Exome sequencing confirms the clinical diagnosis of both joubert syndrome and klinefelter syndrome with keratoconus in a han Chinese family.

Introduction: Joubert syndrome a rare genetic disorder, is characterized by abnormalities in the development of the central nervous system with "molar signs" on magnetic resonance imaging of the brain and accompanied by cerebellar vermis hypoplasia, ataxia, hypotonia, and developmental delay. Keratoconus (KC) is a kind of genetically predisposed eye disease that causes blindness characterized by a dilated thinning of the central or paracentral cornea conically projected forward, highly irregular astigmatism, and severe visual impairment. Klinefelter syndrome is caused by an extra X chromosome in the cells of male patients, and the main phenotype is tall stature and dysplasia with secondary sex characteristics. This study was intended to identify the genetic etiology and determine the clinical diagnosis of one Han Chinese family with specific clinical manifestations of keratoconus and multiorgan involvement. Methods: A comprehensive ocular and related general examination was performed on one patient and his asymptomatic parents and brother. Pathogenic genes were tested by exome sequencing. CNV-seq was used to verify the copy number variation, and peripheral blood was cultured for karyotype analysis. The pathogenicity of the identified variant was determined subject to ACMG guidelines. The Gene Expression Omnibus (GEO) dataset of keratoconus-related genes in the NCBI database was obtained to analyze the differentially expressed genes in corneal tissues of the keratoconus group and the normal control group, and analysis of protein-protein interaction networks (PPI) was performed. Results: Proband, a 25-year-old male, had sudden loss of vision in the left eye for 1 week. Best corrected visual acuity (BCVA): 0.5 (-1.00DS/-5.00DC*29°) in the right eye, counting fingers/40 cm in the left eye. Slit-lamp microscopy of the right eye showed mild anterior protrusion of the cornea and thinning of the cone-topped cornea. The left eye showed marked thinning of the central region of the cornea, rounded edema in the form of a cone-like bulge, epithelial bullae, edema and turbidity of the stroma, and bulging of the Descemet's membrane. Cranial magnetic resonance imaging (MRI) revealed changes in the midbrain and cerebellum, with a "molar sign" and a "bat-winged" ventriculus quartus cerebri. General check-up: 168 cm in height, decreased muscle tone in all four limbs, knee jerk elicited, negative Babinski sign, abdominal reflexes elicited, finger-to-nose test positive, intentional tremor evident in both hands, positive Romberg's sign, instability of gait, level I intellectual disability, poor adaptive behavior, communication disorders, teeth all dentures, a peculiar face with blepharophimosis, wide inner canthus distance, mild ptosis, severe positive epicanthus, high palatal arches, exotropia, hypotrichosis of beard and face, inconspicuous prominentia laryngea, and short upper and lower limbs. Exome sequencing detected compound heterozygous frameshift variants M1:c.9279dup:p.His3094Thrfs*18 and M2:c.6515_6522del:p.Lys2172Thrfs*37 in the patient's CPLANE1 gene and the presence of duplication-type CNV on the X chromosome. Sanger sequencing showed that the mother and father carried the M1 and M2 variants, respectively, and the younger brother carried the M2 variant, which was a novel variant. CNV-seq analysis showed the presence of a duplication-type CNV Xp22.33-Xq28 (2757837-156030895) of approximately 155 Mb on the X chromosome of the proband, which was a de novo variant and carried by neither of the parents. The two heterozygous frameshift variants and duplication-type CNV were pathogenic according to the ACMG guidelines. Differential expression analysis of keratoconus-related genes showed that CPLANE1 was upregulated in the corneal tissues of keratoconus patients compared with normal controls, and such a difference was statistically significant (p = 0.000515, <0.05). PPI analysis showed that the CPLANE1-NPHP3 complex protein acted as a bridge between cilia and extracellular matrix tissue. According to the genetic test results and clinical phenotype analysis, the family was finally diagnosed with Joubert syndrome combined with Keratoconus and Klinefelter syndrome. Discussion: In this study, we report a proband in a Han Chinese family with both Joubert syndrome and X-linked Klinefelter syndrome as well as keratoconus, and the phenotype spectrum of CPLANE1-Joubert syndrome may be expanded accordingly. Meanwhile, the significance of exome sequencing was emphasized in aiding the clinical diagnosis of complex cases, which is difficult to make.

MFRP variations cause nanophthalmos in five Chinese families with distinct phenotypic diversity.

Purpose: Nanophthalmos is a congenital ocular structural anomaly that can cause significant visual loss in children. The early diagnosis and then taking appropriate clinical and surgical treatment remains a challenge for many ophthalmologists because of genetic and phenotypic heterogeneity. The objective of this study is to identify the genetic cause of nanophthalmos in the affected families and analyze the clinical phenotype of nanophthalmos with MFRP gene variation (Microphthalmia, isolated; OMIM#611040 and Nanophthalmos 2; OMIM#609549, respectively). Methods: Comprehensive ophthalmic examinations were performed on participants to confirm the phenotype. The genotype was identified using whole exome sequencing, and further verified the results among other family members by Sanger sequencing. The normal protein structure was constructed using Alphafold. Mutant proteins were visualized using pymol software. Pathogenicity of identified variant was determined by in silico analysis and the guidelines of American College of Medical Genetics and Genomics (ACMG). The relationship between genetic variants and clinical features was analyzed. Results: Five nanophthalmos families were autosomal recessive, of which four families carried homozygous variants and one family had compound heterozygous variants in the MFRP gene. Both family one and family three carried the homozygous missense variant c.1486G>A (p.Glu496Lys) in the MFRP gene (Clinvar:SCV005060845), which is a novel variant and evaluated as likely pathogenic according to the ACMG guidelines and in silico analysis. The proband of family one presented papilloedema in both eyes, irregular borders, thickened retinas at the posterior pole, tortuous and dilated retinal vessels, and indistinguishable arteries and veins, while the proband of family three presented uveal effusion syndrome-like changes in the right eye. In families one and 3, despite carrying the same gene variant, the probands had completely different clinical phenotypes. The homozygous nonsense variant c.271C>T (p.Gln91Ter) (Clinvar:SCV005060846) of the MFRP gene was detected in family 2, presenting shallow anterior chamber in both eyes, pigmentation of peripheral retina 360° from the equator to the serrated rim showing a clear demarcation from the normal retina in the form of strips. Family four proband carried the homozygous missense variant c.1411G>A (p.Val471Met) in the MFRP gene (Clinvar:SCV005060847), family five proband carried compound heterozygous missense variants c.1486G>A (p.Glu496Lys) and c.602G>T (p.Arg201Leu) in the MFRP gene (Clinvar:SCV005060848), which is a novel variant and evaluated as likely pathogenic according to the ACMG guidelines and in silico analysis, and they all presented clinically with binocular angle-closure glaucoma, family four also had retinal vein occlusion in the right eye during the follow-up. Conclusion: In this study, pathogenic variants of the MFRP gene were detected in five nanophthalmos families, including two novel variants. It also revealed a distinct phenotypic diversity among five probands harboring variants in the MFRP gene. Our findings extend the phenotype associated with MFRP variants and is helpful for ophthalmologists in early diagnosis and making effective treatment and rehabilitation strategies.

De novo variation in ARID1B gene causes Coffin-Siris syndrome 1 in a Chinese family with excessive early-onset high myopia.

Coffin-Siris syndrome (CSS) is a rare autosomal dominant inheritance disorder characterized by distinctive facial features, hypoplasia of the distal phalanx or nail of the fifth and additional digits, developmental or cognitive delay of varying degree, hypotonia, hirsutism/hypertrichosis, sparse scalp hair and varying kind of congenital anomalies. CSS can easily be misdiagnosed as other syndromes or disorders with a similar clinical picture because of their genetic and phenotypic heterogeneity. We describde the genotype-phenotype correlation of one patient from a healthy Chinese family with a novel genotype underlying CSS, who was first diagnosed in the ophthalmology department as early-onset high myopia (eoHM). Comprehensive ophthalmic tests as well as other systemic examinations were performed on participants to confirm the phenotype. The genotype was identified using whole exome sequencing, and further verified the results among other family members by Sanger sequencing. Real-time quantitative PCR (RT-qPCR) technology was used to detect the relative mRNA expression levels of candidate genes between proband and normal family members. The pathogenicity of the identified variant was determined by The American College of Medical Genetics and Genomics (ACMG) guidelines. STRING protein-protein interactions (PPIs) network analysis was used to detect the interaction of candidate gene-related proteins with high myopia gene-related proteins. The patient had excessive eoHM, cone-rod dystrophy, coarse face, excessive hair growth on the face, sparse scalp hair, developmental delay, intellectual disability, moderate hearing loss, dental hypoplasia, patent foramen ovale, chronic non-atrophic gastritis, bilateral renal cysts, cisterna magna, and emotional outbursts with aggression. The genetic assessment revealed that the patient carries a de novo heterozygous frameshift insertion variant in the ARID1B c.3981dup (p.Glu1328ArgfsTer5), which are strongly associated with the typical clinical features of CSS patients. The test results of RT-qPCR showed that mRNA expression of the ARID1B gene in the proband was approximately 30% lower than that of the normal control in the family, suggesting that the variant had an impact on the gene function at the level of mRNA expression. The variant was pathogenic as assessed by ACMG guidelines. Analysis of protein interactions in the STRING online database revealed that the ARID1A protein interacts with the high myopia gene-related proteins FGFR3, ASXL1, ERBB3, and SOX4, whereas the ARID1A protein antagonizes the ARID1B protein. Therefore, in this paper, we are the first to report a de novo heterozygous frameshift insertion variant in the ARID1B gene causing CSS with excessive eoHM. Our study extends the genotypic and phenotypic spectrums for ARID1B-CSS and supplies evidence of significant association of eoHM with variant in ARID1B gene. As CSS has high genetic and phenotypic heterogeneity, our findings highlight the importance of molecular genetic testing and an interdisciplinary clinical diagnostic workup to avoid misdiagnosis as some disorders with similar manifestations of CSS.

De novel heterozygous copy number deletion on 7q31.31-7q31.32 involving TSPAN12 gene with familial exudative vitreoretinopathy in a Chinese family.

AIM: To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32. METHODS: A family with familial exudative vitreoretinopathy (FEVR) phenotype was included in the study. Whole-exome sequencing (WES) was initially used to locate copy number variations (CNVs) on 7q31.31-31.32, but failed to detect the precise breakpoint. The long-read sequencing, Oxford Nanopore sequencing Technology (ONT) was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction (QPCR) and Sanger Sequencing. RESULTS: The proband, along with her father and younger brother, were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32, which included the FEVR-related gene TSPAN12. The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del. The proband exhibited a phase 2A FEVR phenotype, characterized by a falciform retinal fold, macular dragging, and peripheral neovascularization with leaking of fluorescence. These symptoms led to a significant decrease in visual acuity in both eyes. On the other hand, the affected father and younger brother showed a milder phenotype. CONCLUSION: The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype. The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.

BEST1 novel mutation causes Bestrophinopathies in six families with distinct phenotypic diversity.

PURPOSE: To report novel BEST1 variants in six Chinese families with bestrophinopathies of two different inheritance modes and analyze the intrafamilial phenotypic diversity. METHOD: A total of 25 participants including 13 patients and 12 healthy family members from 6 Chinese families with bestrophinopathies were available for genetic and clinical analysis. All of the patients were subjected to comprehensive ophthalmic evaluations and exome sequencing was performed on the probands to detect the causative variants. The pathogenicity of gene variants was predicted using silico analysis and evaluated according to ACMG guidelines. All (likely) pathogenic variants were determined by Sanger sequencing and co-segregation analyses were performed on available family members. The relevant original literature previously reported was retrieved to explore the relationship between BEST1-related gene variants and clinical features. RESULTS: In the 6 families, 3 families (10 patients) were assigned as autosomal dominant bestrophinopathies (VMD) and 3 families (3 patients) were assigned as Autosomal recessive Bestrophinopathies (ARB). A total of 9 variants on the BEST1 gene were identified, containing 7 missense variants, 1 nonsense variant, and 1 frameshift variant, respectively, of which 3 variants c.88A > G (p.Lys30Glu), c.764G > A (p.Arg255Gln) and c.233dupT (p.Ser79Phefs*153) were novel variants. Three families with ARB were detected with heterozygous variants on the BEST1 gene.2 families (8 patients) with BVMD showed markedly irregular dominant inheritance, and the severity of macular lesions varies greatly among individuals of the same family. Among them, the probands showed typical vitelliform lesions in the macula, while the other six patients had no visible signs of the disease by fundus photography (ophthalmoscopy) and minor lesions could be detected on OCT in two patients, the continuity of the ellipsoidal band was interrupted with the chimeric band. The phenotypes of the patients in the three ARB families ranged from typical/atypical vitelliform lesions to extensive extramacular deposits (peripheral spots). CONCLUSION: This study provided evidence that the phenotype of BVMD manifested irregular dominant inheritance, with patients carrying a pathogenic heterozygous variant of BEST1 to develop obvious intrafamilial phenotypic diversity, and the patients who harbor two pathogenic alleles showed recessive inheritance bestrophinopathies with distinct phenotypic diversity. Our study also emphasized the importance of comprehensive genetic analysis in patients with bestrophinopathies, and in such challenging families with distinct intrafamilial phenotypic diversity, it shall provide novel insights into phenotypic assessments of bestrophinopathies, and contribute to better diagnosis, prognosis, and treatment for these patients.

Xp21 DNA microdeletion syndrome in a Chinese family: clinical features show retinitis pigmentosa and chronic granuloma.

Xp21 DNA microdeletion syndrome is a very rare disease characterized by retinitis pigmentosa (RP), chronic granulomatous disease (CGD), and McLeod syndrome (MLS). Due to the complex and diverse clinical manifestations, early diagnosis remains a challenge for many physicians. In this study, for the purpose of determining the pathogenic gene variants and definitive diagnosis in a patient medically backgrounded with RP and CGD from a normal Chinese family, whole-exome sequencing (WES) was performed in this proband and copy number variation (CNV) was further verified in other family members by qPCR. A genetic evaluation revealed that the short arm of the X chromosome in the proband had a deletion CNV Xp21.1p11.4 (37431123-38186681) of approximately 0.755 Mb in size, and contained three contiguous OMIM genes as X-linked Kx blood group antigen (XK), cytochrome b-245 beta chain (CYBB), and RP GTPase regulator (RPGR). The qPCR results confirmed the copy number loss in Xp21.1p11.4 present in the proband and his unaffected mother. According to the American College of Medical Genetics and Genomics (ACMG) guidelines for the CNV interpretation, the deletion of this segment was a pathogenic variant. Our results provided evidence that CNV deletion of Xp21.1p11.4 in the short arm of the X chromosome was a pathogenic variant in such Chinese RP and CGD family, and the McLeod phenotype was not yet available. This study suggests that genetic testing is essential for a definitive diagnosis, which should better assist physicians in prediction, diagnosis, genetic counseling, and guidance for Xp21 DNA microdeletion syndrome.

New pathogenic variants of ALMS1 gene in two Chinese families with Alström Syndrome.

PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.

Evaluating the association between MPDZ-NF1B rs1324183 and keratoconus in an independent northwestern Chinese population.

BACKGROUND: Keratoconus (KC) is a complex, non-inflammatory corneal degenerative disease. Although numerous studies have analyzed the correlation of SNP rs1324183, which located in MPDZ-NF1B gene, and KC in different populations, only few findings were repeated. In this study, to evaluate the association between rs1324183 and KC in a new independent Chinese population, we performed a replication study of the significantly associated rs1324183. METHODS: In total of 114 unrelated KC patients and 88 unrelated controls were recruited from Ningxia, China. We detected the genotypes and alleles of rs1324183 using PCR technology and Sanger sequencing and also analyzed the association between this locus and KC, its clinical parameters by statistical methods. RESULTS: The frequency of genotype AA (11, 9.6%) and genotypes containing allele A (47, 41.2%) of rs1324183 in KC were both higher than those of the control group. And genotype AA of rs1324183 conferred a higher risk of KC (OR > 1). Moreover, corneal parameter Belin/Ambrósio enhanced ectasia display final D value (BAD-D) had significant correlation (p = 0.002) with AA genotype of rs1324183 in KC. CONCLUSIONS: Our replication study indicates that the results of rs1324183 associated with KC in our population is robust and further better illustrates the significance of BAD-D as a diagnostic indicator for KC. rs1324183 should be considered as the first genetic mark of KC risk in its future diagnosis.

A novel stop codon mutation of TSPAN12 gene in Chinese patients with familial exudative vitreoretinopathy.

BACKGROUND: Familial exudative vitreoretinopathy (FEVR) is a group of inherited eye diseases characterized by premature arrest of retinal vessel development. The purpose of our study was to characterize the genetic causes and clinical features in eight Chinese families with FEVR using next-generation sequencing (NGS) technology. MATERIALS AND METHODS: Eight families with FEVR were included in genetic and clinical analyses. We screened the proband and the parents in eight pedigrees with FEVR using targeted NGS approach and in silico analysis to determine the causative mutation for their family's phenotype. RESULTS: Four cases (4/8, 50.0%) were confirmed to harbor mutations in known genes, including 3 novel mutations and one previously reported mutation. Among the detected mutations, TSPAN12 accounted for 75% (3/4). We identified a novel stop codon of TSPAN12, a heterozygous missense mutation NM_012338.4:c.633T>A, NP_036470.1:p.Tyr211Ter involved in highly conserved residues in the proband. Retrospective analysis of its clinical manifestation showed that the mutant carrier presented mild clinical features. CONCLUSIONS: We found the novel stop codon mutation p.Tyr211Ter in the TSPAN12, which creates a milder phenotype. Discovery of this novel mutation expands the mutation spectrum of TSPAN12, and would be valuable for future genetic disease diagnosis.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.