RESUMEN
Background: Radiotherapy (RT) is the primary treatment for diffuse midline glioma (DMG), a lethal pediatric malignancy defined by histone H3 lysine 27-to-methionine (H3K27M) mutation. Based on the loss of H3K27 trimethylation producing broad epigenomic alterations, we hypothesized that H3K27M causes a functional double-strand break (DSB) repair defect that could be leveraged therapeutically with PARP inhibitor and RT for selective radiosensitization and antitumor immune responses. Methods: H3K27M isogenic DMG cells and orthotopic brainstem DMG tumors in immune deficient and syngeneic, immune competent mice were used to evaluate the efficacy and mechanisms of PARP1/2 inhibition by olaparib or PARP1 inhibition by AZD9574 with concurrent RT. Results: H3K27M mutation caused an HRR defect characterized by impaired RT-induced K63-linked polyubiquitination of histone H1 and inhibition of HRR protein recruitment. H3K27M DMG cells were selectively radiosensitized by olaparib in comparison to isogenic controls, and this effect translated to efficacy in H3K27M orthotopic brainstem tumors. Olaparib and RT induced an innate immune response and induction of NK cell (NKG2D) activating ligands leading to increased NK cell-mediated lysis of DMG tumor cells. In immunocompetent syngeneic orthotopic DMG tumors, either olaparib or AZD9574 in combination with RT enhanced intratumoral NK cell infiltration and activity in association with NK cell-mediated therapeutic responses and favorable activity of AZD9574. Conclusions: The HRR deficiency in H3K27M DMG can be therapeutically leveraged with PARP inhibitors to radiosensitize and induce an NK cell-mediated antitumor immune response selectively in H3K27M DMG, supporting the clinical investigation of best-in-class PARP inhibitors with RT in DMG patients. Key points: H3K27M DMG are HRR defective and selectively radiosensitized by PARP inhibitor.PARP inhibitor with RT enhances NKG2D ligand expression and NK cell-mediated lysis.NK cells are required for the therapeutic efficacy of PARP inhibitor and RT. Importance of the Study: Radiotherapy is the cornerstone of H3K27M-mutant diffuse midline glioma treatment, but almost all patients succumb to tumor recurrence with poor overall survival, underscoring the need for RT-based precision combination therapy. Here, we reveal HRR deficiency as an H3K27M-mediated vulnerability and identify a novel mechanism linking impaired RT-induced histone H1 polyubiquitination and the subsequent RNF168/BRCA1/RAD51 recruitment in H3K27M DMG. This model is supported by selective radiosensitization of H3K27M DMG by PARP inhibitor. Notably, the combination treatment results in NKG2D ligand expression that confers susceptibility to NK cell killing in H3K27M DMG. We also show that the novel brain penetrant, PARP1-selective inhibitor AZD9574 compares favorably to olaparib when combined with RT, prolonging survival in a syngeneic orthotopic model of H3K27M DMG. This study highlights the ability of PARP1 inhibition to radiosensitize and induce an NK cell-mediated antitumor immunity in H3K27M DMG and supports future clinical investigation.
RESUMEN
Plasmon-induced hot carriers are a promising "active" energy source, attracting increasing attention for their potential applications in photocatalysis and photodetection. Here, we hybridize plasmonic Au spherical nanoparticles (SNPs) with catalytically active Pt nanocrystals to form Au@Pt core-satellite nanoparticles (CSNPs), which act as both an efficient catalyst for plasmon-promoted decarboxylation reaction and a robust surface-enhanced Raman scattering (SERS) substrate for plasmon-enhanced molecular spectroscopic detection. By regulating the coverage of Pt nanocrystals on the Au SNPs, we modulated the "hotspot" structures of the Au@Pt CSNPs to optimize the SERS detecting capability and catalytic decarboxylation performance. The coupling functionalities enable us with unique opportunities to in-situ SERS monitor universal reactions catalyzed by active catalysts (e.g. Pt, Pd) in the chemical industry in real-time. The decarboxylation rate of 4-mercaptophenylacetic acid was dynamically controlled by the surface catalytic decarboxylation step, following first-order overall reaction kinetics. Moreover, the reaction rate exhibited a strong correlation with the local field enhancement |E/E0|4 of the hotspot structure. This work provides spectroscopic insights into the molecule-plasmon interface under the plasmon-promoted catalytic reactions, guiding the rational design of the plasmonic interface of nanocatalysts to achieve desired functionalities.
RESUMEN
Introduction: Echinococcosis is a chronic zoonotic disease caused by tapeworms of the genus Echinococcus. The World Health Organization (WHO) has identified encapsulated disease as one of 17 neglected diseases to be controlled or eliminated by 2050. There is no accurate, early, non-invasive molecular diagnostic method to detect echinococcosis. The feasibility of circulating free DNA as a diagnostic method for echinococcosis has yielded inconclusive results in a number of published studies. However, there has been no systematic evaluation to date assessing the overall performance of these assays. We report here the first meta-analysis assessing the diagnostic accuracy of cfDNA in plasma, serum, and urine for echinococcosis. Methods: We systematically searched PubMed, Embase, Cochrane Library, China National Knowledge Infrastructure (CNKI), and WeiPu databases up to 17 January 2024, for relevant studies. All analyses were performed using RevMan 5.3, Meta-DiSc 1.4, Stata 17.0, and R 4.3.1 software. The sensitivity, specificity, and other accuracy indicators of circulating free DNA for the diagnosis of echinococcosis were summarized. Subgroup analyses and meta-regression were performed to identify sources of heterogeneity. Results: A total of 7 studies included 218 patients with echinococcosis and 214 controls (156 healthy controls, 32 other disease controls (non-hydatid patients), and 26 non-study-targeted echinococcosis controls were included). Summary estimates of the diagnostic accuracy of cfDNA in the diagnosis of echinococcosis were as follows: sensitivity (SEN) of 0.51 (95% CI: 0.45-0.56); specificity (SPE) of 0.99 (95% CI: 0.97-0.99); positive likelihood ratio (PLR) of 11.82 (95% CI: 6.74-20.74); negative likelihood ratio (NLR) of 0.57 (95% CI: 0.41-0.80); diagnostic ratio (DOR) of 36.63 (95% CI: 13.75-97.59); and area under the curve (AUC) value of 0.98 (95% CI: 0.96-1.00). Conclusion: Existing evidence indicates that the combined specificity of circulating cfDNA for echinococcosis is high. However, the combined sensitivity performance is unsatisfactory due to significant inter-study heterogeneity. To strengthen the validity and accuracy of our findings, further large-scale prospective studies are required.Systematic review registrationThe systematic review was registered in the International Prospective Register of Systematic Reviews PROSPERO [CRD42023454158]. https://www.crd.york.ac.uk/PROSPERO/.
RESUMEN
Amorphous alloys or metallic glasses (MGs) thin films have attracted extensive attention in various fields due to their unique functional properties. Here, we use in situ heating transmission electron microscopy (TEM) to investigate the thermal stability and crystallization behavior of Pd-Au-Si thin films prepared by a pulsed laser deposition (PLD) method. Upon heating treatment inside a TEM, we trace the structural changes in the Pd-Au-Si thin films through directly recording high-resolution images and diffraction patterns at different temperatures. TEM observations reveal that the Pd-Au-Si thin films started to nucleate with small crystalline embryos uniformly distributed in the glassy matrix upon approaching the glass transition temperature Tg=625K, and subsequently, the growth of crystalline nuclei into sub-10 nm Pd-Si nanocrystals commenced. Upon further increasing the temperature to 673K, the thin films transformed to micro-sized patches of stacking-faulty lamellae that further crystallized into Pd9Si2 and Pd3Si intermetallic compounds. Interestingly, with prolonged thermal heating at elevated temperatures, the Pd9Si2 transformed to Pd3Si. Simultaneously, the solute Au atoms initially dissolved in glassy alloys and eventually precipitated out of the Pd9Si2 and Pd3Si intermetallics, forming nearly spherical Au nanocrystals. Our TEM results reveal the unique thermal stability and crystallization processes of the PLD-prepared Pd-Au-Si thin films as well as demonstrate a possibility of producing a large quantity of pure nanocrystals out of amorphous solids for various applications.
RESUMEN
The current first-line treatment for repairing cartilage defects in clinical practice is the creation of microfractures (MF) to stimulate the release of mesenchymal stem cells (MSCs); however, this method has many limitations. Recent studies have found that MSC-derived extracellular vesicles (MSC-EVs) play an important role in tissue regeneration. This study aimed to verify whether MSC-EVs promote cartilage damage repair mediated by MFs and to explore the repair mechanisms. In vitro experiments showed that human umbilical cord Wharton's jelly MSC-EVs (hWJMSC-EVs) promoted the vitality of chondrocytes and the proliferation and differentiation ability of bone marrow-derived MSCs. This was mainly because hWJMSC-EVs carry integrin beta-1 (ITGB1), and cartilage and bone marrow-derived MSCs overexpress ITGB1 after absorbing EVs, thereby activating the transforming growth factor-ß/Smad2/3 axis. In a rabbit knee joint model of osteochondral defect repair, the injection of different concentrations of hWJMSC-EVs into the joint cavity showed that a concentration of 50 µg/ml significantly improved the formation of transparent cartilage after MF surgery. Extraction of regenerated cartilage revealed that the changes in ITGB1, transforming growth factor-ß, and Smad2/3 were directly proportional to the repair of regenerated cartilage. In summary, this study showed that hWJMSC-EVs promoted cartilage repair after MF surgery.
Asunto(s)
Fracturas por Estrés , Humanos , Animales , Conejos , Cartílago , Condrocitos , Factor de Crecimiento Transformador beta , Factores de Crecimiento TransformadoresRESUMEN
We investigate theoretically the photoelectron momentum distributions (PMDs) of the helium atom in the few-cycle nonlinear chirped laser pulse. The numerical results show that the direction of the spider-like interference structure in PMDs exhibits periodic variations with the increase of the chirp parameter. It is illustrated that the direction of the spider-like interference structure is related to the direction of the electron motion by tracking the trajectories of the electrons. We also demonstrate that the carrier-envelope phase can precisely control the opening of the ionization channel. In addition, we investigate the PMDs when a chirp-free second harmonic (SH) laser pulse is added to the chirped laser field, the numerical results show that the interference patterns can change from only spider-like interference structure to both spider-like and ring-like interference structures.
RESUMEN
The magnetic skyrmions exhibit intriguing topological behaviors, holding promise for future applications in the realm of spintronic devices. Despite recent advancements, achieving spontaneous magnetic skyrmions and topological transitions in magnets featuring uniaxial magnetic anisotropy, particularly at elevated temperatures (>100 K), remains a challenging endeavor. Here, single-crystal Fe5Si3 nanorods with the central symmetry and uniaxial magnetic anisotropy were successfully synthesized on a mica substrate through chemical vapor deposition, which exhibit a high Curie temperature (TC) of about 372 K. The real-time observation, facilitated by Lorentz transmission electron microscopy, revealed the spontaneous formation of magnetic skyrmions and evolution of domains in focused ion beam-prepared Fe5Si3 thin foils. Moreover, Fe5Si3 device transport measurements expose notable magnetoresistance (MR) effects, enabling the interchange between positive and negative MR across specific temperature settings. These results offer various potential avenues for exploring diverse topological spin textures and their formation mechanisms, indicating inventive applications for iron-silicon alloy in the realm of spintronics.
RESUMEN
The topological Hall effect (THE) is the transport response of chiral spin textures and thus can serve as a powerful probe for detecting and understanding these unconventional magnetic orders. So far, the THE is only observed in either noncentrosymmetric systems where spin chirality is stabilized by Dzyaloshinskii-Moriya interactions, or triangular-lattice magnets with Ruderman-Kittel-Kasuya-Yosida-type interactions. Here, a pronounced THE is observed in a Fe-Co-Ni-Mn chemically complex alloy with a simple face-centered cubic (fcc) structure across a wide range of temperatures and magnetic fields. The alloy is shown to have a strong magnetic frustration owing to the random occupation of magnetic atoms on the close-packed fcc lattice and the direct Heisenberg exchange interaction among atoms, as evidenced by the appearance of a reentrant spin glass state in the low-temperature regime and the first principles calculations. Consequently, THE is attributed to the nonvanishing spin chirality created by strong spin frustration under the external magnetic field, which is distinct from the mechanism responsible for the skyrmion systems, as well as geometrically frustrated magnets.
RESUMEN
With the rapid development of society and the economy, population aging has become a common challenge faced by many countries in the world today. Structural and functional changes in the cardiovascular system can occur with age, increasing the incidence and severity of cardiovascular diseases in older adults. Due to the limited regenerative capacity of myocardial cells, myocardial infarction and its resulting heart failure and congenital heart disease have become the number one killer of human health. At present, the treatment of cardiovascular diseases includes drug therapy and nondrug therapy. Nondrug therapy mainly includes minimally invasive interventional therapy, surgical diagnosis and treatment, and cell therapy. Long-term drug treatment may cause headache due to vasodilation, lower blood pressure, digestive system dysfunction and other side effects. Surgical treatment is traumatic, difficult to treat, and expensive. In recent years, stem cell therapy has exhibited broad application prospects in basic and clinical research on cardiovascular disease because of its plasticity, self-renewal and multidirectional differentiation potential. Therefore, this paper looks at stem cell therapy for diseases, reviews recent advances in the mechanism and clinical transformation of cardiovascular aging and related diseases in China, and briefly discusses the development trend and future prospects of cardiovascular aging research.
RESUMEN
Diffuse intrinsic pontine glioma (DIPG) is a highly malignant brain tumor that mainly occurs in children with extremely low overall survival. Traditional therapeutic strategies, such as surgical resection and chemotherapy, are not feasible mostly due to the special location and highly diffused features. Radiotherapy turns out to be the standard treatment method but with limited benefits of overall survival. A broad search for novel and targeted therapies is in the progress of both preclinical investigations and clinical trials. Extracellular vesicles (EVs) emerged as a promising diagnostic and therapeutic candidate due to their distinct biocompatibility, excellent cargo-loading-delivery capacity, high biological barrier penetration efficiency, and ease of modification. The utilization of EVs in various diseases as biomarker diagnoses or therapeutic agents is revolutionizing modern medical research and practice. In this review, we will briefly talk about the research development of DIPG, and present a detailed description of EVs in medical applications, with a discussion on the application of engineered peptides on EVs. The possibility of applying EVs as a diagnostic tool and drug delivery system in DIPG is also discussed.
Asunto(s)
Neoplasias del Tronco Encefálico , Vesículas Extracelulares , Glioma , Humanos , Niño , Neoplasias del Tronco Encefálico/tratamiento farmacológico , Neoplasias del Tronco Encefálico/patología , Glioma/terapia , Glioma/tratamiento farmacológico , Sistemas de Liberación de Medicamentos , Vesículas Extracelulares/patología , Comunicación CelularRESUMEN
tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.
Asunto(s)
Células Madre Mesenquimatosas , ARN Pequeño no Traducido , Humanos , ARN Pequeño no Traducido/metabolismo , Cordón UmbilicalRESUMEN
Osteosarcoma (OS) is one of the most common types of solid sarcoma with a poor prognosis. Solid tumors are often exposed to hypoxic conditions, while hypoxia is regarded as a driving force in tumor recurrence, metastasis, progression, low chemosensitivity and poor prognosis. Pytoptosis is a gasdermin-mediated inflammatory cell death that plays an essential role in host defense against tumorigenesis. However, few studies have reported relationships among hypoxia, pyroptosis, tumor immune microenvironment, chemosensitivity, and prognosis in OS. In this study, gene and clinical data from Therapeutically Applicable Research to Generate Effective Treatments (TARGET) and Gene Expression Omnibus (GEO) databases were merged to develop a hypoxia risk model comprising four genes (PDK1, LOX, DCN, and HMOX1). The high hypoxia risk group had a poor prognosis and immunosuppressive status. Meanwhile, the infiltration of CD8+ T cells, activated memory CD4+ T cells, and related chemokines and genes were associated with clinical survival outcomes or chemosensitivity, the possible crucial driving forces of the OS hypoxia immune microenvironment that affect the development of pyroptosis. We established a pyroptosis risk model based on 14 pyroptosis-related genes to independently predict not only the prognosis but also the chemotherapy sensitivities. By exploring the various connections between the hypoxic immune microenvironment and pyroptosis, this study indicates that hypoxia could influence tumor immune microenvironment (TIM) remodeling and promote pyroptosis leading to poor prognosis and low chemosensitivity.
RESUMEN
OBJECTIVE: To determine the prognostic significance of inflammatory response-associated genes in acute myeloid leukemia (AML). METHODS: Transcriptomic profiles and related clinical information of AML patients were acquired from a public database. To establish a multi-gene prognosis signature, we performed least absolute shrinkage and selection operator Cox analysis for the TCGA cohort and evaluated the ICGC cohort for verification. Subsequently, Kaplan-Meier analysis was carried out to compare the overall survival (OS) rates between high- and low-risk groups. Biological function and single-sample gene set enrichment (ssGSEA) analyses were employed to investigate the association of risk score with immune status and the tumor microenvironment. Prognostic gene expression levels in AML samples and normal controls were confirmed by qRT-PCR and immunofluorescence. RESULTS: We identified a potential inflammatory response-related signature comprising 11 differentially expressed genes, including ACVR2A, CCL22, EBI3, EDN1, FFAR2, HRH1, ICOSLG, IL-10, INHBA, ITGB3, and LAMP3, and found that AML patients with high expression levels in the high-risk group had poor OS rates. Biological function analyses revealed that prognostic genes mainly participated in inflammation and immunity signaling pathways. Analyses of cancer-infiltrating immunocytes indicated that in high-risk patients, the immune suppressive microenvironment was significantly affected. The expression of the inflammation reaction-associated signature was found to be associated with susceptibility to chemotherapy. There was a significant difference in prognostic gene expression between AML and control tissues. CONCLUSION: A novel inflammatory response-related signature was developed with 11 candidate genes to predict prognosis and immune status in AML patients.
RESUMEN
Metabolic reprogramming is a hallmark of glioma, and sterol O-acyltransferase 1 (SOAT1) is an essential target for metabolic therapy. However, the prognostic value of SOAT1 and its association with immune infiltration has not been fully elucidated. Using RNA-seq and clinical data of glioma patients from The Cancer Genome Atlas (TCGA), SOAT1 was found to be correlated with poor prognosis in glioma and the advanced malignancy of clinicopathological characteristics. Next, the correlation between SOAT1 expression and tumor-infiltrating immune cells was performed using the single-sample GSEA algorithm, gene expression profiling interactive analysis (GEPIA), and tumor immune estimation resource version 2 (TIMER2.0); it was found that SOAT1 expression was positively correlated with multiple tumor-infiltrating immune cells. To further verify these results, immunofluorescence was conducted on paraffin-embedded glioma specimens, and a positive trend of the correlation between SOAT1 expression and Treg infiltration was observed in this cohort. Finally, differentially expressed gene analysis, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were performed to explore the biological processes and signaling pathways that SOAT1 may be involved in during glioma pathogenesis. A protein-protein interaction network was established, and co-expression analysis was conducted to investigate the regulatory mechanism of SOAT1 in glioma. To the best of our knowledge, this is the first comprehensive study reporting that SOAT1 may serve as a novel prognostic biomarker associated with immune infiltrates, providing a novel perspective for glioma metabolic therapy.
RESUMEN
Glioblastoma (GBM) is the most lethal malignant tumor in the central nervous system, with a median survival of only 14 months. Cholesterol, which is the main component of cell membrane and the precursor of many hormones, is one of the most important lipid components in human body. Since reprogramming of the cholesterol metabolic profile has been discovered in many cancers including GBM, cholesterol metabolism becomes a promising potential target for therapy. Since GBM cells rely on external cholesterol to survive and accumulate lipid droplets to meet their rapid growth needs, targeting the metabolism of cholesterol by different strategies including inhibition of cholesterol uptake and promotion of cholesterol efflux by activating LXRs and disruption of cellular cholesterol trafficking, inhibition of SREBP signaling, inhibition of cholesterol esterification, could potentially oppose the growth of glial tumors. In this review, we discussed the above findings and describe cholesterol synthesis and homeostatic feedback pathways in normal brain tissues and brain tumors, statin use in GBM and the role of lipid rafts and cholesterol precursors and oxysterols in the treatment and pathogenesis of GBM are also summarized.
RESUMEN
The balance between ubiquitination and deubiquitination is crucial for protein stability, function and location under physiological conditions. Dysregulation of E1/E2/E3 ligases or deubiquitinases (DUBs) results in malfunction of the ubiquitin system and is involved in many diseases. Increasing reports have indicated that ubiquitin-specific peptidases (USPs) play a part in the progression of many kinds of cancers and could be good targets for anticancer treatment. Glioma is the most common malignant tumor in the central nervous system. Clinical treatment for high-grade glioma is unsatisfactory thus far. Multiple USPs are dysregulated in glioma and have the potential to be therapeutic targets. In this review, we collected studies on the roles of USPs in glioma progression and summarized the mechanisms of USPs in glioma tumorigenesis, malignancy and chemoradiotherapy resistance.
Asunto(s)
Glioma/fisiopatología , Ubiquitina-Proteína Ligasas/fisiología , Proteasas Ubiquitina-Específicas/metabolismo , Ubiquitinación/fisiología , Animales , Autofagia/fisiología , Carcinogénesis/metabolismo , Reparación del ADN/fisiología , Resistencia a Antineoplásicos/fisiología , Humanos , Tolerancia a Radiación/fisiología , Transducción de Señal/fisiologíaRESUMEN
Glioblastoma multiforme (GBM) is the most common type of primary brain tumor in adults. GBM is characterized by a high degree of malignancy and aggressiveness, as well as high morbidity and mortality rates. GBM is currently treatable via surgical resection, chemotherapy and radiotherapy, but the prognosis of patients with GBM is poor. The suppressor of cytokine signaling (SOCS) protein family comprises eight members, including SOCS1-SOCS7 and cytokine-inducible SH2-containing protein. SOCS proteins regulate the biogenesis of GBM via the JAK/STAT and NF-κB signaling pathways. Driven by NF-κB, the expression of SOCS proteins can serve as a negative regulator of the JAK/STAT signaling pathway and exerts a potential inhibitory effect on GBM. In GBM, E3 ubiquitin ligase is involved in the regulation of cellular functions, such as the receptor tyrosine kinase (RTK) survival signal, in which SOCS proteins negatively regulate RTK signaling, and kinase overexpression or mutation can lead to the development of malignancies. Moreover, SOCS proteins affect the proliferation and differentiation of GBM cells by regulating the tumor microenvironment. SOCS proteins also serve specific roles in GBM of different grades and different isocitrate dehydrogenase mutation status. The aim of the present review was to describe the biogenesis and function of the SOCS protein family, the roles of SOCS proteins in the microenvironment of GBM, as well as the role of this protein family and E3 ubiquitin ligases in GBM. Furthermore, the role of SOCS proteins as diagnostic and prognostic markers in GBM and their potential role as GBM therapeutics were explored.
RESUMEN
Swift electrons can undergo inelastic interactions not only with electrons but also with near-fields, which may result in an energy loss or gain. Developments in photon-induced near-field electron microscopy (PINEM) enable direct imaging of the plasmon near-field distribution with nanometer resolution. Here, we report an analysis of the surface plasmonic near-field structure based on PINEM observations of silver nanowires. Single-photon order-selected electron images revealed the wavelike and banded structure of electric equipotential regions for a confined near-field integral associated with typical absorption of photon quanta (nâω). Multimodal plasmon oscillations and second-harmonic generation were simultaneously observed, and the polarization dependence of plasmon wavelength and symmetry properties were analyzed. Based on advanced imaging techniques, our work has implications for future studies of the localized-field structures at interfaces and visualization of novel phenomena in nanostructures, nanosensors, and plasmonic devices.
RESUMEN
As a member of the suppressor of cytokine signaling (SOCS) family, SOCS3 is a cytokine-inducible protein that inhibits cytokine signaling in a variety of signaling pathways. Increasing evidence shows that SOCS3 regulates tumor development through multiple pathological and physiological processes. It is worth mentioning that SOCS3 negatively regulates JAK/STAT signaling by binding to JAK/cytokine receptors or phosphorylation docking sites on STAT receptors, thus preventing tumor cell proliferation and inhibiting tumor cell invasion and metastasis. The kinase inhibitory region KIR of SOCS3 is the key to JAK inhibition. In addition, SOCS3 may also regulate tumor progression through other molecules or signaling pathways, such as microRNAs (miRNAs), IL-6 and NF-κB signaling pathway. MicroRNAs inhibit SOCS3 expression by binding to the 3' untranslated region of SOCS3 mRNA, thus regulating tumor development processes, including tumor cell proliferation, invasion, metastasis, differentiation, cell cycle and apoptosis, as well as tumor metastasis and chemotherapy resistance. On the whole, SOCS3 acts as an inhibitor of the majority of tumors through various pathways. In the present review, the role of SOCS3 in multitudinous tumors was comprehensively summarized, the molecular mechanisms and modes of action of SOCS3 in tumors were discussed, and the association between SOCS3 expression and the clinical characteristics of patients with cancer were emphasized.
Asunto(s)
Neoplasias/metabolismo , Proteína 3 Supresora de la Señalización de Citocinas/metabolismo , Antineoplásicos/uso terapéutico , Movimiento Celular , Proliferación Celular , Resistencia a Antineoplásicos , Regulación Neoplásica de la Expresión Génica , Humanos , Quinasas Janus/metabolismo , MicroARNs/genética , MicroARNs/metabolismo , Invasividad Neoplásica , Neoplasias/tratamiento farmacológico , Neoplasias/genética , Neoplasias/patología , Factores de Transcripción STAT/metabolismo , Transducción de Señal , Proteína 3 Supresora de la Señalización de Citocinas/genéticaRESUMEN
Electron diffraction techniques in transmission electron microscopy (TEM) have been successfully employed for determining the unit-cell parameters of crystal phases, albeit they exhibit a limited accuracy compared with X-ray or neutron diffraction, and they often involve a tedious measurement procedure. Here, a new package for determining unit-cell parameters from a single electron diffraction pattern has been developed. The essence of the package is to reconstruct a 3D reciprocal primitive cell from a single electron diffraction pattern containing both zero-order Laue zone and high-order Laue zone reflections. Subsequently, the primitive cell can be reduced to the Niggli cell which, in turn, can be converted into the unit cell. Using both simulated and experimental patterns, we detail the working procedure and address some effects of experimental conditions (diffraction distortions, misorientation of the zone axis and the use of high-index zone axis) on the robustness and accuracy of the software developed. The feasibility of unit-cell determination of the TiO2 nanorod using this package is also demonstrated. Should the parallel-beam, nano-beam and convergent-beam modes of the TEM be used flexibly, the software can determine unit-cell parameters of unknown-structure crystallites (typically >50â nm).