

The evolution of sociality and altruism is enigmatic because cooperators are constantly threatened by cheaters who benefit from cooperation without incurring its full cost [1, 2]. Kin recognition is the ability to recognize and cooperate with genetically close relatives. It has also been proposed as a potential mechanism that limits cheating [3, 4], but there has been no direct experimental support for that possibility. Here we show that kin recognition protects cooperators against cheaters. The social amoebae Dictyostelium discoideum cooperate by forming multicellular aggregates that develop into fruiting bodies of viable spores and dead stalk cells. Cheaters preferentially differentiate into spores while their victims die as stalk cells in chimeric aggregates. We engineered syngeneic cheaters and victims that differed only in their kin-recognition genes, tgrB1 and tgrC1, and in a single cheater allele and found that the victims escaped exploitation by different types of nonkin cheaters. This protection depends on kin-recognition-mediated segregation because it is compromised when we disrupt strain segregation. These findings provide direct evidence for the role of kin recognition in cheater control and suggest a mechanism for the maintenance of stable cooperative systems.

Self-recognition in social amoebae is mediated by allelic pairs of tiger genes.

Free-living cells of the social amoebae Dictyostelium discoideum can aggregate and develop into multicellular fruiting bodies in which many die altruistically as they become stalk cells that support the surviving spores. Dictyostelium cells exhibit kin discrimination--a potential defense against cheaters, which sporulate without contributing to the stalk. Kin discrimination depends on strain relatedness, and the polymorphic genes tgrB1 and tgrC1 are potential components of that mechanism. Here, we demonstrate a direct role for these genes in kin discrimination. We show that a matching pair of tgrB1 and tgrC1 alleles is necessary and sufficient for attractive self-recognition, which is mediated by differential cell-cell adhesion. We propose that TgrB1 and TgrC1 proteins mediate this adhesion through direct binding. This system is a genetically tractable ancient model of eukaryotic self-recognition.

Polymorphic members of the lag gene family mediate kin discrimination in Dictyostelium.

Self and kin discrimination are observed in most kingdoms of life and are mediated by highly polymorphic plasma membrane proteins. Sequence polymorphism, which is essential for effective recognition, is maintained by balancing selection. Dictyostelium discoideum are social amoebas that propagate as unicellular organisms but aggregate upon starvation and form fruiting bodies with viable spores and dead stalk cells. Aggregative development exposes Dictyostelium to the perils of chimerism, including cheating, which raises questions about how the victims survive in nature and how social cooperation persists. Dictyostelids can minimize the cost of chimerism by preferential cooperation with kin, but the mechanisms of kin discrimination are largely unknown. Dictyostelium lag genes encode transmembrane proteins with multiple immunoglobulin (Ig) repeats that participate in cell adhesion and signaling. Here, we describe their role in kin discrimination. We show that lagB1 and lagC1 are highly polymorphic in natural populations and that their sequence dissimilarity correlates well with wild-strain segregation. Deleting lagB1 and lagC1 results in strain segregation in chimeras with wild-type cells, whereas elimination of the nearly invariant homolog lagD1 has no such consequences. These findings reveal an early evolutionary origin of kin discrimination and provide insight into the mechanism of social recognition and immunity.

Involvements of a novel protein, DIA2, in cAMP signaling and spore differentiation during Dictyostelium development.

The novel gene dia2 (differentiation-associated gene 2) was originally isolated as a gene expressed specifically in response to initial differentiation of Dictyostelium discoideum Ax-2 cells. Using dia2(AS) cells in which the dia2 expression was inactivated by the antisense RNA method, DIA2 protein was found to be required for cAMP signaling during cell aggregation. During late development, the DIA2 protein changed its location from the endoplasmic reticulum (ER) to prespore-specific vacuoles (PSVs) that are specifically present in prespore cells of the slug. In differentiating prestalk cells, however, DIA2 was found to be nearly lost from the cells. Importantly, exocytosis of PSVs from prespore cells and the subsequent spore differentiation were almost completely impaired in dia2(AS) cells. In addition, spore induction by externally applied 8-bromo cAMP was significantly suppressed in dia2(AS) cells. Taken together, these results strongly suggested that DIA2 might be closely involved in cAMP signaling and spore differentiation as well as in the initiation of differentiation during Dictyostelium development.

cis-Acting site controlling bidirectional transcription at the growth-differentiation transition in Dictyostelium discoideum.

A pair of adjacent genes, impA and dia1, are divergently transcribed but expressed at different stages in the life cycle of Dictyostelium discoideum. The intervening 654-bp region carries cis-acting regions that are essential for transcription in both directions as well as repression of dia1 in growing cells. We have focused on a 112-bp region proximal to dia1 that is essential for bidirectional transcription. Analyses of a set of internal deletions showed that the sequence between positions 80 and 97 (TTTGAATTTTTTGAATTT) is critical and that bases outside this region are dispensable. Site-directed mutations within this critical region confirmed the importance of this sequence for transcription both to the right and to the left. However, insertions of either 6 or 24 Ts into the run of 6 Ts separating the repeated GAA sequence had little effect on the functioning of the site in either direction, suggesting that factors recognize the half-sites TTGAATT separately. Inversion of the bases between positions 80 and 97 greatly reduced expression in both directions, indicating that orientation is critical for expression of both the nearby impA gene and the distal dia1 gene, which is more than 500 bp away. Comparison of 38 mutant constructs with multiple random variations in the region indicated that transcription factors may bind to a range of related sequences and still retain function. All functional constructs directed transcription both leftward and rightward, while all nonfunctional constructs were impaired for transcription in both directions. It appears that the same transcription complex controls transcription of both impA and dia1.

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.