Modeling high-risk Wilms tumors enables the discovery of therapeutic vulnerability.

Wilms tumor (WT) is the most common pediatric kidney cancer treated with standard chemotherapy. However, less-differentiated blastemal type of WT often relapses. To model the high-risk WT for therapeutic intervention, we introduce pluripotency factors into WiT49, a mixed-type WT cell line, to generate partially reprogrammed cells, namely WiT49-PRCs. When implanted into the kidney capsule in mice, WiT49-PRCs form kidney tumors and develop both liver and lung metastases, whereas WiT49 tumors do not metastasize. Histological characterization and gene expression signatures demonstrate that WiT49-PRCs recapitulate blastemal-predominant WTs. Moreover, drug screening in isogeneic WiT49 and WiT49-PRCs leads to the identification of epithelial- or blastemal-predominant WT-sensitive drugs, whose selectivity is validated in patient-derived xenografts (PDXs). Histone deacetylase (HDAC) inhibitors (e.g., panobinostat and romidepsin) are found universally effective across different WT and more potent than doxorubicin in PDXs. Taken together, WiT49-PRCs serve as a blastemal-predominant WT model for therapeutic intervention to treat patients with high-risk WT.

Development and application of a quantitative real-time PCR method for detection of Decapod iridescent virus 1.

As a newly discovered virus, Decapoda iridovirus 1 (DIV1) can cause a mortality rate of up to 100% in crustaceans, leading to huge economic losses. At present, there is no effective prevention and control measures for this disease. In the present study, the specific primers targeting highly conserved regions of MCP gene were designed, and then a quantitative real-time PCR method was established. The results indicate that DIV1 quantitative real-time PCR established has good specificity and does not cross react with other pathogens including white spot syndrome virus (WSSV), infectious subcutaneous and hematopoietic necrosis virus (IHHNV) and Vibrio parahaemolyticus induced acute hepatopancreatic necrosis disease (VpAHPND). The real-time PCR was capable of detecting DIV1 DNA at a minimum concentration of 10 copies/µL within 34 cycles. The method has good repeatability, with intra group and inter group coefficients of variation both less than 2%. Thirty-two clinical samples were assessed using both the real-time PCR and conventional PCR. The results shown real-time PCR we established are more sensitive than conventional PCR. In conclusion, this method has strong specificity, stable repeatability, and high sensitivity, providing technical support for clinical diagnosis, epidemiology investigation and monitoring of DIV1.

Advancing immunomodulatory functions in mesenchymal stem/stromal cells through targeting the GATA6-mediated pathway.

BACKGROUND AIMS: The immunomodulatory capacity of mesenchymal stem/stromal cells (MSCs) is a key feature that makes them particularly valuable for regenerative medicine. However, this potential is affected by the chronological aging of the donors and the cell expansion procedures in culture. We have demonstrated that GATA binding protein 6 (GATA6) plays a pivotal role in the aging of MSCs and inhibiting GATA6 rejuvenates the characteristics of MSCs. METHODS: In this study, we compared the immunomodulatory capabilities of young and old MSC models, using induced pluripotent stem cells-derived rejuvenated MSCs (rMSCs) and their parental MSCs (pMSCs), respectively, to identify a key mechanism involved in the differential regulation of these capabilities. Additionally, we explored the role of GATA6 in mediating the mechanism. RESULTS: Our results demonstrated that rMSCs exhibited downregulated aging-associated regulators, including p53, p21 and GATA6, and showed enhanced suppression of T cell proliferation compared to pMSCs. Through analyzing our previous RNA-seq data and employing target gene knockdown, we determined both suppressors of cytokine signaling 3 (SOCS3) and interleukin 6 were involved in GATA6-induced regulation, collectively affecting the expression of programmed death ligand 1 (PDL1) in both pMSCs and rMSCs. CONCLUSIONS: Our findings underline the significance of the GATA6/SOCS3/PDL1 pathway in regulating aging-associated changes in MSC immunomodulatory activity, providing valuable insights into the potential use of rMSCs in the treatment of immune diseases and regenerative medicine.

[One-stage posterior debridement and spinal internal fixation for the treatment of lumbar Brucellar spondylitis].

OBJECTIVE: To explore the clinical efficacy and safety of one-stage posterior lesion removal and internal spinal fixation in patients with lumbar Brucellosis spondylitis. METHODS: The clinical data of 24 patients admitted from October 2017 to October 2022 were retrospectively analyzed, 2 patients were lost to follow-up at 10 months after surgery, at the final 22 cases were included in the study, including 13 males and 9 females with an average age of (52.00±6.89) years old, were treated with one-stage posterior lesion removal and internal spinal fixation. The operation time, intraoperative bleeding, follow-up time, erythrocyte sedimentation rate(ESR) and C-reactive protein(CRP) before and after operation were recorded. The pain visual analogue scale(VAS), Oswestry disability index(ODI), the Japanese Orthopaedic Association(JOA) score for neurofunction, American Spinal Injury Association(ASIA) spinal cord injury grade and modified MacNab criteria were ussed to evaluate the efficacy. RESULTS: All patients were followed up from 12 to 30 months with an average of (17.41±4.45) months. The operation time was 70 to 155 min with an average of (116.59±24.32) min;the intraoperative bleeding volume was 120 to 520 ml with an average of (275.00±97.53) ml. CRP and ESR levels decreased more significantly at 1 week and at the final follow-up than preoperative levels(P<0.05). VAS, JOA score and ODI at 1 week and at the latest follow-up were more significantly improved than preoperative results(P<0.05). There was no significant difference between ASIA preoperative and 1 week after operation(P>0.05), and a significant difference between preoperative and last follow-up(P<0.05). In the final follow-up, 21 patients had excellent efficacy, 1 patient had fair, and there was no recurrence during the follow-up. CONCLUSION: One-stage transpedicular lesion removal and internal spinal fixation, with few incisions and short operation time, helps the recovery of neurological function, and the prognosis meets the clinical requirements, which can effectively control Brucella spondylitis.

MiR-30c suppresses the proliferation, metastasis and polarity reversal of tumor cell clusters by targeting MTDH in invasive micropapillary carcinoma of the breast.

Purpose: Invasive micropapillary carcinoma (IMPC) of the breast has a high propensity for lymphovascular invasion and axillary lymph node metastasis and displays an 'inside-out' growth pattern, but the molecular mechanism of invasion, metastasis and cell polarity reversal in IMPC is unclear. Methods: and Patients: Cell growth curves, tumor sphere formation assays, transwell assays, mouse xenograft model and immunofluorescence were evaluated to investigate the effects of miR-30c and MTDH. Dual luciferase reporter assays was performed to confirm that the MTDH (metadherin) 3'UTR bound to miR-30c. MiRNA in situ hybridization (ISH) and immunohistochemistry (IHC) were carried out on IMPC patient tissues for miR-30c and MTDH expression, respectively. Results: We found miR-30c as a tumor suppressor gene in cell proliferation, metastasis and polarity reversal of IMPC. Overexpression of miR-30c inhibited cell growth and metastasis in vitro and in vivo. MiR-30c could directly target the MTDH 3'UTR. MiR-30c overexpression inhibited breast cancer cell proliferation, invasion and metastasis by targeting MTDH. Moreover, miR-30c/MTDH axis could also regulate cell polarity reversal of IMPC. By ISH and IHC analyses, miR-30c and MTDH were significantly correlated with tumor size, lymph nodule status and tumor grade, the 'inside-out' growth pattern, overall survival (OS) and disease-free survival (DFS) in IMPC patients. Conclusions: Overall, miR-30c/MTDH axis was responsible for tumor proliferation, metastasis and polarity reversal. It may provide promising therapeutic targets and prognostic biomarkers for patients with IMPC.

Three new compounds from the fruits of Solanum virginianum L. and their anti-inflammatory activities.

Three new compounds 1-glyceryl 9(ß), 10(α), 11(ß)-trihydroxy-12(Z)-octadecenoate, 2'S-20-O-p-hydroxyphenylpropionyloxy-20-hyd-roxyarachidic acid glycerol ester (2), 3-O-α-l-arabinopyranosyl-(1→6)-ß-d-glucopyranoside of ethyl (3S)-hydroxybutanoate (3), as well as a new natural product (4) were isolated from the fruits of Solanum virginianum L. The structures of 26 compounds were determined by comprehensive spectroscopic analyses, NMR calculation, chemical methods, and comparisons of spectroscopic data. Compounds 2 and 16 exhibited good anti-inflammatory activity in the LPS-induced RAW 264.7 inflammatory model with IC50 values of 16.75 ± 1.54 and 22.43 ± 2.01 µM, respectively.

AntDAS-GCMS: A New Comprehensive Data Analysis Platform for GC-MS-Based Untargeted Metabolomics with the Advantage of Addressing the Time Shift Problem.

Over the years, a number of state-of-the-art data analysis tools have been developed to provide a comprehensive analysis of data collected from gas chromatography-mass spectrometry (GC-MS). Unfortunately, the time shift problem remains unsolved in these tools. Here, we developed a novel comprehensive data analysis strategy for GC-MS-based untargeted metabolomics (AntDAS-GCMS) to perform total ion chromatogram peak detection, peak resolution, time shift correction, component registration, statistical analysis, and compound identification. Time shift correction was specifically optimized in this work. The information on mass spectra and elution profiles of compounds was used to search for inherent landmarks within analyzed samples to resolve the time shift problem across samples efficiently and accurately. The performance of our AntDAS-GCMS was comprehensively investigated by using four complex GC-MS data sets with various types of time shift problems. Meanwhile, AntDAS-GCMS was compared with advanced GC-MS data analysis tools and classic time shift correction methods. Results indicated that AntDAS-GCMS could achieve the best performance compared to the other methods.

Lower Gluteal Liposuction Combined With Upper Gluteal and Infragluteal Region Fat Grafting: A Novel Concept to Improve Gluteal Ptosis.

BACKGROUND: Gluteal ptosis results in a severe disturbance of gluteal aesthetics. Currently, satisfactory procedures for improving gluteal ptosis are lacking. OBJECTIVES: To improve gluteal ptosis, the authors propose a novel concept of combined liposuction of the lower gluteal region and fat grafting to the upper gluteal and infragluteal regions, and verify its efficacy and safety. METHODS: Patients who underwent liposuction of the lower gluteal region combined with fat grafting to the upper gluteal and infragluteal regions between January 2020 and July 2023 were retrospectively reviewed. Postoperative changes in the gluteal ptosis grade, complications, and patient satisfaction were evaluated. RESULTS: A total of 28 patients were enrolled in this study; 21 (75.0%) patients had gluteal ptosis grade 4 and 7 (25.0%) patients had gluteal ptosis grade 5. The median fat removal volume was 210 mL, and the median fat graft injected volume was 355 mL in the gluteal region and 180 mL in the infragluteal region. All patients showed improvement in gluteal ptosis; 16 (57.1%) patients improved by 1 grade and 12 (42.9%) patients showed a 2-grade improvement. All patients were satisfied with their posttreatment outcomes. Only 1 patient showed lateral translocation of the fat graft. No other complications were observed. CONCLUSIONS: Liposuction of the lower gluteal region combined with fat grafting to the upper gluteal and infragluteal regions is effective in improving gluteal ptosis, with a low risk of complications and high patient satisfaction.

Prediction of recurrence-related factors for patients with early-stage cervical cancer following radical hysterectomy and adjuvant radiotherapy.

OBJECTIVE: To analyze recurrent factors in patients with clinical early-stage cervical cancer (ESCC) following hysterectomy and adjuvant radiotherapy. METHODS: We collected data from patients with ESCC, staged according to the 2009 Federation International of Gynecology and Obstetrics (FIGO) staging criteria, who underwent hysterectomy followed by adjuvant radiotherapy between 2012 and 2019. These patients were subsequently restaged using the 2018 FIGO criteria. Univariable and multivariable analyses, along with nomogram analyses, were conducted to explore factors associated with recurrence-free survival (RFS). RESULTS: A total of 310 patients met the inclusion criteria, with a median follow-up time of 46 months. Among them, 126 patients with ESCC were restaged to stage III C1 or III C2 after surgery due to lymph node metastasis (LNM) based on the 2018 FIGO staging criteria. Of these, 60 (19.3%) experienced relapse. The 1-, 3-, and 5-year RFS rates were 93.9%, 82.7%, and 79.3%, respectively. Multivariate analysis revealed that the number of positive lymph nodes (LNs), tumor diameter (TD) > 4 cm, and parametrial invasion (PI) were associated with recurrence. The nomogram indicated their predictive value for 3-year and 5-year RFS. Notably, the 5-year recurrence rate (RR) increased by 30.2% in patients with LNM, particularly those with ≥ 3 positive LNs (45.5%). Patients with stage III C2 exhibited a significantly higher RR than those with IIIC1 (56.5% vs. 24.3%, p < 0.001). The 5-year RFS for patients with TD > 4 cm was 65.8%, significantly lower than for those with TD ≤ 4 cm (88.2%). Subgroup analysis revealed higher 5-year RRs in patients with stage III C2 than that in patients with III-C1 (56.5% vs. 24.3%, p < 0.001), demonstrating a significant difference in the RFS survival curve. CONCLUSION: RR in patients with clinical ESCC after hysterectomy followed by adjuvant radiotherapy is correlated with the number of positive LNs, TD > 4 cm, and PI. Emphasis should be placed on the common high-risk factor of LNM association with recurrence after radical hysterectomy in ESCC.

A novel comprehensive strategy for high-thoroughly studying released compounds during the combustion process of herbs. A case study for Artemisia argyi Levl. et Vant.

The comprehensive study of compound variations in released smoke during the combustion process is a great challenge in many scientific fields related to analytical chemistry like traditional Chinese medicine, environment analysis, food analysis, etc. In this work, we propose a new comprehensive strategy for efficiently and high-thoroughly characterizing compounds in the online released complex smokes: (i) A smoke capture device was designed for efficiently collecting chemical constituents to perform gas chromatography-mass spectrometry (GC-MS) based untargeted analysis. (ii) An advanced data analysis tool, AntDAS-GCMS, was used for automatically extracting compounds in the original acquired GC-MS data files. Additionally, a GC-MS data analysis guided instrumental parameter optimizing strategy was proposed for the optimization of parameters in the smoke capture device. The developed strategy was demonstrated by the study of compound variations in the smoke of traditional Chinese medicine, Artemisia argyi Levl. et Vant. The results indicated that more than 590 components showed significant differences among released smokes of various moxa velvet ratios. Finally, about 88 compounds were identified, of which phenolic compounds were the most abundant, followed by aromatics, alkenes, alcohols and furans. In conclusion, we may provide a novel approach to the studies of compounds in online released smoke.

On-Tissue Spatial Proteomics Integrating MALDI-MS Imaging with Shotgun Proteomics Reveals Soy Consumption-Induced Protein Changes in a Fragile X Syndrome Mouse Model.

Fragile X syndrome (FXS), the leading cause of inherited intellectual disability and autism, is caused by the transcriptional silencing of the FMR1 gene, which encodes the fragile X messenger ribonucleoprotein (FMRP). FMRP interacts with numerous brain mRNAs that are involved in synaptic plasticity and implicated in autism spectrum disorders. Our published studies indicate that single-source, soy-based diets are associated with increased seizures and autism. Thus, there is an acute need for an unbiased protein marker identification in FXS in response to soy consumption. Herein, we present a spatial proteomics approach integrating mass spectrometry imaging with label-free proteomics in the FXS mouse model to map the spatial distribution and quantify levels of proteins in the hippocampus and hypothalamus brain regions. In total, 1250 unique peptides were spatially resolved, demonstrating the diverse array of peptidomes present in the tissue slices and the broad coverage of the strategy. A group of proteins that are known to be involved in glycolysis, synaptic transmission, and coexpression network analysis suggest a significant association between soy proteins and metabolic and synaptic processes in the Fmr1KO brain. Ultimately, this spatial proteomics work represents a crucial step toward identifying potential candidate protein markers and novel therapeutic targets for FXS.

[Effects of Combined Pollution of Microplastics and Lead on Maize Seed Germination and Growth].

Microplastics are a new contaminant that are causing worldwide concern. However, an understanding of their impact on agricultural seed germination remains inadequate. To investigate the effects of combined microplastic and heavy metal contamination on crop seed germination and growth, the effects of exposure to different single and combined concentrations of lead (Pb) and three microplastics[polyethylene (PE), polypropylene (PP), and polyvinyl chloride (PVC)] on maize seed germination and growth were investigated using maize seeds. The results showed that:the inhibition of maize seed germination by Pb single exposure generally increased with Pb concentration. Compared with that in CK, 500, 1000, and 1500 mg·L-1 PE exposure significantly inhibited maize seed germination, but 100 and 300 mg·L-1 exposure had no significant effect (except at d 5). All PP concentration exposures significantly inhibited maize seed germination, with higher concentrations resulting in stronger inhibition. Compared to that under PP and PE exposure, PVC single exposure inhibited maize germination less, and 500, 1000, and 1500 mg·L-1 exposures produced a facilitative effect at the later stages of germination. The germination index, germination potential, and vigor index of maize seeds decreased with the increase in the single exposure concentration of lead and three types of microplastics, significantly decreased compared with that of CK under the combined exposure of Pb and PE, and did not change significantly under the combined exposure of PP and Pb or PVC and Pb. Among the three types of microplastics, PVC had the least effect on corn seed vigor. Both single exposures of 10 mg·L-1Pb and 100 mg·L-1 of the three microplastics promoted maize stalk and root growth, whereas other concentrations showed mostly inhibitory effects. When the PE concentration was 500 mg·L-1, the 10 and 20 mg·L-1Pb exposures both promoted maize seed stalk and root growth; however, the combined PP and Pb exposures did not produce significant inhibition, whereas 500 mg·L-1PVC and 10 mg·L-1Pb showed the strongest inhibition of maize stalk and root growth under combined PVC and Pb exposures. The effects of combined exposure to microplastics and Pb on the germination and growth of maize seeds were essentially antagonistic, thus slowing down the toxic effects of their respective single exposures on maize seeds.

[Distribution Characteristics and Risk Assessment of Microplastics in Farmland Soil in Guyuan].

The farmland ecosystem faces the emerging risk of microplastic pollution. To investigate the distribution characteristics of microplastics in agricultural soils in Guyuan City, the abundance, type, color, size, and shape of microplastics in Guyuan City agricultural soils were analyzed using field survey, microscopic observation, and Fourier transform infrared spectroscopy. In addition, the risk of microplastic pollution was assessed using the pollution load index method (PLI). The results showed that the microplastic abundance of agricultural soils (0-20 cm) in Guyuan City ranged from 186.32 to 1286.24 n·kg-1, and the microplastic abundance of soils in facility agriculture increased significantly by 35.56% and 228.91% compared with those in non-facility agriculture with and without film, respectively, and the microplastic abundance in the arable layer was 0.31 times higher than that in the plough pan layer. PE (26.42% to 62.83%) and PP (27.64% to 42.62%) were the main microplastic polymer types, and the number of soil polymer species was significantly greater in facility agriculture than that in non-facility agriculture. Microplastics <100 µm accounted for 32.21%-42.52%, whereas >1000 µm accounted for only 0.28%-12.31%. The particle size of microplastics in the arable layer was 47.39% higher than that in the plough pan layer, and the particle size of microplastics was the largest in facility agriculture and the smallest in non-facility film-free planting. Microplastics were mostly in the form of films, fibers, fragments, and microbeads, with the greatest abundance in the form of fibers and the second largest in the form of films. A total of seven colors of microplastics were monitored, mainly white and black. The overall risk of contamination in the study area was low, and the highest risk of microplastic contamination was found in the soil of facility agriculture. The results of the study will provide data reference for the assessment of microplastic contamination in agricultural soils and microplastic soil environmental behavior in China.

Formin-related protein 1 facilitates proliferation and aggressive phenotype of clear cell renal cell carcinoma through MAPK/MMP2 pathway.

BACKGROUND: Formin-related protein-1(FRL1) has reportedly been overexpressed in a variety of malignancies, such as clear cell renal cell carcinoma (ccRCC). However, the clinical value and molecular mechanisms underlying ccRCC tumorigenesis and progression in association with FRL1 remain poorly understood. METHODS: Immunohistochemical analysis was performed on 119 paraffin-embedded RCC tissue samples to detect FRL1 expression and analyze its prognostic value. Colony formation, the CCK-8 assay, flow cytometry, and in vivo nude mice subcutaneous experiments were used to identify the effects of FRL1 on growth and proliferation. In vitro tests for wound healing, migration, and invasion were used to assess the involvement of FRL1 in invasion and metastatic potential. The process of epithelial-mesenchymal transition process (EMT) and the MMP2 expression were detected in stably transfected RCC cells via western blotting, as well as in tumor tissue paraffin sections from xenograft model. RESULTS: Both FRL1 mRNA and protein levels were noticeably elevated in ccRCC cell lines and samples. Aberrant overexpression of FRL1 was associated with unfavorable clinicopathological features of ccRCC and indicated poor prognosis. Ectopic overexpression of FRL1 increased the growth-promoting traits of ccRCC cells as well as the migratory and invasive capacity of RCC cells, whereas FRL1-silencing caused the opposite results. In addition, FRL1 promoted epithelial-mesenchymal transition (EMT) and upregulated the expression of matrix metalloproteinase 2 (MMP2). Finally, overexpression of FRL1 upregulated phosphorylation level of ERK1/2 with no effect on total level of ERK1/2 in the RCC cells. MAPK/ERK inhibitor reversed the promotional effects of FRL1. CONCLUSION: FRL1 was overexpressed in ccRCC tissues and predicted poor prognosis. FRL1 contributes to invasion and aggressive phenotype of ccRCC by facilitating EMT through MAPK/MMP2 axis.

Arginase from Priestia megaterium and the Effects of CMCS Conjugation on Its Enzymological Properties.

Arginase has shown promising potential in treating cancers by arginine deprivation therapy; however, low enzymatic activity and stability of arginase are impeding its development. This study was aimed to improve the enzymological properties of a marine bacterial arginase by carboxymethyl chitosan (CMCS) conjugation. An arginase producing marine bacterium Priestia megaterium strain P6 was isolated and identified. The novel arginase PMA from the strain was heterologously expressed, purified, and then conjugated to CMCS by ionic gelation with calcium chloride as the crosslinking agent. Enzymological properties of both PMA and CMCS-PMA conjugate were determined. The optimum temperature for PMA and CMCS-PMA at pH 7 were 60 °C and 55 °C, respectively. The optimum pH for PMA and CMCS-PMA at 37 °C were pH 10 and 9, respectively. CMCS-PMA showed higher thermostability than PMA over 55-70 °C and higher pH stability over pH 4-11 with the highest pH stability at pH 7. At 37 °C and pH of 7, i.e., around the human blood temperature and pH, CMCS-PMA was higher than the free PMA in enzymatic activity and stability by 24% and 21%, respectively. CMCS conjugation not only changed the optimum temperature, optimum pH, and enzymatic activity of PMA, but also improved its pH stability and temperature stability, and thus made it more favorable for medical application.

Pyroptosis and its role in cancer.

Programmed cell death (PCD) is mediated by specific genes that encode signals. It can balance cell survival and death. Pyroptosis is a type of inflammatory, caspase-dependent PCD mediated by gasdermin proteins, which function in pore formation, cell expansion, and plasma membrane rupture, followed by the release of intracellular contents. Pyroptosis is mediated by caspase-1/3/4/5/11 and is primarily divided into the classical pathway, which is dependent on caspase-1, and the non-classical pathway, which is dependent on caspase-4/5/11. Inflammasomes play a vital role in these processes. The various components of the pyroptosis pathway are related to the occurrence, invasion, and metastasis of tumors. Research on pyroptosis has revealed new options for tumor treatment. This article summarizes the recent research progress on the molecular mechanism of pyroptosis, the relationship between the various components of the pyroptosis pathway and cancer, and the applications and prospects of pyroptosis in anticancer therapy.

Identification of Oak-Barrel and Stainless Steel Tanks with Oak Chips Aged Wines in Ningxia Based on Three-Dimensional Fluorescence Spectroscopy Combined with Chemometrics.

With the increased incidence of wine fraud, a fast and reliable method for wine certification has become a necessary prerequisite for the vigorous development of the global wine industry. In this study, a classification strategy based on three-dimensional fluorescence spectroscopy combined with chemometrics was proposed for oak-barrel and stainless steel tanks with oak chips aged wines. Principal component analysis (PCA), partial least squares analysis (PLS-DA), and Fisher discriminant analysis (FDA) were used to distinguish and evaluate the data matrix of the three-dimensional fluorescence spectra of wines. The results showed that FDA was superior to PCA and PLS-DA in classifying oak-barrel and stainless steel tanks with oak chips aged wines. As a general conclusion, three-dimensional fluorescence spectroscopy can provide valuable fingerprint information for the identification of oak-barrel and stainless steel tanks with oak chips aged wines, while the study will provide some theoretical references and standards for the quality control and quality assessment of oak-barrel aged wines.

First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China.

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar：TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1，MZ555753.1, U42342.1）were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

The Synergistic Effects between Sulfobetaine and Hydrophobically Modified Polyacrylamide on Properties Related to Enhanced Oil Recovery.

In order to explore the mechanism responsible for the interactions in the surfactant-polymer composite flooding and broaden the application range of the binary system in heterogeneous oil reservoirs, in this paper, the influences of different surfactants on the viscosity of two polymers with similar molecular weights, partially hydrolyzed polyacrylamide (HPAM) and hydrophobically modified polyacrylamide (HMPAM), were studied at different reservoir environments. In addition, the relationship between the surfactant-polymer synergistic effects and oil displacement efficiency was also investigated. The experimental results show that for HPAM, surfactants mainly act as an electrolyte to reduce its viscosity. For HMPAM, SDBS and TX-100 will form aggregates with the hydrophobic blocks of polymer molecules, reducing the bulk viscosity. However, zwitterionic surfactant aralkyl substituted alkyl sulfobetaine BSB molecules can build "bridges" between different polymer molecules through hydrogen bonding and electrostatic interaction. After forming aggregates with HMPAM molecules, the viscosity will increase. The presence of two polymers all weakened the surfactant oil-water interfacial membrane strength to a certain extent, but had little effect on the interfacial tension. The synergistic effect of the "bridge" between HMPAM and BSB under macroscopic conditions also occurs in the microscopic pores of the core, which has a beneficial effect on improving oil recovery.

Dynamic Interfacial Tensions of Surfactant and Polymer Solutions Related to High-Temperature and High-Salinity Reservoir.

Betaine is a new surfactant with good application prospects in high-temperature and high-salinity reservoirs. The interfacial properties of two kinds of betaine mixtures with a good synergistic effect were evaluated in this paper. On this basis, the effects of temperature-resistant, salt-resistant polymers with different contents of 2-acrylamide-2-methylpropanesulfonic acid (AMPS) on dynamic interfacial tensions (IFTs) against n-alkanes and crude oil were studied. The experimental results show that the IFTs between betaine ASB and n-alkanes can be reduced to ultra-low values by compounding with anionic surfactant petroleum sulfonate (PS) and extended anionic surfactant alkoxyethylene carboxylate (AEC), respectively. ASB@AEC is very oil-soluble with nmin value ≥14, and ASB@PS is relatively water-soluble with nmin value of 10. The water solubility of both ASB@PS and ASB@AEC is enhanced by the addition of water-soluble polymers. The HLB of the ASB@AEC solution becomes better against crude oil after the addition of polymers, and the IFT decreases to an ultra-low value as a result. On the contrary, the antagonistic effect in reducing the IFT can be observed for ASB@PS in the same case. In a word, polymers affect the IFTs of surfactant solutions by regulating the HLB.