Phylogenetic analysis, molecular characterization and virulence profiling based on toxoflavin gene of an Indian BG1 strain of Burkholderia glumae causing panicle blight of rice.

Bacterial panicle blight (BPB) caused by Burkholderia glumae (BG) has become significantly more prevalent in the rice-growing regions of North India. Based on virulence screening and in vitro quantification of toxoflavin, the BG strains were classified as hyper- (BG1 and BG3), moderate- (BG2, BG4, BG6, BG8, and BG9), and hypo- (BG5, BG7, and BG10) virulent. Plant inoculation assays with cell-free culture filtrate revealed strains with higher toxoflavin-producing ability had higher virulence. Based on 16S rRNA sequence, 6 isolates from Uttar Pradesh were grouped in clad C1; whereas, clad C2 exhibited 4 isolates, two each from Delhi and Uttar Pradesh. Strain BG1 being the most virulent Indian strain from Uttar Pradesh was further profiled for 11 tox genes. We found all the 11 tox genes present in strain BG1. In toxRABCDE cluster, all tox genes showed high similarity to B. glumae BGR1 except toxB, whereas in toxFGHIJ cluster toxF, toxG, toxH and toxI shared maximum similarity to B. glumae 336gr-1. tox genes of BG1 exhibited homology as well as divergence with B. gladioli. The domain prediction and protein association network analysis indicated the possible involvement of tox genes in the toxoflavin biosynthesis. As per our knowledge, this is the first report in India on characterization of tox genes cluster in B. glumae. Altogether, our study unravels a reliable method for identifying and characterizing B. glumae using tox genes and its relationship with disease production. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03660-6.

Complete genome resource unravels the close relation of an Indian Xanthomonas oryzae pv. oryzae strain IXOBB0003 with Philippines strain causing bacterial blight of rice.

Xanthomonas oryzae pv. oryzae (Xoo) is a pathogen of concern for rice growers as it limits the production potential of rice varieties worldwide. Due to their high genomic plasticity, the pathogen continues to evolve, nullifying the deployed resistance mechanisms. It is pertinent to monitor the evolving Xoo population for the virulent novel stains, and the affordable sequencing technologies made the task feasible with an in-depth understanding of their pathogenesis arsenals. We present the complete genome of a highly virulent Indian Xoo strain IXOBB0003, predominantly found in northwestern parts of India, by employing next-generation sequencing and single-molecule sequencing in real-time technologies. The final genome assembly comprises 4,962,427 bp and has 63.96% GC content. The pan genome analysis reveals that strain IXOBB0003 houses total of 3655 core genes, 1276 accessory genes and 595 unique genes. Comparative analysis of the predicted gene clusters of coding sequences and protein count of strain IXOBB0003 depicts 3687 of almost 90% gene clusters shared by other Asian strains, 17 unique to IXOBB0003 and 139 CDSs of IXOBB0003 are shared with PXO99A. AnnoTALE-based studies revealed 16 TALEs conferred from the whole genome sequence. Prominent TALEs of our strain are found orthologous to TALEs of the Philippines strain PXO99A. The genomic features of Indian Xoo strain IXOBB0003 and in comparison with other Asian strains would certainly contribute significantly while formulating novel strategies for BB management. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03596-x.

First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India.

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

Plant-based expression platforms to produce high-value metabolites and proteins.

Plant-based heterologous expression systems can be leveraged to produce high-value therapeutics, industrially important proteins, metabolites, and bioproducts. The production can be scaled up, free from pathogen contamination, and offer post-translational modifications to synthesize complex proteins. With advancements in molecular techniques, transgenics, CRISPR/Cas9 system, plant cell, tissue, and organ culture, significant progress has been made to increase the expression of recombinant proteins and important metabolites in plants. Methods are also available to stabilize RNA transcripts, optimize protein translation, engineer proteins for their stability, and target proteins to subcellular locations best suited for their accumulation. This mini-review focuses on recent advancements to enhance the production of high-value metabolites and proteins necessary for therapeutic applications using plants as bio-factories.

Black rot disease incited by Indian race 1 of Xanthomonas campestris pv. campestris in Brassica juncea L. cv. Pusa Bold in India.

Mustard (Brassica juncea L.) is an important oil seed crop in the Brassicaceae family. It is widely cultivated in India for its edible leaves, oil and medicinal properties. In January 2022, we noticed necrotic symptoms typical black rot disease on Brassica juncea (L.) cv. Pusa Bold grown in Indian Agricultural Research Institute, India. Initially, chlorotic lesions emerged on the leaf margin, which progressed to angular V-shaped necrotic lesions and blackened veins. Disease progression became a necrotic appearance in the leaf results browning and papery leaf texture appeared. The suspected causal agent was isolated from three different diseased plants of Pusa Bold on nutrient sucrose agar medium that formed pale yellow, mucoid, and fluidal colonies. Three representative isolates originated from three different plants were sub-cultured on YGCA medium. These isolates are Gram-negative, oxidase negative, KOH positive, nonfluorescent on King's Medium B agar, and positive for starch hydrolysis test (Schaad and White 1974). The 16S ribosomal RNA gene and avirulence genes - AvrBs1 and AvrGf1 were amplified and sequenced in these three isolates with other Xanthomonas campestris pv. campestris (Xcc) isolates. The DNA sequence analysis revealed that these isolates are within the species of X. campestris. The race 1 specific marker namely xcc-b100_4389 was used to characterized the race by detection of 1090bp fragment respectively from gDNA of Xcc isolates (Rubel et al., 2017). The pathogenicity of these isolates was tested twice on youngest leaves of 30-day-old plants of Pusa Bold to convey Koch postulates. Inoculum of three isolates were prepared in nutrient broth at 28°C for 48-h. The pathogenicity test was conducted by small scissors dipped in a bacterial suspension (~ 108 cfu/ml) to cut leaf near margins at 10 points per leaf and the three youngest leaves per plant with three replications. The number of infected points per leaf and the severity of symptoms were assessed 15 and 30 days after inoculation (Singh et al., 2011; 2016). The chlorotic lesions with V-shaped symptoms were appeared on all inoculated plants after 15 and 30 dpi (days post-inoculation). The bacteria were reisolated from inoculated plants and has the same identity as original isolates by using 16S rRNA, avr genes and race 1 specific marker PCR, thereby confirming Koch's postulates. The bacterial inoculation was repeated and the same symptoms appear. Most of the crucifers are infected with black rot disease e.g., cauliflower, cabbage, Brussels, sprout etc. (Vicente et al., 2001). The nucleotide BLAST analysis of 16S rRNA, AvrBs1, AvrGf1 showed a 100% identity with different Xcc strains reported from Germany (B100; AM920689), Brazil (ATCC 33913; AE008922), India (Xcc-C7; CP077958), France (CFBP 5817; CM002673) and China (8004; CP000050) (Singh et al. 2022). Whilst, the nBLAST analysis of xcc-b100_4389 showed 100% nucleotide identity with Xcc race 1 (B100; AM920689), Germany. The sequences were deposited in GenBank (16S rRNA: OM839780; AvrBs1: OM994397; AvrGf1: OM994398; xcc-b100_4389: OM994399). The XccAK1 strain (ITCCBH_0014) was deposited in Indian Type Culture Collection, ICAR-IARI, New Delhi, India. Presently, it is a first report of necrotic black rot on B. juncea cv. Pusa Bold incited by Xcc race 1, India. Previous research reported the black rot disease on other species of the Brassica genus e.g., B. oleracea, and B. napus in Serbia (Popovic et al., 2013) and Argentina (Gaetan et al., 2005).

Rice transcriptome upon infection with Xanthomonas oryzae pv. oryzae relative to its avirulent T3SS-defective strain exposed modulation of many stress responsive genes.

Xanthomonas oryzae pv. oryzae (Xoo) is a destructive pathogen that causes bacterial blight disease of rice worldwide. Xoo uses T3SS (type III secretion system) effectors to subvert rice innate immunity. However, the comprehensive knowledge of rice genes involved in T3SS effectors-mediated interaction remains unclear. In this study, the transcriptome profiles of rice infected with a virulent Xoo strain from North-eastern region of India relatives to its avirulent strain (that lacks functional T3SS) were analyzed at early (2-6 hpi) and late (16-24 hpi) hours of infection. Out of total 255 differentially expressed genes (DEGs), during early infection, 62 and 70 genes were upregulated and downregulated, respectively. At late infection, 70 and 53 genes were upregulated and downregulated, respectively. The transcriptomic data identified many differentially expressed resistant genes, transposons, transcription factors, serine/threonine protein kinase, cytochrome P450 and peroxidase genes that are involved in plant defense. Pathway analysis revealed that these DEGs are involved in hormone signaling, plant defense, cellular metabolism, growth and development processes. DEGs associated with plant defense were also validated through quantitative real-time PCR. Our study brings a comprehensive picture of the rice genes that are being differentially expressed during bacterial blight infection. Nevertheless, the DEG-associated pathways would provide sensible targets for developing resistance to bacterial blight. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-022-03193-4.

Xanthomonas axonopodis pv. punicae depends on multiple non-TAL (Xop) T3SS effectors for its coveted growth inside the pomegranate plant through repressing the immune responses during bacterial blight development.

Xanthomonas axonopodis pv. punicae (Xap), the bacterial blight pathogen of pomegranate, incurs substantial loss to yield and reduces export quality of this economically important fruit crop. During infection, the bacterium secretes six non-TAL (Xop) effectors into the pomegranate cells through a specialized type three secretion system (T3SS). Previously, we demonstrated the role of two key effectors, XopL and XopN in pathogenesis. Here, we investigate the role of rest effectors (XopC2, XopE1, XopQ and XopZ) on disease development. We generated null mutants for each individual effector and mutant bacterial suspension was infiltrated into pomegranate leaves. Compared to Xap wild, the mutant bacterial growth was reduced by 2.7-11.5 folds. The mutants produced lesser water-soaked lesions when infiltrated on leaves by 1.13-2.21 folds. Among the four effectors, XopC2 contributes highest for in planta bacterial growth and disease development. XopC2 efficiently suppressed the defense responses like callose deposition, reactive oxygen species (ROS) and the activation of immune responsive genes. Being a major contributor, we further characterize XopC2 for its subcellular localization, its protein structure and networking. XopC2 is localized to the plasma membrane of Nicotiana benthamiana like XopL and XopN. XopC2 is a 661 amino acids protein having 15 alpha and 17 beta helix. Our STRING and I-TASSER based analysis hinted that XopC2 interacts with multiple membrane localized plant proteins including transcription regulator of CCR4-NOT family, TTN of maintenance of chromosome family and serine/threonine-protein phosphatase 2A (PP2A) isoform. Based on the interaction it is predicted that XopC2 might involve in diverse functions like nuclear-transcribed mRNA catabolic process, maintenance of chromosome, hormone signaling and protein dephosphorylation activities and thereby suppress the plant immunity. Altogether, our study suggests that Xap largely depends on three non-TAL (Xop) effectors, including XopC2, XopL and XopN, to modulate pomegranate PTI for its unrestricted proliferation during bacterial blight development.

Complete Genome Sequence of Indian Race 4 of Xanthomonas oryzae pv. oryzae, the Causal Agent of Bacterial Blight of Rice.

Xanthomonas oryzae pv. oryzae, the causal bacterium of bacterial blight limits rice production globally. Currently, genome sequences for only a few X. oryzae pv. oryzae isolates are available from India. Based on the next-generation sequencing and single-molecule sequencing in real-time technologies, we present here the complete genome sequence of X. oryzae pv. oryzae race 4, a highly virulent member of the Indian X. oryzae pv. oryzae population that has been extensively used in different research studies. The genome data will contribute to our understanding of X. oryzae pv. oryzae genomic features and pave the way for research on rice-X. oryzae pv. oryzae interactions.

AC4 protein of tomato leaf curl Palampur virus is an RNA silencing suppressor and a pathogenicity determinant.

Plants deploy RNA silencing as a natural defence against invading viruses involving sequence-specific degradation of the viral RNAs. As a counter-defence strategy, viruses encode suppressor proteins that simultaneously target different steps of the silencing machinery. Tomato leaf curl Palampur virus (ToLCPalV) is a bipartite begomovirus in Geminiviridae family. It is responsible for significant reduction in the crop yield and quality. DNA-A of the virus encodes for six proteins whereas DNA-B codes for two proteins. In this study, all viral genes were screened for their role in suppression of green fluorescent protein (GFP) silencing in Nicotiana tabacum cv. Xanthi, employing agrobacterium based co-infiltration assay. The assay identified AC4 as a potential suppressor of RNA silencing. In addition, AC4 expression also suppressed virus-induced gene silencing (VIGS) of the phytoene desaturase (PDS) gene in N. benthamiana. Potato virus X (PVX) mediated transient expression of the AC4 in N. benthamiana showed enhanced symptoms that include downward leaf curling, leaf puckering and tissue necrosis. Further, N. benthamiana lines stably expressing AC4 showed severe developmental abnormalities. Mutational analysis suggested that glycine at 2nd position is essential for AC4 pathogenicity. Collectively, these findings demonstrate the role of ToLCPalV AC4 in viral pathogenesis, disease establishment and suppression of gene silencing.

XopR T3SS-effector of Xanthomonas oryzae pv. oryzae suppresses cell death-mediated plant defense response during bacterial blight development in rice.

Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight disease that limits the rice production globally. The bacterium secretes effector proteins directly into plant cells through a type III secretion system (T3SS). Here, we examined the role of a conserved XopR T3SS-effector in the suppression of host basal defense response. Phylogenetic and sequence analysis showed that XopR is well conserved within Xoo strains but shares varying degree of similarity among the other Xanthomonas species. The expression of XopR was shown to be regulated by hrpX, a key regulator of hrp cluster. For functional analysis we employed two mutant strains of Xoo, one lacks xopR gene and other lacks hrpX gene (making the strain defective in T3SS). Programmed cell death (PCD) events was examined both in rice and tobacco leaves through trypan blue staining method. In XopR expressing tobacco leaves the PCD induction was compromised. We observed higher PCD on rice leaves inoculated with Xoo mutants lacking either xopR or functional T3SS as compared to wild type. Contrary, when xopR gene was complemented in mutated strain the PCD was suppressed which clearly suggests that XopR acts as suppressor of the PCD mediated defense response. The EYFP::XopR fusion protein was shown to be localized to the plasma membrane of Nicotiana benthamiana and onion epidermal cells. Altogether our study leads to the understanding that XopR T3SS-effector is essential for Xoo to suppress PCD, primarily to support the in planta colonization of Xoo during blight pathogenesis.

AV2 protein of tomato leaf curl Palampur virus promotes systemic necrosis in Nicotiana benthamiana and interacts with host Catalase2.

Tomato leaf curl Palampur virus (ToLCPalV) is a whitefly-transmitted, bipartite begomovirus. Here, we demonstrated that ectopic expression of AV2 from a Potato virus X (PVX)-based vector accelerated systemic necrosis and reactive oxygen species (ROS) accumulation in Nicotiana benthamiana. Furthermore, 10 amino acids from N-terminal region of AV2 were found to be associated with the systemic necrosis symptom/phenotype. Mutational studies of ToLCPalV infectious clones lacking the AV2 revealed that AV2 is essential for the systemic movement of DNA-A, symptom severity and viral DNA accumulation. In a yeast two-hybrid assay, Catalase2 (Cat2) was found to associate with AV2 protein. Further, silencing of Cat2 resulted in appearance of necrotic lesions on N. benthamiana and these plants were highly susceptible to ToLCPalV infection in comparison to control plants. Infection ToLCPalV on Solanum lycopersicum resulted in downregulation of Cat2 transcripts, followed by accumulation of ROS and stress marker transcripts. The AV2 protein also suppressed virus-induced gene silencing (VIGS) of the Phytoene desaturase (PDS) gene. Our results show that AV2 is essential for the pathogenicity, systemic movement and suppression of gene silencing in the host. Altogether, our findings suggest that interactions between AV2 and Cat2 might play a crucial role in the establishment of ToLCPalV infection.

Molecular characterization of a new begomovirus infecting Mirabilis jalapa in northern India.

Begomoviruses are whitefly-transmitted single-stranded DNA viruses that are responsible for considerable economic losses. A begomovirus, alphasatellite and betasatellite were characterized in a Mirabilis jalapa plant exhibiting severe leaf curling and mottling symptoms. The complete viral genome shared highest sequence identity of 87% with pedilanthus leaf curl virus (AM712436), reported from Pakistan. Additionally, the viral genome was 84% identical to that of chilli leaf curl India virus (KX951415) and 83% identical to that of tobacco curly shoot virus (GU1999584), which were previously reported to infect M. jalapa in India and China, respectively. Based on the ICTV criterion for begomovirus species demarcation (≥91% sequence identity for the complete genome), the virus represents a new species, for which we propose the name Mirabilis leaf curl virus. The alphasatellite and betasatellite sequences were similar to the corresponding sequences of ageratum yellow vein India alphasatellite (KU852743; 99% identity) and tomato leaf curl Patna betasatellite (HQ180394; 86% identity) sequences, respectively. This report describes a new begomovirus-satellite disease complex in M. jalapa.

Identification of host cellular targets of AC4 and AV2 proteins of tomato leaf curl palampur virus and their sub-cellular localization studies.

Tomato leaf curl palampur virus (ToLCPalV) is a bipartite begomovirus with genome organization typical of old world begomoviruses. It infects commercially important crops and weeds in the Asian subcontinent. Apart from other proteins, the DNA-A of the virus encodes AV2 and AC4 proteins of approximately 13.73 and 6.7 kDa, respectively. In case of other begomoviruses, previous studies have shown the role of AV2 and AC4 proteins in virus movement, pathogenesis and suppression of gene silencing. However, the ToLCPalV proteins are significantly variable in comparison to closest relative and hence there is a need to work out their functions. In this study, we identified 9 cellular proteins of tomato that interact with AV2 and AC4 proteins, through yeast two hybrid screening. Upon sequence analysis, these interactors were identified as cysteine protease, katanin p60 ATPase-containing subunit A-like, guanine deaminase, NADH dehydrogenase (ubiquinone) iron-sulfur protein, glyceraldehyde-3-phosphate dehydrogenase B, 60S acidic ribosomal P0 protein, acyl co-A dehydrogenase IBR3, oxygen-evolving enhancer protein 1 and peroxisomal membrane protein 11D. These proteins play a vital role in protein degradation, plant defense response, microtubule severing, photosynthesis and protein synthesis. The two viral proteins, however, did not interact with each other in yeast. AV2 when fused with GFP under the control of cauliflower mosaic virus 35S promoter was localized in nucleus and cytoplasm. On the other hand, AC4-GFP fusion was localized only in cytoplasm. The outcome of present study will help to elucidate the mechanism of viral pathogenesis. Further functional characterization of identified host proteins will provide an insight into their involvement in disease development.

Molecular identification of Ageratum enation virus, betasatellite and alphasatellite molecules isolated from yellow vein diseased Amaranthus cruentus in India.

Natural occurrence of yellow vein disease on Amaranthus cruentus was observed at Lucknow, India in the year 2008. The causal virus was successfully transmitted through whiteflies (Bemisia tabaci) from diseased A. cruentus to healthy seedlings of A. cruentus and other test species which indicated begomovirus infection. The begomovirus DNA-A, betasatellite, and alphasatellite components associated with yellow vein disease were amplified by rolling circle amplification using Ø-29 DNA polymerase from diseased A. cruentus and characterized by their sequence analyses. The begomovirus DNA-A genome contained six ORFs: AV2 and AV1 in virion sense and AC3, AC2, AC1, and AC4 in complementary sense strand; and a non-translated intergenic region having the conserved geminiviral nonanucleotide sequence. The virus isolate showed 97-99% sequence identities and close phylogenetic relationships with various isolates of Ageratum enation virus (AgEV); therefore, the isolate under study was identified as AgEV. The beta- and alphasatellite molecules were also identified to be associated with the disease based on their high sequence identities and close phylogenetic relationships with the respective molecules reported worldwide. Co-infiltration of agro-infectious clones of AgEV DNA-A and its betasatellite DNA induced leaf curl and enation symptoms after 25-35 days on A. cruentus, Nicotiana benthamiana, and N. glutinosa plants. We report the association of AgEV, betasatellite and alphasatellite components with yellow vein disease of A. cruentus from India.