Short-Term Training with Basic Science Research Literature Advances Medical Students' Skills for Adaptive Expertise.

Physicians must adapt their learning and expertise to the rapid evolution of healthcare. To train for the innovation-efficient demands of adaptive expertise, medical students need to acquire the skill of adaptive self-regulated learning, which includes accessing, interpreting, and synthesizing emerging basic and translational research to support patient care. In response, we developed the course Medical Student Grand Rounds (MSGR). It engages all pre-clerkship students at our institution with self-regulated learning from translational basic research literature. In this report, we describe MSGR's methodology and important outcomes. Students found, interpreted, critically assessed, and presented basic research literature about self-selected clinically relevant topics. In less than one semester and mentored by basic science researchers, they completed eight milestones: (a) search research literature databases; (b) choose a clinical topic using searching skills; (c) outline the topic's background; (d) outline a presentation based on the topic's mechanistic research literature; (e) attend translational research-oriented grand rounds by faculty; (f) learn to prepare oral presentations; (g) write an abstract; and (h) present at Grand Rounds Day, emphasizing their topic's research literature. Graded milestones and end-of-course self-assessments indicated students became proficient in interpreting research articles, preparing and delivering presentations, understanding links among basic and translational research and clinical applications, and pursuing self-regulated learning. Qualitative analysis of self-assessment surveys found most students thought they progressed toward the learning objectives: find scientific information about a research topic (56% positive responses), interpret and critically assess scientific information (64%), and prepare and deliver a scientific presentation (50%). Milestones improve time management and provide a scaffolded method for presenting focused research topics. MSGR equips students with critical thinking skills for lifelong, adaptive, self-regulated learning-a foundation for adaptive expertise. The master adaptive learner cycle of planning, learning, assessing, and adjusting is a conceptual framework for understanding students' MSGR learning experiences.

Cost-effectiveness of an Emergency Department-Based Intensive Care Unit.

Importance: Value in health care is quality per unit cost (V = Q/C), and an emergency department-based intensive care unit (ED-ICU) model has been associated with improved quality. To assess the value of this care delivery model, it is essential to determine the incremental direct cost of care. Objective: To determine the association of an ED-ICU with inflation-adjusted change in mean direct cost of care, net revenue, and direct margin per ED patient encounter. Design, Setting, and Participants: This retrospective economic analysis evaluated the cost of care delivery to patients in the ED before and after deployment of the Joyce and Don Massey Family Foundation Emergency Critical Care Center, an ED-ICU, on February 16, 2015, at a large academic medical center in the US with approximately 75 000 adult ED visits per year. The pre-ED-ICU cohort was defined as all documented ED visits by patients 18 years or older with a complete financial record from September 8, 2012, through June 30, 2014 (660 days); the post-ED-ICU cohort, all visits from July 1, 2015, through April 21, 2017 (660 days). Fiscal year 2015 was excluded from analysis to phase in the new care model. Statistical analysis was performed March 1 through December 30, 2021. Exposures: Implementation of an ED-ICU. Main Outcomes and Measures: Inflation-adjusted direct cost of care, net revenue, and direct margin per patient encounter in the ED. Results: A total of 234 884 ED visits during the study period were analyzed, with 115 052 patients (54.7% women) in the pre-ED-ICU cohort and 119 832 patients (54.5% women) in the post-ED-ICU cohort. The post-ED-ICU cohort was older (mean [SD] age, 49.1 [19.9] vs 47.8 [19.6] years; P < .001), required more intensive respiratory support (2.2% vs 1.1%; P < .001) and more vasopressor use (0.5% vs 0.2%; P < .001), and had a higher overall case mix index (mean [SD], 1.7 [2.0] vs 1.5 [1.7]; P < .001). Implementation of the ED-ICU was associated with similar inflation-adjusted total direct cost per ED encounter (pre-ED-ICU, mean [SD], $4875 [$15 175]; post-ED-ICU, $4877 [$17 400]; P = .98). Inflation-adjusted net revenue per encounter increased by 7.0% (95% CI, 3.4%-10.6%; P < .001), and inflation-adjusted direct margin per encounter increased by 46.6% (95% CI, 32.1%-61.2%; P < .001). Conclusions and Relevance: Implementation of an ED-ICU was associated with no significant change in inflation-adjusted total direct cost per ED encounter. Holding delivery costs constant while improving quality demonstrates improved value via the ED-ICU model of care.

Guiding Preclinical Medical Students in Finding, Synthesizing, and Communicating Translational Basic Research Literature: Roles for Basic Science Research Mentors.

PROBLEM: Understanding and communicating medical advances driven by basic research, and acquiring foundational skills in critically appraising and communicating translational basic research literature that affects patient care, are challenging for medical students to develop. APPROACH: The authors developed a mandatory course from 2012 to 2018 at Texas A&M University College of Medicine to address this problem. Medical Student Grand Rounds (MSGR) trains first-year students to find, critically assess, and present primary research literature about self-selected medically relevant topics. With basic science faculty mentoring, students completed milestones culminating in oral presentations. Students learned to search literature databases and then choose a clinical subject using these skills. They outlined the clinical subject area background and a mechanistic research topic into a clinical problem based on deeper evaluation of primary research literature. "Mechanistic" was defined in this context as providing experimental evidence that explained the "how" and "why" underlying clinical manifestations of a disease. Students received evaluations and feedback from mentors about discerning the quality of information and synthesizing information on their topics. Finally, students prepared and gave oral presentations, emphasizing the primary literature on their topics. OUTCOMES: In the early stages of the course development, students had difficulty critically assessing and evaluating research literature. Mentored training by research-oriented faculty, however, dramatically improved student perceptions of the MSGR experience. Mentoring helped students develop skills to synthesize ideas from basic research literature. According to grades and self-evaluations, students increased proficiency in finding and interpreting research articles, preparing and delivering presentations, and understanding links among basic and translational research and clinical applications. NEXT STEPS: The authors plan to survey fourth-year students who have completed MSGR about their perceptions of the course in the context of clinical experiences in medical school to guide future refinements.

Proteomic profiling of endothelial invasion revealed receptor for activated C kinase 1 (RACK1) complexed with vimentin to regulate focal adhesion kinase (FAK).

Angiogenesis is critical for many physiological and pathological processes. To identify molecules relevant to angiogenesis, we performed a proteomic screen comparing invading versus non-invading endothelial cells in three-dimensional collagen matrices. We found up-regulated levels of receptor for activated C kinase 1 (RACK1) and the intermediate filament protein vimentin that correlated with increased endothelial cell invasion. Because both RACK1 and vimentin have been linked to focal adhesion kinase (FAK), we investigated whether this pathway regulated invasion. RACK1 depletion reduced invasion responses, and this was associated with attenuated activation of FAK. Knockdown of vimentin significantly decreased levels of phosphorylated and total FAK. Treatment with a pharmacological inhibitor of FAK dose-dependently reduced invasion, indicating a crucial role for FAK activity during invasion. Because RACK1 and vimentin were both up-regulated with sphingosine 1-phosphate treatment, required for invasion, and regulated FAK, we tested whether they complexed together. RACK1 complexed with vimentin, and growth factors enhanced this interaction. In addition, RACK1, vimentin, and FAK formed an intermolecular complex in invading endothelial cultures in three dimensions in response to stimulation by sphingosine 1-phosphate and growth factors. Moreover, depletion of RACK1 decreased the association of vimentin and FAK, suggesting that RACK1 was required for stabilizing vimentin-FAK interactions during sprouting. Silencing of vimentin and RACK1 decreased cell adhesion and focal contact formation. Taken together, these results demonstrate that proangiogenic signals converge to enhance expression and association of RACK1 and vimentin, which regulated FAK, resulting in successful endothelial sprout formation in three-dimensional collagen matrices.

Non-Hodgkin's B-cell lymphoma: advances in molecular strategies targeting drug resistance.

Non-Hodgkin's lymphoma (NHL) is a heterogeneous class of cancers displaying a diverse range of biological phenotypes, clinical behaviours and prognoses. Standard treatments for B-cell NHL are anthracycline-based combinatorial chemotherapy regimens composed of cyclophosphamide, doxorubicin, vincristine and prednisolone. Even though complete response rates of 40-50% with chemotherapy can be attained, a substantial proportion of patients relapse, resulting in 3-year overall survival rates of about 30%. Relapsed lymphomas are refractory to subsequent treatments with the initial chemotherapy regimen and can exhibit cross-resistance to a wide variety of anticancer drugs. The emergence of acquired chemoresistance thus poses a challenge in the clinic preventing the successful treatment and cure of disseminated B-cell lymphomas. Gene-expression analyses have increased our understanding of the molecular basis of chemotherapy resistance and identified rational targets for drug interventions to prevent and treat relapsed/refractory diffuse large B-cell lymphoma. Acquisition of drug resistance in lymphoma is in part driven by the inherent genetic heterogeneity and instability of the tumour cells. Due to the genetic heterogeneity of B-cell NHL, many different pathways leading to drug resistance have been identified. Successful treatment of chemoresistant NHL will thus require the rational design of combinatorial drugs targeting multiple pathways specific to different subtypes of B-cell NHL as well as the development of personalized approaches to address patient-to-patient genetic heterogeneity. This review highlights the new insights into the molecular basis of chemorefractory B-cell NHL that are facilitating the rational design of novel strategies to overcome drug resistance.

Calpain-mediated vimentin cleavage occurs upstream of MT1-MMP membrane translocation to facilitate endothelial sprout initiation.

Endothelial cells normally line the vasculature and remain quiescent. However, these cells can be rapidly stimulated to undergo morphogenesis and initiate new blood vessel formation given the proper cues. This study reports a new mechanism for initiating angiogenic sprout formation that involves vimentin, the major intermediate filament protein in endothelial cells. Initial studies confirmed vimentin was required for sphingosine 1-phosphate (S1P)- and growth factor (GF)-induced endothelial cell invasion, and vimentin was cleaved by calpains during invasion. Calpains were predominantly activated by GF and were required for sprout initiation. Because others have reported membrane type 1-matrix metalloproteinase (MT1-MMP) is required for endothelial sprouting responses, we tested whether vimentin and calpain acted upstream of MT1-MMP. Both calpain and vimentin were required for successful MT1-MMP membrane translocation, which was stimulated by S1P. In addition, vimentin complexed with MT1-MMP in a manner that required both the cytoplasmic domain of MT1-MMP and calpain activation, which increased the soluble pool of vimentin in endothelial cells. Altogether, these data indicate that pro-angiogenic signals converge to activate calpain-dependent vimentin cleavage and increase vimentin solubility, which act upstream to facilitate MT1-MMP membrane translocation, resulting in successful endothelial sprout formation in three-dimensional collagen matrices. These findings help explain why S1P and GF synergize to stimulate robust sprouting in 3D collagen matrices.

Akt, 14-3-3ζ, and vimentin mediate a drug-resistant invasive phenotype in diffuse large B-cell lymphoma.

Development of resistance to the CHOP chemotherapeutic regimen (cyclophosphamide, doxorubicin, vincristine, prednisone) remains a major cause of treatment failure and mortality in approximately 40% of patients with diffuse large B-cell lymphoma (DLBCL). We established CHOP-resistant DLBCL cells as a model system to investigate molecular mechanisms involved in multidrug resistance. Two-dimensional differential in-gel (DIGE) analysis identified 10 differentially expressed proteins between CHOP-sensitive and -resistant DLBCL cells that play roles in glycolysis (triosephosphate isomerase-1, enolase-1), cytoskeletal structure (ezrin, vimentin, tubulin-specific chaperone B), purine biosynthesis (serine hydroxymethyltransferase), calcium binding (sorcin), and apoptosis (p53, 14-3-3ζ, Akt). Akt, 14-3-3ζ, and vimentin were up-regulated in CHOP-resistant DLBCL cells. We showed previously that siRNA-mediated knockdown of 14-3-3ζ reversed CHOP resistance in DLBCL cells (Maxwell et al., J Biol Chem 2009;284:22379-22389). Here we show that chemical inhibition of Akt overcomes CHOP resistance in DLBCL cells. CHOP-resistant cells exhibited a five-fold greater ability to invade collagen matrices compared with CHOP-sensitive cells. Knockdown of vimentin by siRNA or withaferin A repressed the invasiveness of CHOP-resistant cells in collagen matrices. Increased expressions of Akt, 14-3-3ζ, and vimentin were observed by Western blotting in primary DLBCL tissues relative to normal lymphatic tissue. The data implicate activation of an Akt-14-3-3ζ signaling pathway in promoting a multidrug-resistant phenotype associated with a vimentin-dependent invasive behavior in DLBCL cells.

Annexin 2 regulates endothelial morphogenesis by controlling AKT activation and junctional integrity.

Sprouting angiogenesis is a multistep process that involves endothelial cell activation, basement membrane degradation, proliferation, lumen formation, and stabilization. In this study, we identified annexin 2 as a regulator of endothelial morphogenesis using a three-dimensional in vitro model where sprouting angiogenesis was driven by sphingosine 1-phosphate and angiogenic growth factors. We observed that sphingosine 1-phosphate triggered annexin 2 translocation from the cytosol to the plasma membrane and its association with vascular endothelial (VE)-cadherin. In addition, annexin 2 depletion attenuated Akt activation, which was associated with increased phosphorylation of VE-cadherin and endothelial barrier leakage. Disrupting homotypic VE-cadherin interactions with EGTA, antibodies to the extracellular domain of VE-cadherin, or gene silencing all resulted in decreased Akt (but not Erk1/2) activation. Furthermore, expression of constitutively active Akt restored reduced endothelial sprouting responses observed with annexin 2 and VE-cadherin knockdown. Collectively, we report that annexin 2 regulates endothelial morphogenesis through an adherens junction-mediated pathway upstream of Akt.

14-3-3zeta mediates resistance of diffuse large B cell lymphoma to an anthracycline-based chemotherapeutic regimen.

Patients presenting with diffuse large B cell lymphoma (DLBCL) are treated with a standard anthracycline-based chemotherapeutic mixture consisting of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP). Half of DLBCL patients will develop chemo-refractory tumors due to the emergence of CHOP-resistant DLBCL cells. We isolated DLBCL cells that were resistant to CHOP as a model system to investigate the molecular basis of CHOP resistance. Resistant cells emerged from CHOP-sensitive DLBCL populations after repeated cycles of on-off exposure to stepwise increased dosages of CHOP. A proteomic analysis of CHOP-sensitive and -resistant DLBCL cells identified the zeta isoform of the 14-3-3 family as a differentially expressed protein. CHOP-sensitive cells showed reduced expression of 14-3-3zeta protein in the presence of high-dose CHOP relative to control cells. In contrast, CHOP-resistant cells expressed markedly higher levels of 14-3-3zeta regardless the presence of high-dose CHOP. Because 14-3-3zeta is known to exert anti-apoptotic influences and chemoresistance in lung, colon, and prostate carcinoma, we hypothesized that 14-3-3zeta promotes survival of DLBCL cells in CHOP. In support of our hypothesis, knockdown of 14-3-3zeta by small interfering RNA restored the sensitivity of resistant DLBCL to CHOP-induce apoptosis. In addition, 14-3-3zeta expression was highly up-regulated in a resected DLBCL lymph node relative to a normal lymph node by Western blot analysis. Furthermore, more than half of 35 DLBCL tissues showed elevated 14-3-3zeta expression relative to normal lymph tissue by immunohistochemical analysis. Our study implicates 14-3-3zeta in the pathogenesis of DLBCL and suggests a promising combination strategy with a 14-3-3 inhibitor for the treatment of refractory DLBCL.

Identification of a p53-response element in the promoter of the proline oxidase gene.

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188bp upstream of the POX transcriptional start site.

The p53-induced gene-6 (proline oxidase) mediates apoptosis through a calcineurin-dependent pathway.

Proline oxidase is a p53-induced redox gene that can generate reactive oxygen species (ROS) and mediate apoptosis in tumor cells. We report that proline oxidase is a downstream effector in p53-mediated activation of the calcium/calmodulin-dependent phosphatase calcineurin in lung, renal, colon, and ovarian carcinoma cells. The activation of calcineurin by p53 and proline oxidase was detected by activation of the nuclear factor of activated T cells (NFAT), an established indicator of activated calcineurin. Both proline oxidase- and p53-induced activation of NFAT were sensitive to the calcineurin inhibitors cyclosporin A and FK-506, to scavengers of ROS, and to inhibitors of calcium mobilization. A proline oxidase antisense vector suppressed the ability of p53 to up-regulate proline oxidase, activate calcineurin, and induce apoptosis. Moreover, two renal carcinoma-derived mutant p53 proteins were deficient in inducing proline oxidase expression and in activating calcineurin. Inhibitors of calcineurin and calcium mobilization abolished proline oxidase-mediated apoptosis and reduced p53-induced apoptosis. Treatment of colon and ovarian carcinoma cells with the anticancer genotoxic agent etoposide up-regulated both p53 and proline oxidase, activated calcineurin, and induced apoptosis. The etoposide-mediated activation of calcineurin and induction of apoptosis was markedly suppressed by FK-506 calcineurin inhibitor. We propose that proline oxidase mediates apoptosis through the generation of proline-dependent ROS, which then mobilize calcium and activate calcineurin. The activation of calcineurin-regulated transcription factor pathways by proline oxidase might affect gene expression events important to p53 regulation of cell growth and apoptosis.

Proline oxidase induces apoptosis in tumor cells, and its expression is frequently absent or reduced in renal carcinomas.

Proline oxidase is a p53-induced gene that can mediate apoptosis in lung carcinoma cells. Here, we provide evidence implicating a role for proline oxidase in renal carcinoma. We observed absent or reduced expression of proline oxidase in 8 of 12 primary renal cell carcinomas, with respect to their normal tissue counterparts. Two renal cell carcinomas, which displayed little or no expression of proline oxidase, expressed p53s that were less capable of inducing proline oxidase than p53 isolated from normal renal tissue. One of those tumor-derived p53s contained a double transition mutation at amino acid residues 125 (Ala to Thr) and 193 (Arg to His), and the other exhibited a single transition mutation at amino acid 149 (Ser to Phe). Forced up-regulation of proline oxidase induced the formation of reactive oxygen species and mediated apoptosis in the 786-0 renal cell carcinoma cell line. A proline oxidase antisense vector repressed p53-induced up-regulation of proline oxidase, release of cytochrome c from mitochondria, and apoptosis in 786-0 renal carcinoma cells. Taken together, these findings support a role for proline oxidase as a downstream effector in p53-mediated apoptosis. We hypothesize that its altered expression can contribute to the development of renal carcinomas. The presence of proline oxidase in mitochondria, a primary organelle that regulates apoptosis, places this molecule in a subcellular localization that can directly influence the apoptotic pathway and thus tumorigenesis.