RESUMEN
BACKGROUND: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6. METHODS: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression. RESULTS: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD). CONCLUSIONS: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.
Asunto(s)
Aniridia/genética , Codón sin Sentido , Factor de Transcripción PAX6/genética , Desprendimiento de Retina/genética , Adulto , Aniridia/diagnóstico , Exones/genética , Femenino , Heterocigoto , Humanos , Irán , Masculino , Linaje , ARN Mensajero/genética , Reacción en Cadena en Tiempo Real de la Polimerasa , Desprendimiento de Retina/diagnóstico , Agudeza Visual/fisiologíaRESUMEN
BACKGROUND: The aim of this study was to simultaneously measure the concentrations of vascular endothelial growth factor (VEGF) and soluble VEGF receptor-1 (sVEGFR-1, also known as sFlt-1) in the aqueous humor of patients with non-proliferative diabetic retinopathy (NPDR) and to investigate whether aqueous levels of vascular endothelial growth factor (VEGF) and VEGFR-1 are related to diabetic macular edema. MATERIALS AND METHODS: Aqueous humor was collected from 27 diabetic patients and 33 age- and sex-matched normoglycemic controls and analyzed for pro-angiogenic VEGF and angiogenic inhibitor VEGFR-1 by enzyme-linked immunosorbent assay (ELISA). The mean foveal thickness was measured by optical coherence tomography (OCT). RESULTS: There was no significant difference in the aqueous levels of VEGF in patients with NPDR compared with control subjects (P > 0.05), while the NPDR patients had significantly lower sVEGFR-1 in their aqueous humor. Furthermore, a significant (P < 0.01) positive correlation was observed between VEGF/sVEGFR-1 concentration and the mean foveal thickness measured on OCT. CONCLUSION: The results suggest that decreased chelating effect of sVEGFR-1 may be the preliminary event allowing VEGF to activate the proangiogenic endothelial cell state and to induce permeability. The imbalance between angiogenic agent (VEGF) and the antiangiogenic factors (sFlt-1), which is disturbed in the diabetic state, may determine the fate of diabetic macular edema.
