Experimental Limits on Solar Reflected Dark Matter with a New Approach on Accelerated-Dark-Matter-Electron Analysis in Semiconductors.

Recently a dark matter-electron (DM-electron) paradigm has drawn much attention. Models beyond the standard halo model describing DM accelerated by high energy celestial bodies are under intense examination as well. In this Letter, a velocity components analysis (VCA) method dedicated to swift analysis of accelerated DM-electron interactions via semiconductor detectors is proposed and the first HPGe detector-based accelerated DM-electron analysis is realized. Utilizing the method, the first germanium based constraint on sub-GeV solar reflected DM-electron interaction is presented with the 205.4 kg·day dataset from the CDEX-10 experiment. In the heavy mediator scenario, our result excels in the mass range of 5-15 keV/c^{2}, achieving a 3 orders of magnitude improvement comparing with previous semiconductor experiments. In the light mediator scenario, the strongest laboratory constraint for DM lighter than 0.1 MeV/c^{2} is presented. The result proves the feasibility and demonstrates the vast potential of the VCA technique in future accelerated DM-electron analyses with semiconductor detectors.

Constraints on Sub-GeV Dark Matter-Electron Scattering from the CDEX-10 Experiment.

We present improved germanium-based constraints on sub-GeV dark matter via dark matter-electron (χ-e) scattering using the 205.4 kg·day dataset from the CDEX-10 experiment. Using a novel calculation technique, we attain predicted χ-e scattering spectra observable in high-purity germanium detectors. In the heavy mediator scenario, our results achieve 3 orders of magnitude of improvement for m_{χ} larger than 80 MeV/c^{2} compared to previous germanium-based χ-e results. We also present the most stringent χ-e cross-section limit to date among experiments using solid-state detectors for m_{χ} larger than 90 MeV/c^{2} with heavy mediators and m_{χ} larger than 100 MeV/c^{2} with electric dipole coupling. The result proves the feasibility and demonstrates the vast potential of a new χ-e detection method with high-purity germanium detectors in ultralow radioactive background.

Exotic Dark Matter Search with the CDEX-10 Experiment at China's Jinping Underground Laboratory.

A search for exotic dark matter (DM) in the sub-GeV mass range has been conducted using 205 kg day data taken from a p-type point contact germanium detector of the CDEX-10 experiment at China's Jinping underground laboratory. New low-mass dark matter searching channels, neutral current fermionic DM absorption (χ+A→ν+A) and DM-nucleus 3→2 scattering (χ+χ+A→ϕ+A), have been analyzed with an energy threshold of 160 eVee. No significant signal was found; thus new limits on the DM-nucleon interaction cross section are set for both models at the sub-GeV DM mass region. A cross section limit for the fermionic DM absorption is set to be 2.5×10^{-46} cm^{2} (90% C.L.) at DM mass of 10 MeV/c^{2}. For the DM-nucleus 3→2 scattering scenario, limits are extended to DM mass of 5 and 14 MeV/c^{2} for the massless dark photon and bound DM final state, respectively.

Incidental finding of juvenile angiofibroma from pre-orthodontic radiographs: two case reports and a literature review.

This case series presents two asymptomatic cases of juvenile angiofibroma which were initially incidentally identified in pre-orthodontic radiographs. Juvenile angiofibroma is an uncommon, locally aggressive benign, vascular neoplasm with invasive growth patterns. Due to the hypervascularity of these tumours, there are biopsy associated risks and multi-slice computed tomography, magnetic resonance imaging and angiography are usually employed for diagnosis. Early pre-symptomatic identification of this lesion facilitates early management and limiting potential life-threatening complications. This highlights the importance of thorough interpretation of dental radiographs, including the evaluation of structures which are not in the primary region of interest. © 2022 Australian Dental Association.

Dispersion-managed technique in temporal-frequency measurement for MoTe2-based ultrafast laser.

Ultrafast phenomena exist widely in modern scientific research. The time scale of ultrafast phenomena is mostly in the order of picosecond, femtosecond, or even attosecond. Nowadays, it is still a major challenge to study these nonrepetitive transient processes. Here, a temporal-frequency measurement based on a dispersion-managed technique has been proposed for an MoTe2-based ultrafast laser. The temporal-frequency measurement comprises a laser diode, an optical switch, a section of tunable dispersion compensation fiber, and a three-port beam splitter. Resolution of the proposed measurement can be tuned in a wide range; further, the upper and lower resolution limits are numerically simulated. The proposed measurement is expected to be applied in ultrafast pulse detection due to its application in real-time measurement of ultrafast nonrepetitive signals.

MiR-640 inhibition alleviates acute liver injury via regulating WNT signaling pathway and LRP1.

OBJECTIVE: Acute liver injury (ALI) is associated with the Kupffer cells (KCs) inflammation and hepatocytes apoptosis. Previous studies have shown that miR-640 is a valid regulator of the Low-density lipoprotein receptor-related protein 1 (LRP 1) which expressed much lower in an inflammatory condition. However, it is unclear whether MiR-640 inhibition protects against ALI by the up-regulation of LRP 1. To explore the regulated mechanism of miR-640 on acute liver injury. MATERIALS AND METHODS: We analyzed the expression of miR-640 in different times of acute injured liver tissues. Lipopolysaccharide (LPS) was employed in provoking the KCs inflammation to injure liver. We used miR-640 mimic or inhibitor to improve or resist the function of miR-640 to explore miR-640 function to ALI via the target of LRP1. RESULTS: We showed that the expression of miR-640 markedly increased in LPS-induced acute injured liver tissues. LPS promoted the progress of ALI, and the inhibition of miR-640 could reverse the injured effects of LPS. Moreover, WNT signaling pathway and LRP1 were significantly enhanced by miR-640 inhibition. CONCLUSIONS: These results suggested that miR-640 promotes KCs inflammation via restraining LRP 1 and WNT signaling pathway. But inhibiting miR-640 prevents inflammation damage and ameliorates ALI. MiR-640 inhibition may become a novel target for the therapy of ALI in the future.

Direct Detection Constraints on Dark Photons with the CDEX-10 Experiment at the China Jinping Underground Laboratory.

We report constraints on the dark photon effective kinetic mixing parameter (κ) with data taken from two p-type point-contact germanium detectors of the CDEX-10 experiment at the China Jinping Underground Laboratory. The 90% confidence level upper limits on κ of solar dark photon from 205.4 kg-day exposure are derived, probing new parameter space with masses (m_{V}) from 10 to 300 eV/c^{2} in direct detection experiments. Considering dark photon as the cosmological dark matter, limits at 90% confidence level with m_{V} from 0.1 to 4.0 keV/c^{2} are set from 449.6 kg-day data, with a minimum of κ=1.3×10^{-15} at m_{V}=200 eV/c^{2}.

A significant incidental finding on cone beam computed tomography: multiple myeloma.

Cone beam computed tomography is widely used in dentistry. Incidental findings are common, with many requiring intervention or monitoring. We present a rare case of previously undiagnosed, asymptomatic multiple myeloma first identified incidentally on cone beam computed tomography and panoramic radiography. This case highlights the diverse range of lesions that may appear on cone beam computed tomography and the importance of radiologic interpretation.

Identifying characteristics of an effective fracture liaison service: systematic literature review.

Fracture liaison services (FLS) have been demonstrated to improve outcomes following osteoporotic fracture. The aim of this systematic literature review (SLR) was to determine the characteristics of an FLS that lead to improved patient outcomes. We conducted a SLR, including articles published between 2000 and February 2017, using global (Medline, EMBASE, PubMed and Cochrane Library) and local databases. Studies including patients aged ≥ 50 years with osteoporotic fractures enrolled in an FLS were assessed. Information extracted from each article included key person coordinating the FLS (physician, nurse or other healthcare professional), setting (hospital vs community), intensity (single vs multiple), duration (long vs short term), fracture type and gender. A meta-analysis of randomised controlled trials was conducted based on the key person coordinating the FLS. Out of 7236 articles, 57 were considered to be high quality and identified for further analysis. The SLR identified several components which contributed to FLS success, including multidisciplinary involvement, driven by a dedicated case manager, regular assessment and follow-up, multifaceted interventions and patient education. Meta-analytic data confirm the effectiveness of an FLS following an osteoporotic fracture: approximate 27% increase in the likelihood of BMD testing and up to 21% increase in the likelihood of treatment initiation compared with usual care. The balance of evidence indicates that the multifaceted FLS and dedicated coordination are important success factors that contribute to effective FLS interventions which reduce fracture-related morbidity and mortality.

Design of metasurface polarizers based on two-dimensional cold atomic arrays.

Engineering light-matter interaction using cold atomic arrays is one of the central topics in modern optics. Here we have demonstrated the capability of two-dimensional asymmetric cold atomic arrays as microscopic metasurfaces for controlling polarization states of light. The designed linear polarizer can lead to an extinction ratio over 20dB as well as a high transmittance over 0.8 for the permitted polarization at zero detuning. For detuned driving light, changing lattice constants can also achieve high performance linear polarizers. We have also accomplished a circular polarizer by manipulating the phases of transmitted light. A theoretical analysis based on Bloch theorem shows the underlying mechanism for this performance is actually attributed to cooperative effects in periodic lattices. Finally, we discuss in detail the effects of system size, lattice imperfection and nonzero driving light linewidth in practical implementation. The present study paves a way to design extremely miniaturized metasurfaces using cold atoms and other two-level systems, showing great potential in quantum information and quantum metrology sciences as well as the fundamental physics of light-matter interaction.

Survival outcome of weak estrogen/progesterone receptor expression in HER2 negative breast cancer is similar to triple negative breast cancer.

BACKGROUND: Recent publications have suggested that human epidermal growth factor receptor 2 (HER2)-negative breast cancers with "weak" estrogen receptor (ER)/progesterone receptor (PR) expression levels by immunohistochemical (IHC) analysis were considered as the triple-negative (TN) subtype. This study aimed to evaluate the overall survival (OS), disease-free survival rates (DFS), and disease-specific survival (DSS) based on ER and PR expression levels into one of three groups, ER and PR <1%, ER and PR 1%-20%, and ER or PR >20% by hormone therapy. METHODS: Medical records of 3353 breast cancer patients treated from 2006 to 2013 were retrospectively reviewed. Tumor characteristics, type of treatment, OS, DFS and DSS were evaluated among the three patient groups. RESULTS: Regarding OS, there were significant differences according to the received hormone therapy in the different groups: ER and PR <1% (P = 0.972), ER and PR 1%-20% (P = 0.264), and ER or PR >20% (P = 0.014). Regarding DFS and DSS, there were also significant differences in the different groups: ER and PR <1% (P = 0.611, 0.766), ER and PR 1%-20% (P = 0.847, 0.629), and ER or PR >20% (P = 0.031, 0.002). CONCLUSIONS: In HER2 negative breast cancer patient with hormone therapy, ER and PR expression level of 1%-20% has similar survival outcome to the ER and PR expression level of <1% by IHC analysis.

[Diagnostic value of combining serum soluble ST2 and interleukin-33 for heart failure patients with preserved left ventricular ejection fraction].

Objective: Diagnostic efficacy of serum markers is low for heart failure patients with preserved left ventricular ejection fraction (HF-pEF) as compared to heart failure patients with reduced left ventricular ejection fraction.We sought to explore the diagnostic value of serum levels of soluble ST2 (sST2) combined with interleukin-33 (IL-33) for the diagnosis of HF-pEF in this study. Methods: A total of 376 patients with HF-pEF (HF group), 376 matched-control patients without heart failure who shared similar clinical characteristics (non-HF group) were included in the study.Another 500 healthy individuals were recruited for assessing the normal ranges of IL-33 and sST2.Serum levels of NT-proBNP were measured by chemi-luminescence assay, while IL-33 and sST2 were measured by enzyme linked immunosorbent assay. Results: Serum levels of IL-33 and sST2 were not normally distributed in healthy population.Serum concentrations of IL-33 and sST2 were significantly higher in HF-pEF patients than in patients in non-HF group (median, IL-33: 0.437 µg/L vs. 0.127 µg/L, P<0.01; sST: 0.118 µg/L vs. 0.067 µg/L, P<0.01). The area under receiver operating characteristic curve (AUC) of sST2 for detecting HF-pEF was 0.763 (95%CI 0.729-0.795, P<0.01), with 71.01% sensitivity and 66.75% specificity, the AUC was 0.884 (95%CI 0.859-0.908, P<0.01), with 80.05% sensitivity and 81.91% specificity in patients with serum IL-33 higher than 0.117 µg/L (median level of serum IL-33 in healthy individuals, n=306). The AUC of NT-proBNP for detecting HF-pEF was 0.83, with 74.73% sensitivity and 84.57% specificity.The AUC of sST2 for detecting HF-pEF was significantly higher than NT-proBNP in population with high serum IL-33 (AUC: 0.88 vs. 0.83, P<0.01). Conclusion: Serum sST2 could serve as a satisfactory biomarker for HF-pEF diagnosis, especially for patients with high serum IL-33 concentrations.

Differential signaling through p190 and p210 BCR-ABL fusion proteins revealed by interactome and phosphoproteome analysis.

Two major types of leukemogenic BCR-ABL fusion proteins are p190BCR-ABLand p210BCR-ABL. Although the two fusion proteins are closely related, they can lead to different clinical outcomes. A thorough understanding of the signaling programs employed by these two fusion proteins is necessary to explain these clinical differences. We took an integrated approach by coupling protein-protein interaction analysis using biotinylation identification with global phosphorylation analysis to investigate the differences in signaling between these two fusion proteins. Our findings suggest that p190BCR-ABL and p210BCR-ABL differentially activate important signaling pathways, such as JAK-STAT, and engage with molecules that indicate interaction with different subcellular compartments. In the case of p210BCR-ABL, we observed an increased engagement of molecules active proximal to the membrane and in the case of p190BCR-ABL, an engagement of molecules of the cytoskeleton. These differences in signaling could underlie the distinct leukemogenic process induced by these two protein variants.

Combination therapy targeting ectopic ATP synthase and 26S proteasome induces ER stress in breast cancer cells.

F1Fo ATP synthase is present in all organisms and is predominantly located on the inner membrane of mitochondria in eukaryotic cells. The present study demonstrated that ATP synthase and electron transport chain complexes were ectopically expressed on the surface of breast cancer cells and could serve as a potent anticancer target. We investigated the anticancer effects of the ATP synthase inhibitor citreoviridin on breast cancer cells through proteomic approaches and revealed that differentially expressed proteins in cell cycle regulation and in the unfolded protein response were functionally enriched. We showed that citreoviridin triggered PERK-mediated eIF2α phosphorylation, which in turn attenuated general protein synthesis and led to cell cycle arrest in the G0/G1 phase. We further showed that the combination of citreoviridin and the 26S proteasome inhibitor bortezomib could improve the anticancer activity by enhancing ER stress, by ameliorating citreoviridin-caused cyclin D3 compensation, and by contributing to CDK1 deactivation and PCNA downregulation. More interestingly, the combined treatment triggered lethality through unusual non-apoptotic caspase- and autophagy-independent cell death with a cytoplasmic vacuolization phenotype. The results imply that by boosting ER stress, the combination of ATP synthase inhibitor citreoviridin and 26S proteasome inhibitor bortezomib could potentially be an effective therapeutic strategy against breast cancer.

Radiation induces senescence and a bystander effect through metabolic alterations.

Cellular senescence is a state of irreversible growth arrest; however, the metabolic processes of senescent cells remain active. Our previous studies have shown that radiation induces senescence of human breast cancer cells that display low expression of securin, a protein involved in control of the metaphase-anaphase transition and anaphase onset. In this study, the protein expression profile of senescent cells was resolved by two-dimensional gel electrophoresis to investigate associated metabolic alterations. We found that radiation induced the expression and activation of glyceraldehyde-3-phosphate dehydrogenase that has an important role in glycolysis. The activity of lactate dehydrogenase A, which is involved in the conversion of pyruvate to lactate, the release of lactate and the acidification of the extracellular environment, was also induced. Inhibition of glycolysis by dichloroacetate attenuated radiation-induced senescence. In addition, radiation also induced activation of the 5'-adenosine monophosphate-activated protein kinase (AMPK) and nuclear factor kappa B (NF-κB) pathways to promote senescence. We also found that radiation increased the expression of monocarboxylate transporter 1 (MCT1) that facilitates the export of lactate into the extracellular environment. Inhibition of glycolysis or the AMPK/NF-κB signalling pathways reduced MCT1 expression and rescued the acidification of the extracellular environment. Interestingly, these metabolic-altering signalling pathways were also involved in radiation-induced invasion of the surrounding, non-irradiated breast cancer and normal endothelial cells. Taken together, radiation can induce the senescence of human breast cancer cells through metabolic alterations.

WWOX suppresses autophagy for inducing apoptosis in methotrexate-treated human squamous cell carcinoma.

Squamous cell carcinoma (SCC) cells refractory to initial chemotherapy frequently develop disease relapse and distant metastasis. We show here that tumor suppressor WW domain-containing oxidoreductase (WWOX) (also named FOR or WOX1) regulates the susceptibility of SCC to methotrexate (MTX) in vitro and cure of SCC in MTX therapy. MTX increased WWOX expression, accompanied by caspase activation and apoptosis, in MTX-sensitive SCC cell lines and tumor biopsies. Suppression by a dominant-negative or small interfering RNA targeting WWOX blocked MTX-mediated cell death in sensitive SCC-15 cells that highly expressed WWOX. In stark contrast, SCC-9 cells expressed minimum amount of WWOX protein and resisted MTX-induced apoptosis. Transiently overexpressed WWOX sensitized SCC-9 cells to apoptosis by MTX. MTX significantly downregulated autophagy-related Beclin-1, Atg12-Atg5 and LC3-II protein expression and autophagosome formation in the sensitive SCC-15, whereas autophagy remained robust in the resistant SCC-9. Mechanistically, WWOX physically interacted with mammalian target of rapamycin (mTOR), which potentiated MTX-increased phosphorylation of mTOR and its downstream substrate p70 S6 kinase, along with dramatic downregulation of the aforementioned proteins in autophagy, in SCC-15. When WWOX was knocked down in SCC-15, MTX-induced mTOR signaling and autophagy inhibition were blocked. Thus, WWOX renders SCC cells susceptible to MTX-induced apoptosis by dampening autophagy, and the failure in inducing WWOX expression leads to chemotherapeutic drug resistance.

First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan.

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5'CCGACATTGCCGTCAGCGATCACG3' and rv-5'AGCGTTCTTGGGTGTGTTGAGCATTTG3' (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

First Report of Stem and Leaf Blight Caused by Sclerotinia sclerotiorum on Eustoma in Taiwan.

Eustoma (Eustoma russellianum) is an economically important cut flower in Taiwan. Each year more than 1.7 million dozen flowers, mainly exported to Japan in the winter, are produced in greenhouses. In January 2011, eustoma plants with stem and leaf blight symptoms were observed in some greenhouses in Changhua County, Taiwan, at an incidence of 2%. Brown and rotten lesions were presented on the stem and nearby leaves, with white mycelia growing on the surface and black sclerotia (up to 7 mm long) produced inside the stem. Infected plants were completely blighted and eventually died. Diseased stem tissues collected from the field were surface sterilized for 3 min in 0.6% NaOCl, rinsed with sterilized distilled water, and plated on potato dextrose agar. White fungal colonies were consistently isolated. The cultures produced large sclerotia at the peripheries of the plates. Internal transcribed spacer (ITS) sequences of two voucher isolates were determined and deposited in GenBank (Accession Nos. JQ653934 and JQ653935). The sequences were 100% identical to that of Sclerotinia sclerotiorum strain ATCC MYA-4521 (Accession No. FJ810516). In addition, PCR amplified DNA fragments (approximately 630 bp) were obtained by the S. sclerotiorum specific primer pair MP_SsF and MP_UniR (1). On the basis of morphology, ITS sequence homology, and the specific PCR detection, the fungus was identified as S. sclerotiorum. The two fungal isolates (BCRC34830 and BCRC34831) were deposited in Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were conducted on 1-month-old, second flush eustoma cultivars Ex Rosa Pink Flash and Rosina Blue Ver. 2 after primary flowers had been harvested in the greenhouse. Fungal inoculum consisting of Tref horticultural substrate and wet sterilized rice colonized by S. sclerotiorum BCRC34830 (substrate-rice-water ratio of 2:1:1) was placed near the base of the plants. Ten plants of each cultivar were inoculated with about 800 g of the mixture. Sterile mixture applied to an equal number of plants served as negative controls. Eight plants of each cultivar showed blight symptoms after 1 month of incubation at an average temperature of 26°C. All control plants remained healthy. The pathogen reisolated from the inoculated stems produced sclerotia identical to those isolated in the field, fulfilling Koch's postulates. The pathogenicity test was repeated with similar results. S. sclerotiorum has been reported on eustoma in Argentina (2). To our knowledge, this is the first report of Sclerotinia blight on eustoma in Taiwan. Although the disease was not prevalent on eustoma, the inoculum could be dormant in the greenhouse soil. Awareness of the potential perennial problem could increase the quality of the flowers exported and benefit the flower industry. References: (1) S. Hirschhäuser and J. Fröhlich. Int. J. Food Microbiol. 118:151, 2007. (2) S. Wolcan et al. Plant Dis. 80:223, 1996.

Parosteal osteosarcoma: report of a case and review of the literature.

Parosteal osteosarcoma is a rare malignancy of the bone that usually arises in the long bones. Involvement of the oral cavity is rare. Only 12 cases of intraoral parosteal osteosarcoma have been reported in the English language literature. This paper defines the major clinical, radiographic and histologic features of parosteal osteosarcoma and illustrates these with a case of a 33-year-old male presenting with a three-month history of a painless enlarging lump in the right maxilla. A critical and comprehensive review of the English language literature is also provided.