Isolation, identification, and mechanism analysis of plant growth-promoting rhizobacteria in tobacco.

Plant growth, crop yield, and pest and disease control are enhanced by PGPR (Plant growth promoting rhizobacteria), which are beneficial microorganisms found in a close symbiosis with plant roots. Phytohormones are secreted, nutrient uptake is improved, and soil properties along with the microbiological environment are regulated by these microorganisms, making them a significant focus in agricultural research. In this study, the efficient PGPR strain T1 was isolated and screened from tobacco inter-root soil, and identified and confirmed by ITS sequencing technology. Tobacco growth indicators and soil property changes were observed and recorded through potting experiments. The activities of key enzymes (e.g., sucrase, catalase, urease) in soil were further determined. High-throughput sequencing technology was utilized to sequence the soil microbial community, and combined with macro-genomics analysis, the effects of T1 strain on soil microbial diversity and metabolic pathways were explored. Following the application of T1, significant improvements were observed in the height, leaf length, and width of tobacco plants. Furthermore, the physical and chemical properties of the soil were notably enhanced, including a 26.26% increase in phosphorus availability. Additionally, the activities of key soil enzymes such as sucrase, catalase, and urease were significantly increased, indicating improved soil health and fertility. Comprehensive joint microbiomics and macrogenomics analyses revealed a substantial rise in the populations of beneficial soil microorganisms and an enhancement in metabolic pathways, including amino acid metabolism, synthesis, and production of secondary metabolites. These increase in beneficial microorganisms and the enhancement of their metabolic functions are crucial for plant growth and soil fertility. This study provides valuable references for the development of innovative microbial fertilizers and offers programs for the sustainable development of modern agriculture.

Genome-wide identification and analysis of anthocyanin synthesis-related R2R3-MYB genes in Fragaria pentaphylla.

BACKGROUND: MYB transcription factors regulate anthocyanin biosynthesis across numerous plant species. However, comprehensive genome-wide investigations regarding the R2R3-MYB gene family and its involvement in regulating anthocyanin biosynthesis in the red and white fruit color morphs of Fragaria pentaphylla remain scarce. RESULTS: A total of 101 FpR2R3-MYB genes were identified from the F. pentaphylla genome and were divided into 34 subgroups based on phylogenetic analysis. Gene structure (exon/intron) and protein motifs were particularly conserved among the FpR2R3-MYB genes, especially members within the same subgroup. The FpR2R3-MYB genes were distributed over seven F. pentaphylla chromosomes. Analysis of gene duplication events revealed five pairs of tandem duplication genes and 16 pairs of segmental duplication genes, suggesting that segmental duplications are the major pattern for expansion of the FpR2R3-MYB gene family expansion in F. pentaphylla. Cis-regulatory elements of the FpR2R3-MYB promoters were involved in cellular development, phytohormones, environmental stress and photoresponse. Based on the analysis of the FpR2R3-MYB gene family and transcriptome sequencing (RNA-seq) data, FpMYB9 was identified as a key transcription factor involved in the regulation of anthocyanin synthesis in F. pentaphylla fruits. The expression of FpMYB9 increases significantly during the ripening stage of red fruits, as confirmed by reverse transcription quantitative real-time PCR. In addition, subcellular localization experiments further confirmed the nuclear presence of FpMYB9, supporting its role as a transcription factor involved in anthocyanin biosynthesis. CONCLUSION: Our results showed that the FpR2R3-MYB genes are highly conserved and play important roles in the anthocyanin biosynthesis in F. pentaphylla fruits. Our results also provide a compelling basis for further understanding of the regulatory mechanism underlying the role of FpMYB9 in anthocyanin formation in F. pentaphylla fruits.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

Three RNA helicase DDX genes are essential for the development and oocyte maturation in Laodelphax striatellus.

BACKGROUND: DEAD-box protein (DDX) is a member of the DDX RNA helicase family that exerts multiple functions in RNA metabolism, cell cycle, tumorigenesis, signal pathway, and fertility, particularly in mammals. Nevertheless, the biological functions of DDXs in insects have not been fully resolved and attracted increasing attention these years. Laodelphax striatellus (Hemiptera) is a notorious rice pest through feeding on rice sap and transmitting plant viruses. In this study, we aim to elucidate the functional characterization of DDXs in L. striatellus, and to exploit potential target genes for the development of pest control strategies. RESULTS: In this study, we characterized the expression patterns of LsDDX6, LsDDX47, and LsDDX51 in planthoppers and analyzed their conserved motifs. These genes were found to be expressed in all tissues and developmental stages examined, with significantly higher transcript levels observed in the ovary. Knockdown of LsDDX6, LsDDX47, and LsDDX51 resulted in an obvious lethal phenotype in nymphs and abnormal ovarian development in adults. Furthermore, a total of 27 DDXs were identified in L. striatellus, and most DDXs were highly expressed in ovary and structure analysis result revealed that all of the DDXs possessed nine motifs that were unique to the DDX family. CONCLUSION: The three DDX RNA helicases (LsDDX6, LsDDX47, and LsDDX51) are essential for both survivorship and reproduction in L. striatellus. Considering a total number of 27 DDXs identified in L. striatellus, they might serve as promising candidates for application in RNAi-based control of this destructive pest. © 2024 Society of Chemical Industry.

Parasitic plants regulate C and N distribution among common mycorrhizal networks linking host and neighboring plants.

Common mycorrhizal networks (CMNs) can link multiple plants and distribute nutrients among them. However, how parasitic plants regulate the carbon and nutrient exchange between CMNs and the linked plants is unknown. Thus, we conducted a container experiment with two Trifolium pratense grown in two plastic cores and connected only by CMNs using a 25-µm nylon fabric in each container. Host T. pratense was parasitized or not parasitized by Cuscuta gronovii. CMNs were left intact or broken by rotating the cores with the host or neighboring T. pratense. The dual 15N and 13C labeling method was used to evaluate the N distributed by CMNs to the host and neighboring T. pratense and the recently fixed C from the host and neighboring T. pratense to CMNs. The results showed that CMNs distributed more 15N to unparasitized neighboring T. pratense than the parasitized host T. pratense. Moreover, the unparasitized neighboring T. pratense provides more recently fixed C to CMNs than the parasitized host T. pratense. These results revealed that the parasite regulated C and nutrient exchange between CMNs and the linked plants following the reciprocal rewards rule. Moreover, this study highlights the importance of parasitic plants in the regulation of mutualistic interactions in ecological webs.

Genomic data provides insights into the evolutionary history and adaptive differentiation of two tetraploid strawberries.

Over the decades, evolutionists and ecologists have shown intense interest in the role of polyploidization in plant evolution. Without clear knowledge of the diploid ancestor(s) of polyploids, we would not be able to answer fundamental ecological questions such as the evolution of niche differences between them or its underlying genetic basis. Here, we explored the evolutionary history of two Fragaria tetraploids, Fragaria corymbosa and Fragaria moupinensis. We de novo assembled five genomes including these two tetraploids and three diploid relatives. Based on multiple lines of evidence, we found no evidence of subgenomes in either of the two tetraploids, suggesting autopolyploid origins. We determined that Fragaria chinensis was the diploid ancestor of F. corymbosa while either an extinct species affinitive to F. chinensis or an unsampled population of F. chinensis could be the progenitor of F. moupinensis. Meanwhile, we found introgression signals between F. chinensis and Fragaria pentaphylla, leading to the genomic similarity between these two diploids. Compared to F. chinensis, gene families related to high ultraviolet (UV)-B and DNA repair were expanded, while those that responded towards abiotic and biotic stresses (such as salt stress, wounding, and various pathogens) were contracted in both tetraploids. Furthermore, the two tetraploids tended to down-regulate defense response genes but up-regulate UV-B response, DNA repairing, and cell division gene expression compared to F. chinensis. These findings may reflect adaptions toward high-altitude habitats. In summary, our work provides insights into the genome evolution of wild Fragaria tetraploids and opens up an avenue for future works to answer deeper evolutionary and ecological questions regarding the strawberry genus.

A CD8+ T cell related immune score predicts survival and refines the risk assessment in acute myeloid leukemia.

Although advancements in genomic and epigenetic research have deepened our understanding of acute myeloid leukemia (AML), only one-third of patients can achieve durable remission. Growing evidence suggests that the immune microenvironment in bone marrow influences prognosis and survival in AML. There is a specific association between CD8+ T cells and the prognosis of AML patients. To develop a CD8+ T cell-related immune risk score for AML, we first evaluated the accuracy of CIBERSORTx in predicting the abundance of CD8+ T cells in bulk RNA-seq and found it significantly correlated with observed single-cell RNA sequencing data and the proportions of CD8+ T cells derived from flow cytometry. Next, we constructed the CTCG15, a 15-gene prognostic signature, using univariate and LASSO regression on the differentially expressed genes between CD8+ THigh and CD8+ TLow groups. The CTCG15 was further validated across six datasets in different platforms. The CTCG15 has been shown to be independent of established prognostic markers, and can distill transcriptomic consequences of several genetic abnormalities closely related to prognosis in AML patients. Finally, integrating this model into the 2022 European LeukemiaNet contributed to a higher predictive power for prognosis prediction. Collectively, our study demonstrates that CD8+ T cell-related signature could improve the comprehensive risk stratification and prognosis prediction in AML.

Combination of transcriptomic and proteomic approaches helps unravel the mechanisms of luteolin in inducing liver cancer cell death via targeting AKT1 and SRC.

Introduction: Luteolin, a natural compound commonly used in traditional Chinese medicine, shows clinical potential as an anti-liver cancer agent. The mechanisms underlying the anti-liver cancer effect of luteolin are limited versus those reported for other cancers. Accordingly, this study was conducted to bridge the existing knowledge gap. Methods: Transcriptomic and proteomic analyses of the response of the hepatocellular carcinoma cell line HuH-7 to luteolin were conducted, and a possible pathway was elucidated using confocal laser scanning microscopy (CLSM), flow cytometry, western blotting, qRT-PCR and bio-layer interferometry assay to systematically explore the possible mechanisms underlying the inhibition of the proliferation of liver cancer cells by luteolin. Results and Discussion: Results showed that luteolin significantly inhibited HuH-7 cell proliferation. Transcriptomic and proteomic analyses collectively revealed that luteolin could promote cell cycle arrest and apoptosis in HuH-7 cells through transcription factors p53, nuclear factor kappa B (NF-κB), FOXO, ATF2, and TCF/LEF via AKT1, as well as the KEAP-NRF and SRC-STAT3 pathways. Furthermore, AKT1 and SRC were identified as the 2 targets of luteolin. Nuclear translocation of transcription factors p53 and NF-κB were affected by luteolin administration. Additionally, AKT1 activity affected normal metabolism in HuH-7 cells and resulted in the accumulation of reactive oxygen species, which activated MOMP and further promoted apoptosis. Our results systematically elucidate the mechanism of luteolin in inhibiting the proliferation of liver cancer cells, mainly through cell cycle arrest and apoptosis via targeting AKT1 and SRC.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Genetic Characterization of Two Novel Insect-Infecting Negative-Sense RNA Viruses Identified in a Leaf Beetle, Aulacophora indica.

Herbivorous insects harbor a variety of insect-specific viruses (ISVs) some of which are considered to be valuable biological agents for potential applications in biological defense and control strategies. Leaf beetles with chewing mouthparts are particularly known for their capacity to disrupt plant tissue while feeding, often creating openings that can act as entry points for plant pathogens. In this study, we have identified two new negative-sense RNA viruses infecting the leaf beetle Aulacophora indica, an important member of the Chrysomelidae family. These recently discovered viruses belong to the viral families Nyamiviridae and Chuviridae and have been preliminarily named Aulacophora indica nyami-like virus 1 (AINlV1) and Aulacophora indica chu-like virus 1 (AIClV1), respectively. The complete genomic sequences of these viruses were obtained using rapid amplification of cDNA ends (RACE) techniques. Detailed analysis of their genomic structures has confirmed their similarity to other members within their respective families. Furthermore, analysis of virus-derived small interfering RNA (vsiRNA) demonstrated a high abundance and typical vsiRNA pattern of AINlV1 and AIClV1, offering substantial evidence to support their classification as ISVs. This research enhances our understanding of viral diversity within insects.

Endogenous nege-like viral elements in arthropod genomes reveal virus-host coevolution and ancient history of two plant virus families.

Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.

The plant-sucking insect selects assembly of the gut microbiota from environment to enhance host reproduction.

Plant-sucking insects have intricate associations with a diverse array of microorganisms to facilitate their adaptation to specific ecological niches. The midgut of phytophagous true bugs is generally structured into four distinct compartments to accommodate their microbiota. Nevertheless, there is limited understanding regarding the origins of these gut microbiomes, the mechanisms behind microbial community assembly, and the interactions between gut microbiomes and their insect hosts. In this study, we conducted a comprehensive survey of microbial communities within the midgut compartments of a bean bug Riptortus pedestris, soybean plant, and bulk soil across 12 distinct geographical fields in China, utilizing high-throughput sequencing of the 16 S rRNA gene. Our findings illuminated that gut microbiota of the plant-sucking insects predominantly originated from the surrounding soil environment, and plants also play a subordinate role in mediating microbial acquisition for the insects. Furthermore, our investigation suggested that the composition of the insect gut microbiome was probably shaped by host selection and/or microbe-microbe interactions at the gut compartment level, with marginal influence from soil and geographical factors. Additionally, we had unveiled a noteworthy dynamic in the acquisition of core bacterial taxa, particularly Burkholderia, which were initially sourced from the environment and subsequently enriched within the insect midgut compartments. This bacterial enrichment played a significant role in enhancing insect host reproduction. These findings contribute to our evolving understanding of microbiomes within the insect-plant-soil ecosystem, shedding additional light on the intricate interactions between insects and their microbiomes that underpin the ecological significance of microbial partnerships in host adaptation.

Identification of a novel member of the genus Laulavirus (family Phenuiviridae) from the entomopathogenic ascomycete fungus Cordyceps javanica.

The virus family Phenuiviridae (order Hareavirales, comprising segmented negative-sense single stranded RNA viruses) has highly diverse members that are known to infect animals, plants, protozoans, and fungi. In this study, we identified a novel phenuivirus infecting a strain of the entomopathogenic fungus Cordyceps javanica isolated from a small brown plant hopper (Laodelphax striatellus), and this virus was tentatively named "Cordyceps javanica negative-strand RNA virus 1" (CjNRSV1). The CjNRSV1 genome consists of three negative-sense single stranded RNA segments (RNA1-3) with lengths of 7252, 2401, and 1117 nt, respectively. The 3'- and 5'-terminal regions of the RNA1, 2, and 3 segments have identical sequences, and the termini of the RNA segments are complementary to each other, reflecting a common characteristic of viruses in the order Hareavirales. RNA1 encodes a large protein (∼274 kDa) containing a conserved domain for the bunyavirus RNA-dependent RNA polymerase (RdRP) superfamily, with 57-80% identity to the RdRP encoded by phenuiviruses in the genus Laulavirus. RNA2 encodes a protein (∼79 kDa) showing sequence similarity (47-63% identity) to the movement protein (MP, a plant viral cell-to-cell movement protein)-like protein (MP-L) encoded by RNA2 of laulaviruses. RNA3 encodes a protein (∼28 kDa) with a conserved domain of the phenuivirid nucleocapsid protein superfamily. Phylogenetic analysis using the RdRPs of various phenuiviruses and other unclassified phenuiviruses showed CjNRSV1 to be grouped with established members of the genus Laulavirus. Our results suggest that CjNRSV1 is a novel fungus-infecting member of the genus Laulavirus in the family Phenuiviridae.

Complete genome sequence of a novel amalgavirus in sponge gourd, Luffa cylindrica.

A novel monopartite dsRNA virus, tentatively named "sponge gourd amalgavirus 1" (SGAV1), was discovered by high-throughput sequencing in sponge gourd (Luffa cylindrica) displaying mosaic symptoms in Jiashan County, Zhejiang Province, China. The genome of SGAV1 is 3,447 nucleotides in length and contains partially overlapping open reading frames (ORFs) encoding a putative replication factory matrix-like protein and a fusion protein, respectively. The fusion protein of SGAV1 shares 57.07% identity with the homologous protein of salvia miltiorrhiza amalgavirus 1 (accession no. DAZ91057.1). Phylogenetic analysis based on the RNA-dependent RNA polymerase (RdRp) protein suggests that SGAV1 belongs to the genus Amalgavirus of the family Amalgaviridae. Moreover, analysis of SGAV1-derived small interfering RNAs indicated that SGAV1 was actively replicating in the host plant. Semi-quantitative RT-PCR showed higher levels of SGAV1 expression in leaves than in flowers and fruits. This is the first report of a novel amalgavirus found in sponge gourd in China.

Diversifying the anthracycline class of anti-cancer drugs identifies aclarubicin for superior survival of acute myeloid leukemia patients.

The efficacy of anthracycline-based chemotherapeutics, which include doxorubicin and its structural relatives daunorubicin and idarubicin, remains almost unmatched in oncology, despite a side effect profile including cumulative dose-dependent cardiotoxicity, therapy-related malignancies and infertility. Detoxifying anthracyclines while preserving their anti-neoplastic effects is arguably a major unmet need in modern oncology, as cardiovascular complications that limit anti-cancer treatment are a leading cause of morbidity and mortality among the 17 million cancer survivors in the U.S. In this study, we examined different clinically relevant anthracycline drugs for a series of features including mode of action (chromatin and DNA damage), bio-distribution, anti-tumor efficacy and cardiotoxicity in pre-clinical models and patients. The different anthracycline drugs have surprisingly individual efficacy and toxicity profiles. In particular, aclarubicin stands out in pre-clinical models and clinical studies, as it potently kills cancer cells, lacks cardiotoxicity, and can be safely administered even after the maximum cumulative dose of either doxorubicin or idarubicin has been reached. Retrospective analysis of aclarubicin used as second-line treatment for relapsed/refractory AML patients showed survival effects similar to its use in first line, leading to a notable 23% increase in 5-year overall survival compared to other intensive chemotherapies. Considering individual anthracyclines as distinct entities unveils new treatment options, such as the identification of aclarubicin, which significantly improves the survival outcomes of AML patients while mitigating the treatment-limiting side-effects. Building upon these findings, an international multicenter Phase III prospective study is prepared, to integrate aclarubicin into the treatment of relapsed/refractory AML patients.

Ivosidenib in Chinese patients with relapsed or refractory isocitrate dehydrogenase 1 mutated acute myeloid leukemia: a registry study.

Ivosidenib, an isocitrate dehydrogenase 1 (IDH1) inhibitor, has demonstrated clinical benefits in a pivotal study (AG120-C-001) in patients with IDH1-mutated (mIDH1) acute myeloid leukemia (AML). A registry study (CS3010-101: NCT04176393) was conducted to assess the pharmacokinetic (PK) characteristics, safety, and efficacy of ivosidenib in Chinese patients with relapsed or refractory (R/R) mIDH1 AML. Patients received ivosidenib 500 mg once daily for 28-day cycles until disease progression. Ten subjects underwent intensive PK/progressive disease (PD) assessments. All subjects had the clinical response assessed at screening, every 28 days through month 12, and then every 56 days. Between November 12, 2019, and April 2, 2021, 30 patients were enrolled; 26 (86.7%) had de novo AML and 18 (60.0%) were transfusion-dependent at baseline. Following single and repeated doses of ivosidenib, median time to maximum plasma concentration (T max) was 4.0 and 2.0 hours, respectively. The inter-individual variability of pharmacokinetic exposure was moderate to high (coefficient of variation [CV], 25%-53%). No obvious accumulation was observed after repeated doses at cycle 2 day 1. Regarding the clinical response, the CR + CRh rate was 36.7% (95% confidence interval [CI]: 19.9%-56.1%), the median duration of CR + CRh was 19.7 months (95% CI: 2.9 months-not reached [NR]), and median duration of response (DoR) was 14.3 months (95% CI: 6.4 months-NR). Consistent clinical benefits and safety of ivosidenib were consistently observed at the final data cutoff with median follow-up time 26.0 months, as compared with primary data cutoff, and the data from Chinese R/R mIDH1 AML patients were also consistent with results from pivotal study.

Discovery of Two Novel Viruses of the Willow-Carrot Aphid, Cavariella aegopodii.

The advancement of bioinformatics and sequencing technology has resulted in the identification of an increasing number of new RNA viruses. This study systematically identified the RNA virome of the willow-carrot aphid, Cavariella aegopodii (Hemiptera: Aphididae), using metagenomic sequencing and rapid amplification of cDNA ends (RACE) approaches. C. aegopodii is a sap-sucking insect widely distributed in Europe, Asia, North America, and Australia. The deleterious effects of C. aegopodii on crop growth primarily stem from its feeding activities and its role as a vector for transmitting plant viruses. The virome includes Cavariella aegopodii virga-like virus 1 (CAVLV1) and Cavariella aegopodii iflavirus 1 (CAIV1). Furthermore, the complete genome sequence of CAVLV1 was obtained. Phylogenetically, CAVLV1 is associated with an unclassified branch of the Virgaviridae family and is susceptible to host antiviral RNA interference (RNAi), resulting in the accumulation of a significant number of 22nt virus-derived small interfering RNAs (vsiRNAs). CAIV1, on the other hand, belongs to the Iflaviridae family, with vsiRNAs ranging from 18 to 22 nt. Our findings present a comprehensive analysis of the RNA virome of C. aegopodii for the first time, offering insights that could potentially aid in the future control of the willow-carrot aphid.

Identification and Characterization of Three Novel Solemo-like Viruses in the White-Backed Planthopper, Sogatella furcifera.

Agricultural insects play a crucial role in transmitting plant viruses and host a considerable number of insect-specific viruses (ISVs). Among these insects, the white-backed planthoppers (WBPH; Sogatella furcifera, Hemiptera: Delphacidae) are noteworthy rice pests and are responsible for disseminating the southern rice black-streaked dwarf virus (SRBSDV), a significant rice virus. In this study, we analyzed WBPH transcriptome data from public sources and identified three novel viruses. These newly discovered viruses belong to the plant-associated viral family Solemoviridae and were tentatively named Sogatella furcifera solemo-like virus 1-3 (SFSolV1-3). Among them, SFSolV1 exhibited a prevalent existence in different laboratory populations, and its complete genome sequence was obtained using rapid amplification of cDNA ends (RACE) approaches. To investigate the antiviral RNA interference (RNAi) response in WBPH, we conducted an analysis of virus-derived small interfering RNAs (vsiRNAs). The vsiRNAs of SFSolV1 and -2 exhibited typical patterns associated with the host's siRNA-mediated antiviral immunity, with a preference for 21- and 22-nt vsiRNAs derived equally from both the sense and antisense genomic strands. Furthermore, we examined SFSolV1 infection and distribution in WBPH, revealing a significantly higher viral load of SFSolV1 in nymphs' hemolymph compared to other tissues. Additionally, in adult insects, SFSolV1 exhibited higher abundance in male adults than in female adults.

Complete genome sequence and genetic characterization of a novel segmented RNA virus infecting Nilaparvata lugens.

The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.

Response Mechanism of cbbM Carbon Sequestration Microbial Community Characteristics in Different Wetland Types in Qinghai Lake.

Carbon-sequestering microorganisms play an important role in the carbon cycle of wetland ecosystems. However, the response mechanism of carbon-sequestering microbial communities to wetland type changes and their relationship with soil carbon remain unclear. To explore these differences and identify the main influencing factors, this study selected marsh wetlands, river wetlands and lakeside wetlands around Qinghai Lake as research subjects. High-throughput sequencing was employed to analyze the functional gene cbbM of carbon-sequestering microorganisms. The results revealed that the alpha diversity of cbbM carbon-sequestering microorganisms mirrored the trend in total carbon content, with the highest diversity observed in marsh wetlands and the lowest in lakeside wetlands. The dominant bacterial phylum was Proteobacteria, with prevalent genera including Thiothrix, Acidithiobacillus, and Thiodictyon. Acidithiobacillus served as a biomarker in lakeside wetlands, while two other genera were indicative of marsh wetlands. The hierarchical partitioning analysis indicated that the diversity of cbbM carbon-fixing microorganisms was primarily influenced by the total nitrogen content, while the community structure was significantly affected by the soil total carbon content. Moreover, an increased soil temperature and humidity were found to favor the carbon fixation processes of Thiomicrospira, Thiomonas, Polaromonas, and Acidithiobacillus. In summary, changes in wetland types seriously affected the characteristics of cbbM carbon sequestration in microbial communities, and a warm and humid climate may be conducive to wetland carbon sequestration.