Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 156
Filtrar
Más filtros












Base de datos
Intervalo de año de publicación
1.
Viruses ; 16(7)2024 Jun 30.
Artículo en Inglés | MEDLINE | ID: mdl-39066226

RESUMEN

Both bacteria product flagellin and macrophages are implicated in HIV-1 infection/disease progression. However, the impact of their interaction on HIV-1 infection and the associated mechanisms remain to be determined. We thus examined the effect of the flagellins on HIV-1 infection of primary human macrophages. We observed that the pretreatment of macrophages with the flagellins from the different bacteria significantly inhibited HIV-1 infection. The mechanistic investigation showed that the flagellin treatment of macrophages downregulated the major HIV-1 entry receptors (CD4 and CCR5) and upregulated the CC chemokines (MIP-1α, MIP-1ß and RANTES), the ligands of CCR5. These effects of the flagellin could be compromised by a toll-like receptor 5 (TLR5) antagonist. Given the important role of flagellin as a vaccine adjuvant in TLR5 activation-mediated immune regulation and in HIV-1 infection of macrophages, future investigations are necessary to determine the in vivo impact of flagellin-TLR5 interaction on macrophage-mediated innate immunity against HIV-1 infection and the effectiveness of flagellin adjuvant-based vaccines studies.


Asunto(s)
Flagelina , Infecciones por VIH , VIH-1 , Macrófagos , Internalización del Virus , Flagelina/inmunología , Humanos , Macrófagos/inmunología , Macrófagos/virología , VIH-1/inmunología , VIH-1/fisiología , Infecciones por VIH/inmunología , Infecciones por VIH/virología , Internalización del Virus/efectos de los fármacos , Receptores CCR5/metabolismo , Receptor Toll-Like 5/metabolismo , Quimiocinas CC/metabolismo , Quimiocinas CC/inmunología , Antígenos CD4/metabolismo , Células Cultivadas , Quimiocina CCL3/metabolismo , Quimiocina CCL5/metabolismo , Quimiocina CCL5/inmunología , Quimiocina CCL4/metabolismo
2.
Antiviral Res ; 228: 105947, 2024 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-38925368

RESUMEN

Combinational antiretroviral therapy (cART) suppresses human immunodeficiency virus type 1 (HIV-1) viral replication and pathogenesis in acquired immunodeficiency syndrome (AIDS) patients. However, HIV-1 remains in the latent stage of infection by suppressing viral transcription, which hinders an HIV-1 cure. One approach for an HIV-1 cure is the "shock and kill" strategy. The strategy focuses on reactivating latent HIV-1, inducing the viral cytopathic effect and facilitating the immune clearance for the elimination of latent HIV-1 reservoirs. Here, we reported that the H3K4 trimethylation (H3K4me3)-specific demethylase KDM5A/B play a role in suppressing HIV-1 Tat/LTR-mediated viral transcription in HIV-1 latent cells. Furthermore, we evaluated the potential of KDM5-specific inhibitor JQKD82 as an HIV-1 "shock and kill" agent. Our results showed that JQKD82 increases the H3K4me3 level at HIV-1 5' LTR promoter regions, HIV-1 reactivation, and the cytopathic effects in an HIV-1-latent T cell model. In addition, we identified that the combination of JQKD82 and AZD5582, a non-canonical NF-κB activator, generates a synergistic impact on inducing HIV-1 lytic reactivation and cell death in the T cell. The latency-reversing potency of the JQKD82 and AZD5582 pair was also confirmed in peripheral blood mononuclear cells (PBMCs) isolated from HIV-1 aviremic patients and in an HIV-1 latent monocyte. In latently infected microglia (HC69) of the brain, either deletion or inhibition of KDM5A/B results in a reversal of the HIV-1 latency. Overall, we concluded that KDM5A/B function as a host repressor of the HIV-1 lytic reactivation and thus promote the latency and the survival of HIV-1 infected reservoirs.


Asunto(s)
Infecciones por VIH , VIH-1 , Activación Viral , Latencia del Virus , VIH-1/fisiología , VIH-1/efectos de los fármacos , VIH-1/genética , Humanos , Latencia del Virus/efectos de los fármacos , Infecciones por VIH/virología , Infecciones por VIH/tratamiento farmacológico , Activación Viral/efectos de los fármacos , Proteína 2 de Unión a Retinoblastoma/metabolismo , Proteína 2 de Unión a Retinoblastoma/genética , Infección Latente/virología , Replicación Viral/efectos de los fármacos , Duplicado del Terminal Largo de VIH/genética , Supervivencia Celular , Línea Celular , Histonas/metabolismo , Proteínas Nucleares , Proteínas Represoras , Histona Demetilasas con Dominio de Jumonji
3.
Front Cell Infect Microbiol ; 14: 1383811, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38808062

RESUMEN

Introduction: While astrocytes participate in the CNS innate immunity against herpes simplex virus type 1 (HSV-1) infection, they are the major target for the virus. Therefore, it is of importance to understand the interplay between the astrocyte-mediated immunity and HSV-1 infection. Methods: Both primary human astrocytes and the astrocyte line (U373) were used in this study. RT-qPCR and Western blot assay were used to measure IFNs, the antiviral IFN-stimulated genes (ISGs), IFN regulatory factors (IRFs) and HSV-1 DNA. IRF1 knockout or knockdown was performed with CRISPR/Cas9 and siRNA transfection techniques. Results: Poly(dA:dT) could inhibit HSV-1 replication and induce IFN-ß/IFN-λs production in human astrocytes. Poly(dA:dT) treatment of astrocytes also induced the expression of the antiviral ISGs (Viperin, ISG56 and MxA). Among IRFs members examined, poly(dA:dT) selectively unregulated IRF1 and IRF9, particularly IRF1 in human astrocytes. The inductive effects of poly(dA:dT) on IFNs and ISGs were diminished in the IRF1 knockout cells. In addition, IRF1 knockout attenuated poly(dA:dT)-mediated HSV-1 inhibition in the cells. Conclusion: The DNA sensors activation induces astrocyte intracellular innate immunity against HSV-1. Therefore, targeting the DNA sensors has potential for immune activation-based HSV-1 therapy.


Asunto(s)
Astrocitos , Herpesvirus Humano 1 , Factor 1 Regulador del Interferón , Replicación Viral , Humanos , Astrocitos/virología , Astrocitos/metabolismo , Factor 1 Regulador del Interferón/metabolismo , Factor 1 Regulador del Interferón/genética , Herpesvirus Humano 1/inmunología , Herpesvirus Humano 1/genética , Herpesvirus Humano 1/fisiología , Inmunidad Innata , Poli dA-dT , Herpes Simple/inmunología , Herpes Simple/virología , Citosol/metabolismo , Línea Celular , Células Cultivadas , ADN Viral/genética , Técnicas de Inactivación de Genes
4.
J Med Virol ; 95(11): e29217, 2023 11.
Artículo en Inglés | MEDLINE | ID: mdl-37933090

RESUMEN

As a key immune cell in the brain, microglia are essential for protecting the central nervous system (CNS) from viral infections, including HIV. Microglia possess functional Toll-like receptor 3 (TLR3), a key viral sensor for activating interferon (IFN) signaling pathway-mediated antiviral immunity. We, therefore, studied the effect of poly (I:C), a synthetic ligand of TLR3, on the activation of the intracellular innate immunity against HIV in human iPSC-derived microglia (iMg). We found that poly (I:C) treatment of iMg effectively inhibits HIV infection/replication at both mRNA and protein levels. Investigations of the mechanisms revealed that TLR3 activation of iMg by poly (I:C) induced the expression of both type I and type III IFNs. Compared with untreated cells, the poly (I:C)-treated iMg expressed significantly higher levels of IFN-stimulated genes (ISGs) with known anti-HIV activities (ISG15, MxB, Viperin, MxA, and OAS-1). In addition, TLR3 activation elicited the expression of the HIV entry coreceptor CCR5 ligands (CC chemokines) in iMg. Furthermore, the transcriptional profile analysis showed that poly (I:C)-treated cells had the upregulated IFN signaling genes (ISG15, ISG20, IFITM1, IFITM2, IFITM3, IFITM10, APOBEC3A, OAS-2, MxA, and MxB) and the increased CC chemokine signaling genes (CCL1, CCL2, CCL3, CCL4, and CCL15). These observations indicate that TLR3 is a potential therapy target for activating the intracellular innate immunity against HIV infection/replication in human microglial cells. Therefore, further studies with animal models and clinical specimens are necessary to determine the role of TLR3 activation-driven antiviral response in the control and elimination of HIV in infected host cells.


Asunto(s)
Infecciones por VIH , Células Madre Pluripotentes Inducidas , Microglía , Receptor Toll-Like 3 , Humanos , Células Cultivadas , Inmunidad Innata , Microglía/virología , Poli I-C/farmacología , Receptor Toll-Like 3/genética
5.
Exp Neurol ; 364: 114386, 2023 06.
Artículo en Inglés | MEDLINE | ID: mdl-36934866

RESUMEN

The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms underlying the development and progression of HAND. This issue is mainly due to the lack of suitable in vitro models that can recapitulate the cellular and molecular complexity of the human brain. Hence, there is an urgent need for such models to study HIV neuropathogenesis and to develop therapeutics for HAND. The emergence of three-dimensional (3D) brain organoids generated from induced pluripotent stem cells (iPSCs) has now provided a clinically relevant in vitro model to study HIV brain infection and neuropathogenesis. Recently, there have been a noticeable number of publications that demonstrate the feasibility and advantages of this model for studies of neurobiology and brain disorders as well as HIV infection. Here, we describe the development of iPSC-derived human microglia-containing brain organoids, including advantages/challenges, and focus on their applicability for modeling HIV brain infection.


Asunto(s)
Infecciones por VIH , Células Madre Pluripotentes Inducidas , Humanos , Encéfalo/patología , Organoides
6.
Mol Ther ; 31(4): 1136-1158, 2023 04 05.
Artículo en Inglés | MEDLINE | ID: mdl-36793212

RESUMEN

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.


Asunto(s)
COVID-19 , Vacunas Virales , Humanos , SARS-CoV-2/genética , Transducción de Señal , ARN Mensajero/genética
7.
J Med Virol ; 95(1): e28253, 2023 01.
Artículo en Inglés | MEDLINE | ID: mdl-36286245

RESUMEN

Cytosolic recognition of microbial DNA in macrophages results in the activation of the interferon (IFN)-dependent antiviral innate immunity. Here, we examined whether activating DNA sensors in peripheral blood monocyte-derived macrophages (MDMs) can inhibit human immunodeficiency virus (HIV). We observed that the stimulation of MDMs with poly(dA:dT) or poly(dG:dC) (synthetic ligands for the DNA sensors) inhibited HIV infection and replication. MDMs treated with poly(dA:dT) or poly(dG:dC) expressed higher levels of both type I and type III IFNs than untreated cells. Activation of the DNA sensors in MDMs also induced the expression of the multiple intracellular anti-HIV factors, including IFN-stimulated genes (ISGs: ISG15, ISG56, Viperin, OAS2, GBP5, MxB, and Tetherin) and the HIV restriction microRNAs (miR-29c, miR-138, miR-146a, miR-155, miR-198, and miR-223). In addition, the DNA sensor activation of MDM upregulated the expression of the CC chemokines (RANTES, MIP-1α, MIP-1ß), the ligands for HIV entry coreceptor CCR5. These observations indicate that the cytosolic DNA sensors have a protective role in the macrophage intracellular immunity against HIV and that targeting the DNA sensors has therapeutic potential for immune activation-based anti-HIV treatment.


Asunto(s)
Infecciones por VIH , VIH-1 , MicroARNs , Humanos , Infecciones por VIH/metabolismo , VIH-1/fisiología , Células Cultivadas , Macrófagos , MicroARNs/genética , MicroARNs/metabolismo , ADN/metabolismo , Replicación Viral
8.
Vaccines (Basel) ; 10(6)2022 May 27.
Artículo en Inglés | MEDLINE | ID: mdl-35746466

RESUMEN

Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.S) are effective in preventing SARS-CoV-2 infection and alleviating COVID-19 illness, they have different efficacy against COVID-19. It is unclear whether the differences are due to varying ability of the vaccines to elicit a specific IgG antibody response and neutralization activity against spike protein of the virus. In this study, we compared the plasma IgG and neutralization titers against spike proteins of wild-type SARS-CoV-2 and eight variants in healthy subjects who received the mRNA-1273, BNT162b2 or Ad26.COV2.S vaccine. We demonstrated that subjects vaccinated with Ad26.COV2.S vaccine had significantly lower levels of IgG and neutralizing titers as compared to those who received the mRNA vaccines. While the linear regression analysis showed a positive correlation between IgG levels and neutralizing activities against SARS-CoV-2 WT and the variants, there was an overall reduction in neutralizing titers against the variants in subjects across the three groups. These findings suggest that people who received one dose of Ad26.COV2.S vaccine have a more limited IgG response and lower neutralization activity against SARS-CoV-2 WT and its variants than recipients of the mRNA vaccines. Thus, monitoring the plasma or serum levels of anti-SARS-CoV-2 spike IgG titer and neutralization activity is necessary for the selection of suitable vaccines, vaccine dosage and regimens.

10.
Cell Biosci ; 11(1): 194, 2021 Nov 10.
Artículo en Inglés | MEDLINE | ID: mdl-34758885

RESUMEN

BACKGROUND: Methamphetamine (METH), a potent addictive psychostimulant, is highly prevalent in HIV-infected individuals. Clinically, METH use is implicated in alteration of immune system and increase of HIV spread/replication. Therefore, it is of importance to examine whether METH has direct effect on HIV infection of monocytes, the major target and reservoir cells for the virus. RESULTS: METH-treated monocytes were more susceptible to HIV infection as evidenced by increased levels of viral proteins (p24 and Pr55Gag) and expression of viral GAG gene. In addition, using HIV Bal with luciferase reporter gene (HIV Bal-eLuc), we showed that METH-treated cells expressed higher luciferase activities than untreated monocytes. Mechanistically, METH inhibited the expression of IFN-λ1, IRF7, STAT1, and the antiviral IFN-stimulated genes (ISGs: OAS2, GBP5, ISG56, Viperin and ISG15). In addition, METH down-regulated the expression of the HIV restriction microRNAs (miR-28, miR-29a, miR-125b, miR-146a, miR-155, miR-223, and miR-382). CONCLUSIONS: METH compromises the intracellular anti-HIV immunity and facilitates HIV replication in primary human monocytes.

11.
Cell Biosci ; 11(1): 168, 2021 Aug 30.
Artículo en Inglés | MEDLINE | ID: mdl-34461999

RESUMEN

BACKGROUND: As the COVID-19 pandemic rages on, the new SARS-CoV-2 variants have emerged in the different regions of the world. These newly emerged variants have mutations in their spike (S) protein that may confer resistance to vaccine-elicited immunity and existing neutralizing antibody therapeutics. Therefore, there is still an urgent need of safe, effective, and affordable agents for prevention/treatment of SARS-CoV-2 and its variant infection. RESULTS: We demonstrated that green tea beverage (GTB) or its major ingredient, epigallocatechin gallate (EGCG), were highly effective in inhibiting infection of live SARS-CoV-2 and human coronavirus (HCoV OC43). In addition, infection of the pseudoviruses with spikes of the new variants (UK-B.1.1.7, SA-B.1.351, and CA-B.1.429) was efficiently blocked by GTB or EGCG. Among the 4 active green tea catechins at noncytotoxic doses, EGCG was the most potent in the action against the viruses. The highest inhibitory activity was observed when the viruses or the cells were pre-incubated with EGCG prior to the infection. Mechanistic studies revealed that EGCG blocked infection at the entry step through interfering with the engagement of the receptor binding domain (RBD) of the viral spikes to angiotensin-converting enzyme 2 (ACE2) receptor of the host cells. CONCLUSIONS: These data support further clinical evaluation and development of EGCG as a novel, safe, and cost-effective natural product for prevention/treatment of SARS-CoV-2 transmission and infection.

12.
Biology (Basel) ; 10(7)2021 Jul 13.
Artículo en Inglés | MEDLINE | ID: mdl-34356516

RESUMEN

The Toll-like receptor (TLR) 7 is a viral sensor for detecting single-stranded ribonucleic acid (ssRNA), the activation of which can induce intracellular innate immunity against viral infections. Imiquimod, a synthetic ligand for TLR7, has been successfully used for the topical treatment of genital/perianal warts in immunocompetent individuals. We studied the effect of imiquimod on the human immunodeficiency virus (HIV) infection of primary human macrophages and demonstrated that the treatment of cells with imiquimod effectively inhibited infection with multiple strains (Bal, YU2, and Jago) of HIV. This anti-HIV activity of imiquimod was the most potent when macrophages were treated prior to infection. Infection of macrophages with pseudotyped HIV NL4-3-ΔEnv-eGFP-Bal showed that imiquimod could block the viral entry. Further mechanistic studies revealed that while imiquimod had little effect on the interferons (IFNs) expression, its treatment of macrophages resulted in the increased production of the CC chemokines (human macrophage inflammatory protein-1 alpha (MIP-1α), MIP-1ß, and upon activation regulated normal T cells expressed and secreted (RANTES)), the natural ligands of HIV entry co-receptor CCR5, and decreased the expression of CD4 and CCR5. The addition of the antibodies against the CC chemokines to macrophage cultures could block imiquimod-mediated HIV inhibition. These findings provide experimental evidence to support the notion that TLR7 participates in the intracellular immunity against HIV in macrophages, suggesting the further clinical evaluation of imiquimod for its additional benefit of treating genital/perianal warts in people infected with HIV.

13.
Front Cell Neurosci ; 15: 682272, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-34290591

RESUMEN

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.

14.
J Innate Immun ; 13(5): 269-279, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-34082434

RESUMEN

The female reproductive tract (FRT) is a major site of HIV sexual transmission. As the outermost layer of cells in the FRT, the human cervical epithelial cells (HCEs) have direct contact with HIV or infected cells. Our early work showed that supernatant (SN) from TLR3-activated HCEs contain the antiviral factors that could potently inhibit HIV replication in macrophages. However, it remains to be determined how HCEs transport the anti-HIV factors to macrophages. This follow-up study examined the role of exosomes in HCE-mediated anti-HIV activity. We found that TLR3 activation of HCEs resulted in the release of exosomes that contained multiple IFN-stimulated genes (ISGs: ISG56, OAS1, MxA, and Mx2) and the HIV restriction microRNAs (miR-28, miR-29 family members, miR-125b, miR-150, miR-382, miR-223, miR-20a, and miR-198). The depletion of exosomes from SN of TLR3-activated HCEs diminished HCE-mediated anti-HIV activity in macrophages, indicating that HCE-derived exosomes are responsible for transporting the antiviral molecules to macrophages. These in vitro findings suggest a novel antiviral mechanism by which HCEs participate in the FRT innate immunity against HIV infection. Further in vivo studies are necessary in order to develop an exosome-based delivery system for prevention and treatment of HIV infection through sexual transmission.


Asunto(s)
Exosomas , Infecciones por VIH , MicroARNs , Células Epiteliales , Femenino , Estudios de Seguimiento , Humanos , Macrófagos , MicroARNs/genética , Receptor Toll-Like 3 , Replicación Viral
15.
Virology ; 560: 76-85, 2021 08.
Artículo en Inglés | MEDLINE | ID: mdl-34051477

RESUMEN

Chronically SHIVSF162P3N-infected cynomolgus monkeys were used to determine the effects of the antibody-mediated acute CD4+ T cell depletion on viral load as well as on the immunological factors associated with disease progression. Compared with the control animals, CD4+ T cell-depleted animals with SHIV infection showed (i) little alteration in plasma viral load over the period of 22 weeks after the depletion; (ii) increased CD4+ T cell proliferation and turnover of macrophages at the early phase of the depletion, but subsequent decline to the basal levels; and (iii) little impact on the expression of the inflammatory cytokines and CC chemokines associated with disease progression. These findings indicate that the antibody-mediated acute CD4+ T cell depletion had minimal impact on plasma viral load and disease progression in chronically SHIVSF162P3N-infected cynomolgus monkeys. Future investigations are necessary to identify the key factor(s) related to the immune activation and macrophage infection during the CD4 deletion in chronic viral infection.


Asunto(s)
Linfocitos T CD4-Positivos/inmunología , Depleción Linfocítica , Virus de la Inmunodeficiencia de los Simios/inmunología , Viremia/sangre , Replicación Viral/inmunología , Animales , Recuento de Linfocito CD4 , Linfocitos T CD4-Positivos/citología , China , Citocinas/biosíntesis , Citocinas/sangre , Progresión de la Enfermedad , Femenino , Activación de Linfocitos/inmunología , Macaca fascicularis , Macrófagos/inmunología , Macrófagos/virología , Prueba de Estudio Conceptual , Síndrome de Inmunodeficiencia Adquirida del Simio/inmunología , Síndrome de Inmunodeficiencia Adquirida del Simio/virología , Carga Viral
16.
J Med Virol ; 93(4): 1983-1998, 2021 04.
Artículo en Inglés | MEDLINE | ID: mdl-33300152

RESUMEN

Patients with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection manifest mainly respiratory symptoms. However, clinical observations frequently identified neurological symptoms and neuropsychiatric disorders related to COVID-19 (Neuro-SARS2). Accumulated robust evidence indicates that Neuro-SARS2 may play an important role in aggravating the disease severity and mortality. Understanding the neuropathogenesis and cellular mechanisms underlying Neuro-SARS2 is crucial for both basic research and clinical practice to establish effective strategies for early detection/diagnosis, prevention, and treatment. In this review, we comprehensively examine current evidence of SARS-CoV-2 infection in various neural cells including neurons, microglia/macrophages, astrocytes, pericytes/endothelial cells, ependymocytes/choroid epithelial cells, and neural stem/progenitor cells. Although significant progress has been made in studying Neuro-SARS2, much remains to be learned about the neuroinvasive routes (transneuronal and hematogenous) of the virus and the cellular/molecular mechanisms underlying the development/progression of this disease. Future and ongoing studies require the establishment of more clinically relevant and suitable neural cell models using human induced pluripotent stem cells, brain organoids, and postmortem specimens.


Asunto(s)
Encéfalo/virología , COVID-19/patología , Enfermedades del Sistema Nervioso/virología , Neuroglía/virología , Neuronas/virología , Animales , Encéfalo/patología , Línea Celular , Humanos , Enfermedades del Sistema Nervioso/patología , Células-Madre Neurales , Neuroglía/patología , Neuronas/patología
18.
Immunology ; 160(3): 269-279, 2020 07.
Artículo en Inglés | MEDLINE | ID: mdl-32053234

RESUMEN

Monocytic-lineage cells in the central nervous system (CNS), including microglia and brain resident macrophages, are the key players in the CNS innate immunity against viral infections, including human immunodeficiency virus (HIV). However, these cells also serve as the major targets and reservoirs for HIV in the CNS. To address the question of how HIV can establish persistent infection in the target cells in the CNS, we examined whether HIV has the ability to counteract Toll-like receptor 3 (TLR3) activation-mediated antiviral immunity in microglia and macrophages. We observed that HIV latently infected microglial cells (HC69·5) expressed reduced levels of TLR3 and TLR3 activation-mediated interferons (IFN-α/ß and IFN-λ) as compared with the uninfected control cells (C20). In addition, HIV infection of primary human macrophages suppressed the expression of TLR3 and the IFNs. HIV infection also inhibited the expression of the antiviral IFN-stimulated genes (ISGs) and the HIV-restriction miRNAs. Mechanistically, HIV infection inhibited the phosphorylation of IFN regulatory factors (IRF3 and IRF7) and signal transducer and activator of transcription proteins (STAT1 and STAT3) in both HIV latently infected microglia and acutely infected macrophages. These findings provide previously unrecognized and sound mechanisms for HIV infection and persistence in the primary target and reservoir cells in the brain.


Asunto(s)
Infecciones por VIH/inmunología , VIH-1/fisiología , Macrófagos/inmunología , Microglía/inmunología , Línea Celular , Regulación de la Expresión Génica , Humanos , Tolerancia Inmunológica , Inmunidad Innata , Factor 3 Regulador del Interferón/genética , Factor 3 Regulador del Interferón/metabolismo , Factor 7 Regulador del Interferón/genética , Factor 7 Regulador del Interferón/metabolismo , Interferones/genética , Interferones/metabolismo , Especificidad de Órganos , Factor de Transcripción STAT1/genética , Factor de Transcripción STAT1/metabolismo , Factor de Transcripción STAT3/genética , Factor de Transcripción STAT3/metabolismo , Receptor Toll-Like 3/metabolismo
19.
Antiviral Res ; 174: 104704, 2020 02.
Artículo en Inglés | MEDLINE | ID: mdl-31917237

RESUMEN

AIMS: Deguelin, a natural compound derived from Mundulea sericea (Leguminosae) and some other plants exhibits an activity to inhibit autophagy, a cellular machinery required for hepatitis C virus (HCV) replication. This study aimed to illuminate the impact of deguelin on HCV replication and mechanism(s) involved. METHODS: HCV JFH-1-Huh7 infectious system was used for the investigation. Real time RT-PCR, Western blot, fluorescent microscopy assay were used to measure the expression levels of viral or cellular factors. Overexpression and silencing expression techniques were used to determine the role of key cellular factors. RESULTS: Deguelin treatment of Huh7 cells significantly inhibited HCV JFH-1 replication in a dose- and time-dependent manner. Deguelin treatment suppressed autophagy in Huh7 cells, evidenced by the decrease of LC3B-II levels, the conversion of LC3B-I to LC3B-II, and the formation of GFP-LC3 puncta as well as the increase of p62 level in deguelin-treated cells compared with control cells. HCV infection could induce autophagy which was also suppressed by deguelin treatment. Mechanism research reveals that deguelin inhibited expression of Beclin1, which is a key cellular factor for the initiation of the autophagosome formation in autophagy. Overexpression or silencing expression of Beclin1 in deguelin-treated Huh7 cells could weaken or enhance the inhibitory effect on autophagy by deguelin, respectively, and thus partially recover or further inhibit HCV replication correspondingly. CONCLUSIONS: Deguelin may serve as a novel anti-HCV compound via its inhibitory effect on autophagy, which warrants further investigation as a potential therapeutic agent for HCV infection.


Asunto(s)
Antivirales/farmacología , Autofagia/efectos de los fármacos , Beclina-1/genética , Hepacivirus/efectos de los fármacos , Hepatocitos/efectos de los fármacos , Rotenona/análogos & derivados , Replicación Viral/efectos de los fármacos , Carcinoma Hepatocelular/tratamiento farmacológico , Carcinoma Hepatocelular/virología , Línea Celular Tumoral , Regulación hacia Abajo , Hepacivirus/fisiología , Hepatocitos/virología , Humanos , Neoplasias Hepáticas/tratamiento farmacológico , Neoplasias Hepáticas/virología , Extractos Vegetales/farmacología , Rotenona/farmacología
20.
Front Immunol ; 11: 598884, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-33664729

RESUMEN

Epithelial cells of the female reproductive tract (FRT) participate in the initial innate immunity against viral infections. Poly(dA:dT) is a synthetic analog of B form double-stranded (ds) DNA which can activate the interferon (IFN) signaling pathway-mediated antiviral immunity through DNA-dependent RNA Polymerase III. Here we investigated whether poly(dA:dT) could inhibit herpes simplex virus type 2 (HSV-2) infection of human cervical epithelial cells (End1/E6E7). We demonstrated that poly(dA:dT) treatment of End1/E6E7 cells could significantly inhibit HSV-2 infection. Mechanistically, poly(dA:dT) treatment of the cells induced the expression of the intracellular IFNs and the multiple antiviral IFN-stimulated genes (ISGs), including IFN-stimulated gene 15 (ISG15), IFN-stimulated gene 56 (ISG56), 2'-5'-oligoadenylate synthetase 1 (OAS1), 2'-5'-oligoadenylate synthetase 2 (OAS2), myxovirus resistance protein A (MxA), myxovirus resistance protein B (MxB), virus inhibitory protein, endoplasmic reticulum-associated, IFN-inducible (Viperin), and guanylate binding protein 5 (GBP5). Further investigation showed that the activation of RIG-I was largely responsible for poly(dA:dT)-mediated HSV-2 inhibition and IFN/ISGs induction in the cervical epithelial cells, as RIG-I knockout abolished the poly(dA:dT) actions. These observations demonstrate the importance for design and development of AT-rich dsDNA-based intervention strategies to control HSV-2 mucosal transmission in FRT.


Asunto(s)
Cuello del Útero/metabolismo , Cuello del Útero/virología , Proteína 58 DEAD Box/metabolismo , Herpes Genital/metabolismo , Herpes Genital/virología , Herpesvirus Humano 2/efectos de los fármacos , Herpesvirus Humano 2/fisiología , Poli dA-dT/farmacología , Receptores Inmunológicos/metabolismo , Biomarcadores , Línea Celular , Supervivencia Celular , Proteína 58 DEAD Box/genética , Células Epiteliales/metabolismo , Células Epiteliales/virología , Femenino , Técnicas de Silenciamiento del Gen , Herpes Genital/tratamiento farmacológico , Humanos , Inmunofenotipificación , Quinasas Janus/metabolismo , Membrana Mucosa/metabolismo , Membrana Mucosa/virología , Receptores Inmunológicos/genética , Factores de Transcripción STAT/metabolismo , Transducción de Señal/efectos de los fármacos , Replicación Viral/efectos de los fármacos
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA
...