RESUMEN
Our study aimed to construct a predictive model for identifying instances of futile recanalization in patients with anterior circulation occlusion acute ischemic stroke (AIS) who achieved complete reperfusion following endovascular therapy. We included 173 AIS patients who attained complete reperfusion, as indicated by a Modified Thrombolysis in Cerebral Infarction (mTICI) scale score of 3. Our approach involved a thorough analysis of clinical factors, imaging biomarkers, and potential no-reflow biomarkers through both univariate and multivariate analyses to identify predictors of futile recanalization. The comprehensive model includes clinical factors such as age, presence of diabetes, admission NIHSS score, and the number of stent retriever passes; imaging biomarkers like poor collaterals; and potential no-reflow biomarkers, notably disrupted blood-brain barrier (OR 4.321, 95% CI 1.794-10.405; p = 0.001), neutrophil-to-lymphocyte ratio (NLR; OR 1.095, 95% CI 1.009-1.188; p = 0.030), and D-dimer (OR 1.134, 95% CI 1.017-1.266; p = 0.024). The model demonstrated high predictive accuracy, with a C-index of 0.901 (95% CI 0.855-0.947) and 0.911 (95% CI 0.863-0.954) in the original and bootstrapping validation samples, respectively. Notably, the comprehensive model showed significantly improved predictive performance over models that did not include no-reflow biomarkers, evidenced by an integrated discrimination improvement of 8.86% (95% CI 4.34%-13.39%; p < 0.001) and a categorized reclassification improvement of 18.38% (95% CI 3.53%-33.23%; p = 0.015). This model, which leverages the potential of no-reflow biomarkers, could be especially beneficial in healthcare settings with limited resources. It provides a valuable tool for predicting futile recanalization, thereby informing clinical decision-making. Future research could explore further refinements to this model and its application in diverse clinical settings.
RESUMEN
Caries is a destructive condition caused by bacterial infection that affects the hard tissues of the teeth, significantly reducing the quality of life for individuals. Photothermal therapy (PTT) offers a noninvasive and painless treatment for caries, but the use of unsafe laser irradiance limits its application. To address this challenge, we prepared nanoparticles of silver ion-doped Prussian blue (AgPB), which was encased within cationic guar gum (CG) to form the antibacterial PTT hydrogel CG-AgPB with a photothermal conversion efficiency of 34.4%. When exposed to an 808 nm laser at a power density of 0.4 W/cm2, the hydrogel readily reached a temperature of over 50 °C in just 3 min, synchronized by the discharge of Ag+ ions from the interstitial sites of AgPB crystals, resulting in broad-spectrum and synergistic antibacterial activities (>99%) against individual oral pathogens (Streptococcus sanguinis, Streptococcus mutans, and Streptococcus sobrinus) and pathogen-induced biofilms. In vivo, CG-AgPB-mediated PTT demonstrated a capability to profoundly reduce the terminal number of cariogenic bacteria to below 1% in a rat model of caries. Given the outstanding biocompatibility, injectability, and flushability, this CG-AgPB hydrogel may hold promise as a next-generation oral hygiene adjunct for caries management in a clinical setting.
RESUMEN
Perioperative neurocognitive disorders (PND) are cognitive dysfunctions that usually occur in elderly patients after anesthesia and surgery. Microglial overactivation is a key underlying mechanism. Interleukin-33 (IL-33) is a member of the IL-1 family that orchestrates microglial function. In the present study, we explored how IL-33, which regulates microglia, contributes to cognitive improvement in a male mouse model of PND. An exploratory laparotomy was performed to establish a PND model. The expression levels of IL-33 and its receptor ST2 were evaluated using Western blot. IL-33/ST2 secretion, microglial density, morphology, phagocytosis of synapse, and proliferation, and dystrophic microglia were assessed using immunofluorescence. Synaptic plasticity was measured using Golgi staining and long-term potentiation. The Morris water maze and open field test were used to evaluate cognitive function and anxiety. Hippocampal expression of IL-33 and ST2 were elevated on postoperative day 3. We confirmed that IL-33 was secreted by astrocytes and neurons, whereas ST2 mainly colocalized with microglia. IL-33 treatment induced microgliosis after anesthesia and surgery. These microglia had larger soma sizes and shorter and fragmented branches. Compared to the Surgery group, IL-33 treatment reduced the synaptic phagocytosis of microglia and increased microglial proliferation and dystrophic microglia. IL-33 treatment also reversed the impaired synaptic plasticity and cognitive function caused by anesthesia and surgery. In conclusion, these results indicate that IL-33 plays a key role in regulating microglial state and synaptic phagocytosis in a PND mouse model. IL-33 treatment has a therapeutic potential for improving cognitive dysfunction in PND.
Asunto(s)
Interleucina-33 , Ratones Endogámicos C57BL , Microglía , Animales , Microglía/efectos de los fármacos , Microglía/metabolismo , Interleucina-33/metabolismo , Masculino , Ratones , Plasticidad Neuronal/efectos de los fármacos , Hipocampo/metabolismo , Hipocampo/efectos de los fármacos , Hipocampo/patología , Proteína 1 Similar al Receptor de Interleucina-1/metabolismo , Aprendizaje por Laberinto/efectos de los fármacos , Aprendizaje por Laberinto/fisiología , Complicaciones Cognitivas Postoperatorias/metabolismo , Fagocitosis/efectos de los fármacos , Astrocitos/metabolismo , Astrocitos/efectos de los fármacos , Trastornos Neurocognitivos/metabolismo , Trastornos Neurocognitivos/tratamiento farmacológico , Modelos Animales de Enfermedad , Neuronas/efectos de los fármacos , Neuronas/metabolismoRESUMEN
In order to improve the energy conversion efficiency and power density of the tritium-powered betavoltaic battery, titanium was deposited on the inner surface of the deep porous three-dimensional structure semiconductor as a tritium absorption material. Therefore, magnetron sputtering technology was used to explore the parameters of titanium coating on the inner surface of a deep porous semiconductor. First, the effects of argon pressure and sputtering power on the properties of titanium films were studied. The properties of the titanium films were characterized by a scanning electron microscope and an atomic force microscope. The optimized sputtering parameters were obtained as follows: argon pressure of 0.5 Pa and sputtering power of 80 W. Based on this parameter, the background vacuum and coating angle were changed, and the titanium film was coated in the deep porous structure. Energy dispersive spectrometry line scan and surface scan were used to analyze the coating results, which showed that these two parameters directly affected the content of titanium in the channel, and the area of titanium in the channel structure accounted for more than 50% under each test condition.
RESUMEN
Recent advancements for simultaneously profiling multi-omics modalities within individual cells have enabled the interrogation of cellular heterogeneity and molecular hierarchy. However, technical limitations lead to highly noisy multi-modal data and substantial costs. Although computational methods have been proposed to translate single-cell data across modalities, broad applications of the methods still remain impeded by formidable challenges. Here, we propose scButterfly, a versatile single-cell cross-modality translation method based on dual-aligned variational autoencoders and data augmentation schemes. With comprehensive experiments on multiple datasets, we provide compelling evidence of scButterfly's superiority over baseline methods in preserving cellular heterogeneity while translating datasets of various contexts and in revealing cell type-specific biological insights. Besides, we demonstrate the extensive applications of scButterfly for integrative multi-omics analysis of single-modality data, data enhancement of poor-quality single-cell multi-omics, and automatic cell type annotation of scATAC-seq data. Moreover, scButterfly can be generalized to unpaired data training, perturbation-response analysis, and consecutive translation.
RESUMEN
Importance: Evidence supports using antiplatelet therapy in patients with acute ischemic stroke. However, neurological deterioration remains common under the currently recommended antiplatelet regimen, leading to poor clinical outcomes. Objective: To determine whether intravenous tirofiban administered within 24 hours of stroke onset prevents early neurological deterioration in patients with acute noncardioembolic stroke compared with oral aspirin. Design, Setting, and Participants: This investigator-initiated, multicenter, open-label, randomized clinical trial with blinded end-point assessment was conducted at 10 comprehensive stroke centers in China between September 2020 and March 2023. Eligible patients were aged 18 to 80 years with acute noncardioembolic stroke within 24 hours of onset and had a National Institutes of Health Stroke Scale (NIHSS) score of 4 to 20. Intervention: Patients were assigned randomly (1:1) to receive intravenous tirofiban or oral aspirin for 72 hours using a central, web-based, computer-generated randomization schedule; all patients then received oral aspirin. Main Outcome: The primary efficacy outcome was early neurological deterioration (increase in NIHSS score ≥4 points) within 72 hours after randomization. The primary safety outcome was symptomatic intracerebral hemorrhage within 72 hours after randomization. Results: A total of 425 patients were included in the intravenous tirofiban (n = 213) or oral aspirin (n = 212) groups. Median (IQR) age was 64.0 years (56.0-71.0); 124 patients (29.2%) were female, and 301 (70.8%) were male. Early neurological deterioration occurred in 9 patients (4.2%) in the tirofiban group and 28 patients (13.2%) in the aspirin group (adjusted relative risk, 0.32; 95% CI, 0.16-0.65; P = .002). No patients in the tirofiban group experienced intracerebral hemorrhage. At 90-day follow-up, 3 patients (1.3%) in the tirofiban group and 3 (1.5%) in the aspirin group died (adjusted RR, 1.15; 95% CI, 0.27-8.54; P = .63), and the median (IQR) modified Rankin scale scores were 1.0 (0-1.25) and 1.0 (0-2), respectively (adjusted odds ratio, 1.28; 95% CI, 0.90-1.83; P = .17). Conclusions and Relevance: In patients with noncardioembolic stroke who were seen within 24 hours of symptom onset, tirofiban decreased the risk of early neurological deterioration but did not increase the risk of symptomatic intracerebral hemorrhage or systematic bleeding. Trial Registration: ClinicalTrials.gov Identifier: NCT04491695.
RESUMEN
SUMMARY: Recent technical advancements in single-cell chromatin accessibility sequencing (scCAS) have brought new insights to the characterization of epigenetic heterogeneity. As single-cell genomics experiments scale up to hundreds of thousands of cells, the demand for computational resources for downstream analysis grows intractably large and exceeds the capabilities of most researchers. Here, we propose EpiCarousel, a tailored Python package based on lazy loading, parallel processing, and community detection for memory- and time-efficient identification of metacells, i.e. the emergence of homogenous cells, in large-scale scCAS data. Through comprehensive experiments on five datasets of various protocols, sample sizes, dimensions, number of cell types, and degrees of cell-type imbalance, EpiCarousel outperformed baseline methods in systematic evaluation of memory usage, computational time, and multiple downstream analyses including cell type identification. Moreover, EpiCarousel executes preprocessing and downstream cell clustering on the atlas-level dataset with 707 043 cells and 1 154 611 peaks within 2 h consuming <75 GB of RAM and provides superior performance for characterizing cell heterogeneity than state-of-the-art methods. AVAILABILITY AND IMPLEMENTATION: The EpiCarousel software is well-documented and freely available at https://github.com/biox-nku/epicarousel. It can be seamlessly interoperated with extensive scCAS analysis toolkits.
Asunto(s)
Cromatina , Análisis de la Célula Individual , Programas Informáticos , Cromatina/metabolismo , Análisis de la Célula Individual/métodos , Humanos , Genómica/métodos , Biología Computacional/métodosRESUMEN
Patients with symptomatic intracranial arterial stenosis (sICAS) suffer embarrassed hemodynamic status and acute ischemic stroke (AIS) recurrence. We aimed to assess the efficacy of remote ischemic conditioning (RIC) on improving this status by evaluating cerebral blood flow (CBF) and cerebral glucose metabolism (CGM) via PET/CT. Adult patients with unilateral sICAS in middle cerebral artery and/or intracranial segment of internal carotid artery-related AIS or transient ischemic attack within 6 months prior to randomization were enrolled. Individuals who received intravenous thrombolysis or endovascular treatment, or sICAS caused by cardiac embolism, small vessel occlusion, or other determined causes were excluded. Twenty-three eligible patients were randomly assigned to standard medical treatment (SMT) (n = 10) or RIC group (n = 13). The RIC protocol consisted of 5 cycles, each for 5-min bilateral upper limb ischemia and 5-min reperfusion period, twice a day, with a total duration of 3 months. Ten healthy volunteers were enrolled as healthy control group. We tested CBF and CGM at the rest stage and the methazolamide-induced stress stage. All patients received PET/CT at baseline and three-month followup. Both CBF and CGM in ipsilateral hemisphere of sICAS patients were significantly decreased at the rest stage and the stress stage (p < .05), which were improved by three-month RIC (p < .05). The lesions decreased notably in RIC group compared to SMT group (p < .05). RIC ameliorated the hemodynamic status and glucose metabolism in regions at high risk of infarction, which might improve the resistance capacity towards ischemic load in sICAS patients.
Asunto(s)
Arteriosclerosis Intracraneal , Accidente Cerebrovascular Isquémico , Adulto , Humanos , Tomografía Computarizada por Tomografía de Emisión de Positrones , Arteriosclerosis Intracraneal/diagnóstico por imagen , Arteriosclerosis Intracraneal/terapia , Isquemia , Hemodinámica , GlucosaRESUMEN
AIM: To explore the neuroprotective effects of ARA290 and the role of ß-common receptor (ßCR) in a mouse model of middle cerebral artery occlusion (MCAO). METHODS: This study included male C57BL/6J mice that underwent MCAO and reperfusion. The neuroprotective effect of ARA290 on MCAO-induced brain injury was investigated using neurological function tests (Longa and modified neurological severity score). Cerebral infarction was examined by 2, 3, 5-triphenyl tetrazolium chloride staining, neuronal apoptosis was assessed by immunofluorescence staining, blood parameters were measured using a flow cytometry-based automated hematology analyzer, liquid chromatography with tandem mass spectrometry was used to identify the serum metabolomics signature, inflammatory cytokines and liver index were detected by commercially available kits, and the protein levels of the erythropoietin (EPO) receptor and ßCR were measured by western blot. RESULTS: ARA290 exerted a qualitatively similar neuroprotective effect after MCAO as EPO. ARA290 significantly reduced neuronal apoptosis and the level of inflammatory cytokines in the brain tissue. However, ARA290's neuroprotective effect was significantly suppressed following the injection of siRNA against ßCR. CONCLUSION: ARA290 provided a neuroprotective effect via ßCR in cerebral ischemic mice without causing erythropoiesis. This study provides novel insights into the role of ARA290 in ischemic stroke intervention.
Asunto(s)
Isquemia Encefálica , Eritropoyetina , Accidente Cerebrovascular Isquémico , Fármacos Neuroprotectores , Oligopéptidos , Daño por Reperfusión , Accidente Cerebrovascular , Ratones , Masculino , Animales , Fármacos Neuroprotectores/farmacología , Fármacos Neuroprotectores/uso terapéutico , Ratones Endogámicos C57BL , Eritropoyetina/uso terapéutico , Accidente Cerebrovascular/tratamiento farmacológico , Accidente Cerebrovascular/genética , Péptidos , Infarto de la Arteria Cerebral Media/tratamiento farmacológico , Citocinas , Encéfalo , Isquemia Encefálica/tratamiento farmacológicoRESUMEN
Background: Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent malignant cancer worldwide. The cysteine X cysteine (CXC) chemokine family contains 17 members, which are reportedly crucial for the growth, invasion, metastasis, and microenvironment of tumor cells. Although the precise functions of CXC ligands (CXCLs) in HNSCC are unclear, these proteins may play important roles in controlling tumor growth and forming the tumor immune environment. Methods: We downloaded the RNA sequencing and matched clinicopathological data of 379 patients with HNSCC as the training set from The Cancer Genome Atlas and two datasets from the Gene Expression Omnibus for use as validation sets. Results: Through consensus clustering, we identified two subtypes of HNSCC associated with the CXCL family, named cluster1 and cluster2. Patients with the cluster1 subtype showed favourable clinical outcomes, significant immune cell infiltration, and improved immune response signalling pathway modulation. We also developed a nomogram of CXCL family scores for therapeutic use and for predicting the overall survival (OS) of patients with HNSCC. Patients with lower scores showed longer OS and higher immune cell infiltration in their tissues. Conclusions: We developed a new classification method for HNSCC using the CXCL gene family, which can be used clinically to evaluate the prognosis and response to immunotherapy in patients with HNSCC.
RESUMEN
In the field of stroke thrombectomy, ineffective clinical and angiographic reperfusion after successful recanalization has drawn attention. Partial or complete microcirculatory reperfusion failure after the achievement of full patency of a former obstructed large vessel, known as the "no-reflow phenomenon" or "microvascular obstruction," was first reported in the 1960s and was later detected in both experimental models and patients with stroke. The no-reflow phenomenon (NRP) was reported to result from intraluminal occlusions formed by blood components and extraluminal constriction exerted by the surrounding structures of the vessel wall. More recently, an emerging number of clinical studies have estimated the prevalence of the NRP in stroke patients following reperfusion therapy, ranging from 3.3% to 63% depending on its evaluation methods or study population. Studies also demonstrated its detrimental effects on infarction progress and neurological outcomes. In this review, we discuss the research advances, underlying pathogenesis, diagnostic techniques, and management approaches concerning the no-reflow phenomenon in the stroke population to provide a comprehensive understanding of this phenomenon and offer references for future investigations.
Asunto(s)
Fenómeno de no Reflujo , Accidente Cerebrovascular , Humanos , Fenómeno de no Reflujo/diagnóstico por imagen , Fenómeno de no Reflujo/etiología , Fenómeno de no Reflujo/terapia , Microcirculación , Accidente Cerebrovascular/terapia , Accidente Cerebrovascular/tratamiento farmacológico , Trombectomía , Reperfusión , Resultado del TratamientoRESUMEN
Single-cell chromatin accessibility sequencing (scCAS) has emerged as a valuable tool for interrogating and elucidating epigenomic heterogeneity and gene regulation. However, scCAS data inherently suffers from limitations such as high sparsity and dimensionality, which pose significant challenges for downstream analyses. Although several methods are proposed to enhance scCAS data, there are still challenges and limitations that hinder the effectiveness of these methods. Here, we propose scCASE, a scCAS data enhancement method based on non-negative matrix factorization which incorporates an iteratively updating cell-to-cell similarity matrix. Through comprehensive experiments on multiple datasets, we demonstrate the advantages of scCASE over existing methods for scCAS data enhancement. The interpretable cell type-specific peaks identified by scCASE can provide valuable biological insights into cell subpopulations. Moreover, to leverage the large compendia of available omics data as a reference, we further expand scCASE to scCASER, which enables the incorporation of external reference data to improve enhancement performance.
Asunto(s)
Algoritmos , Cromatina , Cromatina/genética , Epigenómica/métodos , Regulación de la Expresión Génica , Análisis de la Célula IndividualRESUMEN
Enhancement of vascular remodeling in affected brain tissue is a novel therapy for acute ischemic stroke (AIS). However, conclusions regarding angiogenesis after AIS remain ambiguous. Vascular endothelial growth factor A (VEGFA) and VEGF receptor 2 (VEGFR2) are potent regulators of angiogenesis and vascular permeability. We aimed to investigate the association between VEGFA/VEGFR2 expression in the acute stage of stroke and prognosis of patients with AIS. We enrolled 120 patients with AIS within 24 h of stroke onset and 26 healthy controls. Plasma levels of VEGFA and VEGFR2 were measured by enzyme-linked immunosorbent assay (ELISA). The primary endpoint was an unfavorable outcome defined as a modified Rankin Scale (mRS) score > 2 at 3 months after AIS. Univariate and multivariate logistic regression analyses were used to identify risk factors affecting prognosis. Plasma VEGFA and VEGFR2 were significantly higher in patients with AIS than in health controls, and also significantly higher in patients with unfavorable than those with favorable outcomes. Moreover, both VEGFA and VEGFR2 showed a significantly positive correlation with mRS at 3 months. Univariate and multivariate analyses showed VEGFA and VEGFR2 remained associated with unfavorable outcomes, and adding VEGFA and VEGFR2 to the clinical model significantly improved risk reclassification (continuous net reclassification improvement, 105.71%; integrated discrimination improvement, 23.45%). The new risk model curve exhibited a good fit with an area under the receiver operating characteristic curve (ROC) curve of 0.9166 (0.8658-0.9674). Plasma VEGFA and VEGFR2 are potential markers for predicting prognosis; thus these two plasma biomarkers may improve risk stratification in patients with AIS.
RESUMEN
This study aimed to investigate the impact of abdominal aortic occlusion (AAO)- induced injury on the kidney, lower limb muscles, heart, and brain in mice, and the potential protective effects of hypoxic postconditioning (HyC). The experimental design employed an abdominal aortic occlusion (AAO) model, and involved three groups of mice: sham, AAO, and AAO+HyC. Ten minutes after the AAO model, mice were subjected to hypoxic treatment lowering oxygen concentration to 5% within 45 minutes, and then returned to a normal oxygen environment. Hematoxylin- eosin (HE) stain was used for Histopathological examinations, and Quantibody Mouse Array was used for detecting apoptosis and inflammation-related protein expression. Histopathological examinations showed that HyC mitigated pathological damage to proximal organs (kidneys and lower limb muscles), distal organs (heart and brain), and reduced inflammatory cell infiltration. Expression of apoptosis- and inflammation-related proteins in brain and heart tissues were also evaluated. HyC significantly increased cellular inhibitor of apoptosis 2 (cIAP2) in the brain and Bcl-2 and insulin-like growth factor 2 (IGF-2) in the heart. Additionally, HyC regulated the expression of several inflammation-related factors in both brain and heart tissues. Although further investigation is needed, particularly in human subjects, this study highlights the potential of HyC as a promising therapeutic strategy for reducing AAO-associated organ damage.
RESUMEN
Objective: This study aimed to explore the impact of late night shift work on the functional outcomes of patients with acute ischemic stroke (AIS) treated with endovascular thrombectomy (EVT). Methods: Consecutive AIS patients who underwent EVT between June 2019 and June 2021 were enrolled and divided into non-night shift work and night shift work groups based on their occupational histories. The primary outcome was the modified Rankin Scale score defined 3-month functional outcome. The secondary outcomes were 3-month mortality, symptomatic intracerebral hemorrhage (sICH), ICH and early recanalization. Results: A total of 285 patients were enrolled, 35 patients (12.3%) were night shift workers, who were younger (P < 0.001) and had a significantly higher prevalence of smoking (P < 0.001), hyperlipidemia (P = 0.002), coronary heart disease (P = 0.031), and atrial fibrillation (P < 0.001). The 3-month favorable outcomes were achieved in 44.8% and 25.7% of patients in the non-night shift work and night shift work groups, respectively (adjusted odds ratio [OR]: 0.24, 95% CI: 0.10-0.57; adjusted P = 0.001). No difference was found in 3-month mortality (adjusted OR: 0.43; 95% CI: 0.14-1.25, adjusted P = 0.121), rates of ICH (adjusted OR: 0.73; 95% CI: 0.33-1.60; adjusted P = 0.430), sICH (adjusted OR: 0.75; 95% CI: 0.34-1.67; adjusted P = 0.487), or early successful recanalization (adjusted OR: 0.42; 95% CI: 0.12-1.56; adjusted P = 0.197). These results were consistent after PSM analysis. Conclusion: Our findings suggest that late night shift work is significantly associated with unfavorable outcomes in patients with AIS after EVT.
RESUMEN
As one of the most abundant natural polysaccharides that possess good biological activity, chitosan is extracted from chitin. Its application in the food field is being increasingly valued. However, chitosan extraction is difficult, and its poor solubility limits its application. At present, the extraction methods include the acid-base method, new chemical methods, and biological methods. The extraction rates of chitin/chitosan are 4-55%, 13-14%, and 15-28%, respectively. Different chemical modifications have different effects on chitosan, making it applicable in different fields. This article reviews and compares the extraction and chemical modification methods of chitosan, emphasizing the importance of green extraction methods. Finally, the application prospects of chitosan in the food industry are discussed. This will promote the understanding of the advantages and disadvantages of different extraction methods for chitosan as well as the relationship between modification and application, providing valuable insights for the future development of chitosan.
RESUMEN
BACKGROUND: Acute ischemic stroke (AIS) complicating an acute myocardial infarction (AMI) is not uncommon, but can severely worsen the clinical prognosis. This study aimed to investigate whether remote ischemic conditioning (RIC) could provide clinical benefits to patients with AIS complicating AMI. METHODS: Subjects with AIS complicating AMI were recruited in this double-blind, randomized, controlled trial; assigned to the RIC and sham groups; and respectively underwent twice daily RIC and sham RIC for 2 weeks. All subjects received standard medical therapy. The primary endpoint was the rate of major adverse cardiac and cerebrovascular events (MACCEs) within 3 months after enrollment. MACCEs comprise of death from all causes, unstable anginas, AMI, acute ischemic strokes, and transient ischemic attacks. RESULTS: Eighty subjects were randomly assigned; 37 patients in the RIC group and 40 patients in the sham-RIC group completed the 3-month follow-up and were included in the final analysis. Both RIC and sham RIC procedures were well tolerated. At 3-month follow-up, 11 subjects (29.7%) in the RIC group experienced MACCEs compared to 21 (52.5%) in the sham group (hazard ratio [HR], 0.396; 95% confidence interval, 0.187-0.838; adjusted p < 0.05). Six subjects (16.2%) in the RIC group had died at the 3-month follow up, significantly lower than the 15 (37.5%) deaths in the sham group (adjusted HR 0.333; 95% CI 0.126-0.881; p = 0.027). Seventeen subjects (45.9%) in the RIC group and 6 subjects (15.0%) in the sham group achieved functional independence (mRS score ≤ 2) at 3-month follow-up (adjusted OR 12.75; 95% CI 2.104-77.21; p = 0.006). CONCLUSIONS: Among patients with acute ischemic stroke complicating acute myocardial infarction, treatment with remote ischemic conditioning decreased the major adverse cardiac and cerebrovascular events and improved functional outcomes at 90 days. TRIAL REGISTRATION: URL: www. CLINICALTRIALS: gov . Unique identifier: NCT03868007. Registered 8 March 2019.
Asunto(s)
Accidente Cerebrovascular Isquémico , Infarto del Miocardio , Accidente Cerebrovascular , Humanos , Infarto del Miocardio/complicaciones , Infarto del Miocardio/terapia , Método Doble Ciego , Resultado del Tratamiento , Accidente Cerebrovascular/complicaciones , Accidente Cerebrovascular/terapiaRESUMEN
Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have reexamined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'AGACCATGTGGACCTGTCACTG3', and reverse, 5'GTTTGGAGTGGTAGAAATCTGTC3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'GAGGCAAAAGTCCTGTGTTCCAACT3', and reverse, 5'AAGAAATCCCTGTGGTTGCAGCAGCT3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of antiGAPDH antibodies was incorrectly stated as AbMart Biotech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 10331042, 2019; DOI: 10.3892/ijo.2019.4679].