Iron-loaded cancer-associated fibroblasts induce immunosuppression in prostate cancer.

Iron is an essential biomineral in the human body. Here, we describe a subset of iron-loaded cancer-associated fibroblasts, termed as FerroCAFs, that utilize iron to induce immunosuppression in prostate cancer and predict an unfavorable clinical outcome. FerroCAFs secrete myeloid cell-associated proteins, including CCL2, CSF1 and CXCL1, to recruit immunosuppressive myeloid cells. We report the presence of FerroCAFs in prostate cancer from both mice and human, as well as in human lung and ovarian cancers, and identify a conserved cell surface marker, the poliovirus receptor. Mechanistically, the accumulated iron in FerroCAFs is caused by Hmox1-mediated iron release from heme degradation. The intracellular iron activates the Kdm6b, an iron-dependent epigenetic enzyme, to induce an accessible chromatin state and transcription of myeloid cell-associated protein genes. Targeting the FerroCAFs by inhibiting the Hmox1/iron/Kdm6b signaling axis incurs anti-tumor immunity and tumor suppression. Collectively, we report an iron-loaded FerroCAF cluster that drives immunosuppression through an iron-dependent epigenetic reprogramming mechanism and reveal promising therapeutic targets to boost anti-tumor immunity.

Hierarchical Porous Bi2Te3@C for Wide-Temperature-Range Aqueous Zn-Based Batteries with Air-Recharging Capability.

Air-rechargeable batteries integrating energy harvesting, conversion, and storage provide the most portable and popular approach to self-charging power systems. However, air-rechargeable batteries are currently mostly aqueous Zn-based battery systems in which it has remained a significant challenge to solve the low discharge capacities and poor cycling stability of chemical self-charging due to continuous insertion/extraction of large-size hydrated Zn2+. Herein, efficient Bi2Te3@C cathodes with an active carbon paper substrate are developed. Further ex situ characterization analysis confirms the energy storage mechanism regarding the coexistence of H+/Zn2+ coinsertion and conversion reaction in the aqueous Zn||Bi2Te3@C battery. Benefiting from the fast dynamics process attributed to the unique mechanism, a reliable energy supply is provided even in an extended temperature range from -10 to 45 °C. More importantly, Bi2Te3@C cathodes boost the superior and repeatable air-rechargeability. A discharge capacity of up to 264.20 mA h g-1 at 0.30 A g-1 is manifested after self-charging for 11.00 h. In addition, two quasi-solid-state battery devices are connected in series to continuously power a timer. After the device is discharged and then air self-charged for just a few seconds, an LED is lit.

The origin and morphological character evolution of the paleotropical woody bamboos.

The woody bamboos (Bambusoideae) exhibit distinctive biological traits within Poaceae, such as highly lignified culms, rapid shoot growth, monocarpic mass flowering and nutlike or fleshy caryopses. Much of the remarkable morphological diversity across the subfamily exists within a single hexaploid clade, the paleotropical woody bamboos (PWB), making it ideal to investigate the factors underlying morphological evolution in woody bamboos. However, the origin and biogeographical history of PWB remain elusive, as does the effect of environmental factors on the evolution of their morphological characters. We generated a robust and time-calibrated phylogeny of PWB using single nucleotide polymorphisms retrieved from optimized double digest restriction site associated DNA sequencing, and explored the evolutionary trends of habit, inflorescence, and caryopsis type in relation to environmental factors including climate, soil, and topography. We inferred that the PWB started to diversify across the Oligocene-Miocene boundary and formed four major clades, that is, Melocanninae, Racemobambosinae s.l. (comprising Dinochloinae, Greslanlinae, Racemobambosinae s.str. and Temburongiinae), Hickeliinae and Bambusinae s.l. (comprising Bambusinae s.str. plus Holttumochloinae). The ancestor of PWB was reconstructed as having erect habit, indeterminate inflorescence and basic caryopsis. The characters including climbing/scrambling habit, determinate inflorescence, and nucoid/bacoid caryopsis have since undergone multiple changes and reversals during the diversification of PWB. The evolution of all three traits was correlated with, and hence likely influenced by, aspects of climate, topography, and soil, with climate factors most strongly correlated with morphological traits, and soil factors least so. However, topography had more influence than climate or soil on the evolution of erect habit, whereas both factors had greater effect on the evolution of bacoid caryopsis than did soil. Our results provide novel insights into morphological diversity and adaptive evolution in bamboos for future ecological and evolutionary research.

An ultrasensitive dual-mode aptasensor for patulin based on the upconversion particles and G-Quadruplex-hemin DNAzyme.

Patulin (PAT) is a mycotoxin-produced secondary metabolite that can contaminate foods, causing toxic effects on animal and human health. Therefore, for the first time, we have constructed a "turn-on" dual-mode aptamer sensor for PAT using oleic acid-coated upconversion nanomaterials (OA-UCNPs) and G-Quadruplex-hemin DNAzyme (G4-DNAzyme) as fluorescent and colorimetry probes. The sensor employs aptamers binding to PAT as recognition elements for specific molecule detection. Mxene-Au can be used as a biological inducer to assist OA-UCNPs in controlling fluorescence intensity. In addition, colorimetric signal amplification was performed using the trivalent G4-DNAzyme to increase detection sensitivity and reduce false positives. Under optimal conditions, the dual-mode aptasensor has a detection limit of 5.3 pg mL-1 in fluorescence and 2.4 pg mL-1 in colorimetric methods, respectively, with the wider linear range and limit of detection (LOD) of the colorimetric assay. The combination aptasensor can detect PAT with high sensitivity and high specificity and has broad application prospects in the field of food safety detection.

Recurrent bladder urothelial carcinoma complicated with primary bladder large cell neuroendocrine carcinoma: a case report and literature review.

Objective: To improve the understanding, diagnosis and treatment of bladder large cell neuroendocrine carcinoma (LCNEC). Methods: A clinical case of bladder LCNEC admitted to our hospital was reported. The epidemiology, prognosis, diagnosis and treatment methods of large cell neuroendocrine carcinoma were reviewed. The diagnosis and treatment status and prognosis were discussed based on the literature. Results: The female patient was admitted to hospital for "more than 4 years after TURBT and intermittent hematuria for more than 2 years". She was diagnosed as recurrent bladder cancer and underwent "radical cystotomy + hysterectomy". The postoperative pathological findings were high-grade urothelial carcinoma of the bladder neck and large cell neuroendocrine carcinoma of the bladder. The patient recovered well after surgery, but refused radiotherapy and chemotherapy and is still under close follow-up. Conclusion: Bladder LCNEC is clinically rare, has unique pathological features, is more aggressive than traditional urothelial carcinoma, and has a poor prognosis. Surgery, chemotherapy and radiotherapy should be combined with multi-mode treatment.

[Progress on iron metabolism and ferroptosis in macrophages].

Macrophages play vital roles in iron metabolism and are also modulated by iron. Macrophages are crucial to the recycling of iron and systemic iron homeostasis, and the functional heterogeneity of macrophages contributes to the different effects on iron metabolism. Conversely, iron can affect the development, function, and polarization of macrophages. Macrophages can initiate ferroptosis through a series of signaling pathways when overloaded with intracellular iron. Macrophages ferroptosis can aggravate local inflammatory reactions and promote the progression of various diseases such as metabolism, infection, and inflammation, so inhibiting macrophages ferroptosis may be an important therapeutic target. In addition, inhibiting M1-like macrophages ferroptosis and promoting M2-like macrophages ferroptosis are important in inhibiting the progression of malignant tumors.

Lateral flow assay for simultaneous detection of multiple mycotoxins using nanozyme to amplify signals.

Co-contamination of multiple mycotoxins produces synergistic toxic effects, leading to more serious hazards. Therefore, the simple, rapid and accurate simultaneous detection of multiple mycotoxins is crucial. Herein, a three-channel aptamer-based lateral flow assay (Apt-LFA) was established for the detection of aflatoxin M1 (AFM1), aflatoxin B1 (AFB1) and ochratoxin A (OTA). The multi-channel Apt-LFA utilized gold­iridium nanozyme to catalyze the chromogenic substrate, which effectively achieved signal amplification. Moreover, the positions and lengths of the complementary sequences were screened by changes in fluorescence intensity. After grayscale analysis, the semi-quantitative results showed that the detection limits of AFM1, AFB1 and OTA were 0.39 ng/mL, 0.36 ng/mL and 0.82 ng/mL. The recoveries of the multiplexed competitive sensors in complex matrices of real samples were 93.33%-97.01%, 95.72%-102.67%, and 106.88%-109.33%, respectively. In conclusion, the assembly principle of the three-channel Apt-LFA is simple, which can provide a new idea for the simultaneous detection of small molecule targets.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

5†kW power-level 1050†nm narrow-linewidth fiber amplifier enabled by biconical-tapered active fiber.

Effective wavelength extension is vital in the applications of high-power narrow-linewidth fiber lasers. In this work, we demonstrate a 5-kW power-level narrow-linewidth fiber amplifier at 1050 nm utilizing a homemade biconical-tapered Yb-doped fiber (BT-YDF). Up to ∼4.96 kW fiber laser is achieved with a 3 dB linewidth of ∼0.54 nm and a beam quality factor of Mx 2 = 1.46, My 2 = 1.6. The experimental comparisons reveal that BT-YDF has the advantages of improving a stimulated Raman scattering threshold and balancing transverse mode instability suppression in the fiber amplifier. This work could provide a good reference for extending the operating wavelength of high-power fiber amplifiers.

General error analysis of matrix-operation-mode decomposition technique in few-mode fiber laser.

The mode decomposition based on matrix operation (MDMO) is one of the fastest mode decomposition (MD) techniques, which is important to the few-mode fiber laser characterization and its applications. In this paper, the general error of the MDMO technique was analyzed, where different influencing factors, such as position deviation of the optical imaging system, coordinate deviation of the image acquisition system, aberrations, and mode distortion were considered. It is found that the MDMO technique based on far-field intensity distribution is less affected by optical imaging system position deviation, coordinate deviation of the image acquisition system, and mode distortion than those based on direct near-field decomposition. But far-field decomposition is more affected by aberration than those based on near-field decomposition. In particular, the numerical results show that the deviation of the coordinate axis direction is an important factor limiting the accuracy of MD. In addition, replacing the ideal eigenmode basis with a distorted eigenmode basis can effectively suppress the decrease in mode decomposition accuracy caused by fiber bending. Moreover, based on detailed numerical analysis results, fitting formulas for estimating the accuracy of the MDMO technique with imperfections are also provided, which provides a comprehensive method for evaluating the accuracy of the MDMO technique in practical engineering operations.

Evaluation of the impact of weak end feedback on the SBS threshold in high-power narrow-linewidth fiber amplifiers.

In this work, we quantitatively investigate the SBS threshold in high-power narrow-linewidth fiber amplifiers seeded with phase-modulated single-frequency lasers in presence of weak end feedback. The impacts of the end feedback and spectral linewidths on the SBS threshold are demonstrated in detail through comparative experiments and numerical simulations, respectively. In the experiment, we have pointed out a practical method to estimate the end reflectivity in high-power fiber amplifiers. Based on this estimation, the SBS threshold characters of the high-power narrow-linewidth fiber amplifiers with different end reflectivity and seed linewidths are investigated. By reducing the end reflectivity, a 2.85 times SBS threshold enhancement has been achieved at the most susceptible linewidth (16.8 GHz). Furthermore, we propose a spectral evolution model to investigate the SBS threshold in high-power narrow-linewidth fiber amplifiers, which is even capable for calculating SBS thresholds of the systems with tens of GHz linewidth while weak end reflection is considered. The simulation results demonstrate that end reflection will obviously affect the SBS threshold when the linewidth of the seed laser is broadened beyond 5 GHz, especially for the spectral linewidth of seed lasers nearing the Brillouin frequency shift. Besides, when the end reflectivity is set to be stronger than -65 dB, the SBS threshold performs a tendency to decline and then rise with the growth of seed linewidth. The experiment and simulation results provide a new optimization sight for the SBS effect suppression in high-power narrow-linewidth fiber amplifiers.

Early Detection of Pipeline Natural Gas Leakage from Hyperspectral Imaging by Vegetation Indicators and Deep Neural Networks.

The timely detection of underground natural gas (NG) leaks in pipeline transmission systems presents a promising opportunity for reducing the potential greenhouse gas (GHG) emission. However, existing techniques face notable limitations for prompt detection. This study explores the utility of Vegetation Indicators (VIs) to reflect vegetation health deterioration, thereby representing leak-induced stress. Despite the acknowledged potential of VIs, their sensitivity and separability remain understudied. In this study, we employed ground vegetation as biosensors for detecting methane emissions from underground pipelines. Hyperspectral imaging from vegetation was collected weekly at both plant and leaf scales over two months to facilitate stress detection using VIs and Deep Neural Networks (DNNs). Our findings revealed that plant pigment-related VIs, modified chlorophyll absorption reflectance index (MCARI), exhibit commendable sensitivity but limited separability in discerning stressed grasses. A NG-specialized VI, the optimized soil-adjusted vegetation index (OSAVI), demonstrates higher sensitivity and separability in early detection of methane leaks. Notably, the OSAVI proved capable of discriminating vegetation stress 21 days after methane exposure initiation. DNNs identified the methane leaks following a 3-week methane treatment with an accuracy of 98.2%. DNN results indicated an increase in visible (VIS) and a decrease in near-infrared (NIR) in spectra due to methane exposure.

A fused multi-subfrequency bands and CBAM SSVEP-BCI classification method based on convolutional neural network.

For the brain-computer interface (BCI) system based on steady-state visual evoked potential (SSVEP), it is difficult to obtain satisfactory classification performance for short-time window SSVEP signals by traditional methods. In this paper, a fused multi-subfrequency bands and convolutional block attention module (CBAM) classification method based on convolutional neural network (CBAM-CNN) is proposed for discerning SSVEP-BCI tasks. This method extracts multi-subfrequency bands SSVEP signals as the initial input of the network model, and then carries out feature fusion on all feature inputs. In addition, CBAM is embedded in both parts of the initial input and feature fusion for adaptive feature refinement. To verify the effectiveness of the proposed method, this study uses the datasets of Inner Mongolia University of Technology (IMUT) and Tsinghua University (THU) to evaluate the performance of the proposed method. The experimental results show that the highest accuracy of CBAM-CNN reaches 0.9813 percentage point (pp). Within 0.1-2 s time window, the accuracy of CBAM-CNN is 0.0201-0.5388 (pp) higher than that of CNN, CCA-CWT-SVM, CCA-SVM, CCA-GNB, FBCCA, and CCA. Especially in the short-time window range of 0.1-1 s, the performance advantage of CBAM-CNN is more significant. The maximum information transmission rate (ITR) of CBAM-CNN is 503.87 bit/min, which is 227.53 bit/min-503.41 bit/min higher than the above six EEG decoding methods. The study further results show that CBAM-CNN has potential application value in SSVEP decoding.

A brain functional network feature extraction method based on directed transfer function and graph theory for MI-BCI decoding tasks.

Background: The development of Brain-Computer Interface (BCI) technology has brought tremendous potential to various fields. In recent years, prominent research has focused on enhancing the accuracy of BCI decoding algorithms by effectively utilizing meaningful features extracted from electroencephalographic (EEG) signals. Objective: This paper proposes a method for extracting brain functional network features based on directed transfer function (DTF) and graph theory. The method incorporates the extracted brain network features with common spatial pattern (CSP) to enhance the performance of motor imagery (MI) classification task. Methods: The signals from each electrode of the EEG, utilizing a total of 32 channels, are used as input signals for the network nodes. In this study, 26 healthy participants were recruited to provide EEG data. The brain functional network is constructed in Alpha and Beta bands using the DTF method. The node degree (ND), clustering coefficient (CC), and global efficiency (GE) of the brain functional network are obtained using graph theory. The DTF network features and graph theory are combined with the traditional signal processing method, the CSP algorithm. The redundant network features are filtered out using the Lasso method, and finally, the fused features are classified using a support vector machine (SVM), culminating in a novel approach we have termed CDGL. Results: For Beta frequency band, with 8 electrodes, the proposed CDGL method achieved an accuracy of 89.13%, a sensitivity of 90.15%, and a specificity of 88.10%, which are 14.10, 16.69, and 11.50% percentage higher than the traditional CSP method (75.03, 73.46, and 76.60%), respectively. Furthermore, the results obtained with 8 channels were superior to those with 4 channels (82.31, 83.35, and 81.74%), and the result for the Beta frequency band were better than those for the Alpha frequency band (87.42, 87.48, and 87.36%). Similar results were also obtained on two public datasets, where the CDGL algorithm's performance was found to be optimal. Conclusion: The feature fusion of DTF network and graph theory features enhanced CSP algorithm's performance in MI task classification. Increasing the number of channels allows for more EEG signal feature information, enhancing the model's sensitivity and discriminative ability toward specific activities in brain regions. It should be noted that the functional brain network features in the Beta band exhibit superior performance improvement for the algorithm compared to those in the Alpha band.

Unprecedented variation pattern of plastid genomes and the potential role in adaptive evolution in Poales.

BACKGROUND: The plastid is the photosynthetic organelle in plant cell, and the plastid genomes (plastomes) are generally conserved in evolution. As one of the most economically and ecologically important order of angiosperms, Poales was previously documented to exhibit great plastomic variation as an order of photoautotrophic plants. RESULTS: We acquired 93 plastomes, representing all the 16 families and 5 major clades of Poales to reveal the extent of their variation and evolutionary pattern. Extensive variation including the largest one in monocots with 225,293 bp in size, heterogeneous GC content, and a wide variety of gene duplication and loss were revealed. Moreover, rare occurrences of three inverted repeat (IR) copies in angiosperms and one IR loss were observed, accompanied by short IR (sIR) and small direct repeat (DR). Widespread structural heteroplasmy, diversified inversions, and unusual genomic rearrangements all appeared in Poales, occasionally within a single species. Extensive repeats in the plastomes were found to be positively correlated with the observed inversions and rearrangements. The variation all showed a "small-large-moderate" trend along the evolution of Poales, as well as for the sequence substitution rate. Finally, we found some positively selected genes, mainly in C4 lineages, while the closely related lineages of those experiencing gene loss tended to have undergone more relaxed purifying selection. CONCLUSIONS: The variation of plastomes in Poales may be related to its successful diversification into diverse habitats and multiple photosynthetic pathway transitions. Our order-scale analyses revealed unusual evolutionary scenarios for plastomes in the photoautotrophic order of Poales and provided new insights into the plastome evolution in angiosperms as a whole.

Comprehensive multi-omics analysis of resectable locally advanced gastric cancer: Assessing response to neoadjuvant camrelizumab and chemotherapy in a single-center, open-label, single-arm phase II trial.

BACKGROUND: The current standard of care for locally advanced gastric cancer (GC) involves neoadjuvant chemotherapy followed by radical surgery. Recently, neoadjuvant treatment for this condition has involved the exploration of immunotherapy plus chemotherapy as a potential approach. However, the efficacy remains uncertain. METHODS: A single-arm, phase 2 study was conducted to evaluate the efficacy and tolerability of neoadjuvant camrelizumab combined with mFOLFOX6 and identify potential biomarkers of response through multi-omics analysis in patients with resectable locally advanced GC. The primary endpoint was the pathological complete response (pCR) rate. Secondary endpoints included the R0 rate, near pCR rate, progression-free survival (PFS), disease-free survival (DFS), and overall survival (OS). Multi-omics analysis was assessed by whole-exome sequencing, transcriptome sequencing, and multiplex immunofluorescence (mIF) using biopsies pre- and post-neoadjuvant therapy. RESULTS: This study involved 60 patients, of which 55 underwent gastrectomy. Among these, five (9.1%) attained a pathological complete response (pCR), and 11 (20.0%) reached near pCR. No unexpected treatment-emergent adverse events or perioperative mortality were observed, and the regimen presented a manageable safety profile. Molecular changes identified through multi-omics analysis correlated with treatment response, highlighting associations between HER2-positive and CTNNB1 mutations with treatment sensitivity and a favourable prognosis. This finding was further supported by immune cell infiltration analysis and mIF. Expression data uncovered a risk model with four genes (RALYL, SCGN, CCKBR, NTS) linked to poor response. Additionally, post-treatment infiltration of CD8+ T lymphocytes positively correlates with pathological response. CONCLUSION: The findings suggest the combination of PD-1-inhibitor and mFOLFOX6 showed efficacy and acceptable toxicity for locally advanced GC. Extended follow-up is required to determine the duration of the response. This study lays essential groundwork for developing precise neoadjuvant regimens.

The "quadrant-sandwich" method in clockwise modular D2 lymph node dissection in laparoscopic total gastrectomy: a retrospective cohort study.

Background: For patients who need laparoscopic radical gastrectomy, lymph node dissection (LND) and optimization of surgical procedures are particularly important. This study introduces the "quadrant-sandwich" method in clockwise modular D2 LND and evaluates the advantages and safety of this method. Methods: The clinical data of 108 laparoscopic total gastrectomy patients admitted to the Affiliated Cancer Hospital of Zhengzhou University from January 2019 to January 2022 were retrospectively analyzed. Based on the different LND processes, 55 patients were allocated to the observation group, which underwent clockwise modular LND using the "quadrant-sandwich method", and 53 patients were allocated to the control group, which underwent traditional LND. The effectiveness and safety of the approach in terms of operation time, blood loss, lymph node yield, postoperative recovery and postoperative complications were observed in the two groups. Results: There was no statistical difference between the baseline data of the two groups. In relation to the surgery, the observation group had an operation time of 227.0±48.5 minutes, and intraoperative bleeding of 100.0 mL [inter-quartile range (IQR), 30.0-200.0 mL], while the control group had an operation time of 247±41.5 minutes, and intraoperative bleeding of 180.0 mL (IQR, 130.0-245.0 mL). There were statistically significant differences between the two groups in terms of the operation time and intraoperative bleeding (P=0.001, P=0.020). In relation to the LND, there were no statistically significant differences between the two groups in terms of the total number of lymph nodes in each division, and the number of positive lymph nodes. In relation to the post-operative results, there were no statistically significant differences between the two groups in terms of the post-operative pathological stage, first postoperative oral feeding, post-operative hospitalization time, and post-operative complications. Conclusions: Clockwise modular D2 LND using the "quadrant-sandwich method" is potentially safe and feasible in laparoscopic total gastrectomy. It not only ensures the thoroughness of the LND, but also ensures and efficient and fast surgical process, shortens the operation time, and reduces the amount of intraoperative bleeding.

Postoperative superior anastomotic leakage classification and treatment strategy for postoperative esophagogastric junction cancer.

Background: At present, anastomotic fistula cannot be avoided after adenocarcinoma of the esophagogastric junction (AEG). Once the anastomotic leakage occurs, the posterior mediastinum and the left thoracic cavity are often seriously infected, which further impairs respiratory and circulatory function, heightening the danger of the disease course. The aim of this study was to identify the characteristics of superior anastomotic leakage after surgery for AEG and recommend corresponding treatment strategies to improve the diagnosis and treatment of superior anastomotic leakage after surgery for AEG. Methods: The clinical data of 57 patients with superior anastomotic leakage after surgery for AEG in the Affiliated Cancer Hospital of Zhengzhou University from January 2017 to March 2019 were retrospectively analyzed, including 27 cases referred from external hospitals and 30 cases at the Affiliated Cancer Hospital of Zhengzhou University. According to the diameter and risk level of anastomotic leakage, the high anastomotic leakage is divided into types I, II, III, and IV. Results: Patients with preoperative comorbidities or those treated with the transabdominal approach or laparoscopic surgery often had type I and type II anastomotic leakage; meanwhile, patients with preoperative comorbidities and sacral perforation or those treated with a thoracic and abdominal approach or open surgery often had type III and IV fistula. The difference between types I-II and types III-IV was statistically significant (P<0.05). The mortality rate of patients with type III and type IV leakage was 14.8% within 90 days after operation, while no deaths occurred among patients with type I and type II leakage, and the difference in mortality between the two groups was statistically significant (P<0.05). Conclusions: After surgery for AEG, suitable treatment measures should be adopted according to the type of superior anastomotic leakage that occurs. Types III and IV superior anastomotic leakages are associated with higher mortality and require greater attention from surgeons.

Retrospective study of combined pelvic exenteration in the treatment of primary and recurrent pelvic malignant tumors.

Background: Pelvic malignant tumors often originate in the rectum, bladder, uterus, and other organs. In patients with locally advanced tumours in the presence of direct invasion of one or more organs, negative tumor resection margin (R0) resection can be very beneficial to patient survival if it can be performed. As a multidisciplinary and high-risk surgical method, the pelvic exenteration (PE) procedure has only been reported in a few medical centres internationally. We retrospectively analyzed the clinical data of patients who had undergone PE surgery in our hospital, in order to provide ideas for the best treatment of patients with pelvic malignant tumors. Methods: A retrospective analysis was conducted of 59 patients with pelvic malignant tumors admitted to the Affiliated Cancer Hospital of Zhengzhou University from January 2015 to July 2021, all of whom received PE surgery. They were divided into two groups according to the location of the disease: the rectal cancer group (n=40) and the cervical cancer group (n=19). Statistical analysis was performed on the baseline and follow-up data of the two groups of patients. Results: (I) Patient baseline data. Compared to the rectal cancer group, more patients in the cervical cancer group received preoperative radiotherapy and chemotherapy (P=0.013), and had a lower R0 resection rate (P=0.037). Postoperative complications in patients with rectal cancer and cervical cancer were 27.5% and 47.3%, respectively. (II) Patient survival analysis after PE surgery. The 5-year survival rate was 36.6% in the rectal cancer group and 25.3% in the cervical cancer group. In the rectal cancer group, for the primary tumor, if there was no lymph node metastasis or no postoperative complications in the postoperative pathology, the patient had a good survival prognosis. Univariate analysis showed that recurrent rectal cancer, postoperative lymph node metastasis, postoperative complications, and microsatellite stability (MSS) were significant predictors of poor survival outcomes. Multivariate analysis showed that lymph node metastasis and postoperative complications were independent prognostic factors for patient survival. Conclusions: PE is a viable option for pelvic malignancies; aggressive radical resection of lesions and reduced postoperative complications can effectively improve patient outcomes.