First Report of 'Candidatus Phytoplasma asteris'-Related Strain Associated with Peach Rosette in Canada.

Prunus persica (L.) Bastch (family Rosaceae) is currently represented by 83 accessions at the Canadian Clonal Genebank. Approximately 3,200 ha are devoted to peach cultivation in Canada where Ontario Province accounts for 82% of the national production. The clonal peach accessions, also located in Ontario, are monitored routinely for symptoms of phytoplasma infection, including rosette-like symptoms (3) that are characterized by new shoots with very short internodes, loss of older shoot leaves leaving only bunches of young leaves on the tips of naked shoots, and flowers that rarely set fruit. From June to August 2009, peach accessions PRU0382 and PRU0445 showed typical peach rosette symptoms, while another 14 accessions exhibited either short internodes or no symptoms. Leaf midrib samples were collected from 16 peach accessions, including 17 symptomatic (from which 8 corresponded to accession PRU0382, 6 for PRU0445, 1 for PRU0335, 1 for PRU0179, and 1 for PRU0451) and 16 asymptomatic (from which 5 corresponded to a representative of each accession PRU0382, PRU0445, PRU0335, PRU0179, and PRU0451 and 11 to other peach accessions). Total DNA was extracted (DNeasy Plant Extraction Mini Kit, QIAGEN, Valencia, CA) from 100 mg of each sample and used as a template in a nested PCR with phytoplasma universal primers R16mF2/R1 (1) and fU5/rU3 (2). Nested PCR products of the expected size (~880 bp) were obtained from all symptomatic samples (14 of 14) of accessions PRU0382 (peach-almond cv. Kando from the Czech Republic) and PRU0445 (peach cv. HW271 from Canada) only. All other plants with or without symptoms yielded no PCR products. Amplicons were purified (Wizard PCR Clean-up, Promega, Madison, WI), cloned in pGEM-T Easy Vector (Promega), and sequenced (Robarts Institute, London, Canada). The resulting 16S rDNA sequences were identical; one of each was archived in GenBank as Accession No. GU223904. BLAST analysis determined that the P. persica phytoplasma sequence shared 99% identity with 16S rDNA sequences of 'Candidatus Phytoplasma asteris'-related strains. This relationship was also supported by restriction fragment length polymorphism analysis (RFLP) of rDNA amplicons using AluI, RsaI, and MseI endonucleases that yielded fragment profiles indicative of phytoplasmas belonging to group 16SrI (Aster Yellows), subgroup B (16SrI-B). Among phytoplasma diseases, those attributed to group 16SrI strains are most numerous and affect the widest plant host range. They include peach rosette in the United States and Europe (3) as well as diseases of various horticultural crops in Canada, including grapevine (4). To our knowledge, this is the first report of a subgroup 16SrI-B phytoplasma affecting peach in Canada. Early detection of phytoplasmas by PCR in accessions with both European and Canadian origins underscores the importance of prompt identification of infected plants for subsequent thermotherapy treatment to maintain the health of the collection and prevent further disease spread. References: (1) D. E Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:1441, 1996. (2) K. H. Lorenz et al. Phytopathology 85:771, 1995. (3) C. Marcone et al. Acta Hortic. 386:471, 1995. (4) C. Y. Olivier et al. Plant Dis. 93:669, 2009.

First Report of Pear Decline Caused by 'Candidatus Phytoplasma pyri' in Ontario, Canada.

Pear decline (PD) is a serious disease of pear (Pyrus communis L.) caused by 'Candidatus Phytoplasma pyri', which belongs to the subgroup 16SrX-C of the apple proliferation (AP) group of phytoplasmas (3). Pear seedlings from the Agriculture and Agri-Food Canada (AAFC) pear breeding program, which have been selected for advanced test and grower trials, are routinely submitted to the Canadian Food Inspection Agency (CFIA) Sidney Laboratory (formerly, CFIA Centre for Plant Health, Saanichton, BC) for virus testing at the same time that propagation is initiated to produce trees for further evaluations. In early 2007, the CFIA reported that samples of two seedling selections submitted in 2005 tested positive for phytoplasmas by a nested PCR assay with phytoplasma universal primers P1/P7 (1), followed by phytoplasma universal primers fU5/rU3 (2) and real time PCR with universal phytoplasma primers developed by the CFIA-Sidney (personal communication). Phytoplasmas present in both selections were subsequently identified as 'Ca. P. pyri' strains by nested PCR with the P1/P7 primers followed by PD/peach yellow leaf roll (PYLR)-specific primers fPD/rPDS (2,4). These were the first PD-positive results from many samples submitted over the years for testing. Following PD-positive diagnoses for the seedling trees, others propagated from these seedling trees were removed from the nursery. When tested by PD-specific nested PCR (P1/P7 then fPD/rPDS), one selection had 39 of 79 nursery trees (49%) that were PD positive, while the other selection had 27 of 96 trees (28%) testing as PD positive. PCR amplification of DNA isolated from leaves of six of the propagated trees, with primer pair fPD/rPDS, yielded an ~1,400-bp product that was sequenced. A consensus sequence of 1,313 bp (GenBank Accession No. GU565959) was subjected to a nucleotide BLAST search of the NCBI database and showed 100% nt identity with sequences of phytoplasmas PD1 (AJ542543) and PYLR (Y16394). Subsequently, the PD-positive results from leaf, dormant shoot, and root tissues from the original seedling trees were confirmed by PD-specific nested PCR. On the original seedling trees, visible symptoms typical of PD, especially premature leaf coloration, were observed in late summer 2008 and samples taken of green and red leaves were subjected to PD-specific PCR. Red leaves were PD-positive, while green leaves were mostly PD-negative. Pear leaves, dormant shoots, and roots collected from research and commercial orchards in southern Ontario in 2007 and 2008 were subjected to PD-specific nested PCR (P1/P7 then fPD/rPDS), AP-specific nested PCR (P1/P7 then fO1/rO1) (2), as well as the universal phytoplasma nested PCR (P1/P7 then fU5/rU3), resulting in the identification of PD-positive trees of several cultivars. The sequence of the 1,057-bp amplicon from accession PYR0190 (selection HW615), with AP-specific primers fO1/rO1, was deposited in GenBank (GU475131). Although there have been no previous reports of PD in Ontario, Canada, it would appear that PD has been present for some time based on the number and distribution (both geographic and cultivar) of positive samples. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) K.-H. Lorenz et al. Phytopathology 85:771, 1995. (3) E. Seemüller et al. J. Plant Pathol. 80:3, 1998. (4) C. D. Smart et al. Appl. Environ. Microbiol. 62:2988, 1996.

First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America.

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata 'Kwanzan' for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

First Record of Hop stunt viroid in Canada.

"Tissue-printing" hybridization (3) for Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) was used to assess the sanitary status of stone fruit accessions in the Canadian Clonal Genebank (CCG) located in Harrow (Ontario). The Prunus spp. accessions in the CCG are primarily of Canadian origin; other countries of origin include the United States, the United Kingdom, Hungary, the Czech Republic, the Former Soviet Union, Spain, New Zealand, and Italy. All Prunus spp. accessions were donated to the Genebank from Canadian or American sources. Leaves were harvested in November 2003 from 336 trees (116 peach and nectarine, 84 sweet and sour cherries, 54 plum, 44 apricot, and 38 of other cherries) representing 267 accessions. No visible symptoms were observed during the collection of the accessions to be evaluated. The petioles were excised at the base and imprinted on a nylon membrane in triplicate for each sample. The membranes were air dried and submitted by mail to the laboratory. The digoxigenin-labeled riboprobes used for hybridization were obtained by T7 RNA polymerase transcription of the linearized plasmids pHSVd (1) and pPLMVd (2). Thirty stone fruit samples were infected by viroids. PLMVd occurred in 28 peach and nectarine samples, representing the following cultivars and selections: Harblaze Hardired, Harko, Earlyvee, Harbelle, Harken, Harland, Harrow Beauty, Harrow Rubirose, HW264, Redhaven, Silver Gold, Suncling, V68101, Vanity, Veeglo, Velvet, Vesper, Villa Doria, and Vulcan. PLMVd-infected samples represented 24.1% of the tested peaches and nectarines. PLMVd finding confirms previous reports of the viroid in Canada from British Columbia and Ontario. Two CCG apricot accessions, 'Bulida' and 'Velkopavlovicka', were found to be infected with only HSVd, representing 4.5% of tested apricot samples. These samples, determined to be positive by tissue-printing hybridization, were also positive by reverse transcription-polymerase chain reaction (RT-PCR) (1). In addition, nucleotide sequences of the PCR products were obtained. The 'Bulida' isolate showed 100% homology to a Spanish isolate, apr9, while the 'Velkopavlovicka' isolate showed 99% homology to an Italian isolate. Since HSVd has not been previously reported in Canada (4), to our knowledge, this report documents its first detection in the country. This report may prompt the inclusion of regular testing for HSVd in existing Prunus spp. virus testing programs in Canada. References: (1) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (2) M. Badenes et al. Acta Hortic. 472:565, 2001. (3) V. Pallás et al. Page 135 in: Virus and Virus-Like Diseases of Stone Fruits, with Particular Reference to the Mediterranean Region. A. Myrta et al., eds. CIHEAM-IAMB, 2003. (4) R. Singh et al. Page 255 in: Viroids. A. Hadidi et al., eds. CSIRO Publishing, Australia, 2003.

First Report of Bean pod mottle virus in Soybean in Canada.

In 2001, soybean fields were surveyed to determine the incidence of viruses because soybean aphids (Aphis glycines Matsamura), known to transmit Soybean mosaic virus (SMV) (2), were found in Ontario. In addition, bean leaf beetle (Cerotoma trifurcata Forster) was found during 2000 to be contaminated with Bean pod mottle virus (BPMV), although soybean plants, on which the beetles were feeding, tested negative (3). In the current survey, young soybean leaves were selected at random in July and August from 20 plants per site at growth stages R4 to R5 (1) from 415 sites representing the entire soybean-producing area in Ontario. Samples were maintained under cool conditions until received at the laboratory, where they were promptly processed. A combined sub-sample was obtained from the 20 plants per site. The 415 sub-samples were tested for SMV, BPMV, Tobacco ringspot virus (TRSV), and Tobacco streak virus (TSV) using polyclonal antibody kits for double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkart, IN). The ELISA plates were read with a plate reader (MRX, Dynex Technologies Inc., Chantilly, VA), and results were analyzed using ELISA software (Leading Edge Research, Merrickville, Ontario) and compared positive and negative controls (Agdia). TRSV was detected in one sample from Essex County and another sample from Middlesex County. SMV, BPMV, and TSV were not found in commercial soybean fields. However, SMV and BPMV were found in samples originating from two soybean breeding nurseries, one in Essex County and one in Kent County. Seedlings of soybean cv. Williams 82 were inoculated in the greenhouse with sap from leaf samples that tested positive for BPMV. Leaves of plants that developed mosaic symptoms were retested using ELISA and confirmed to be positive for BPMV. SMV and TRSV have been found previously in commercial soybean fields in Ontario (4). To our knowledge, this is the first report of BPMV on soybean plants in Canada. References: (1) W. R. Fehr et al. Merr. Crop. Sci. 11:929, 1971. (2) J. H. Hill et al. Plant Dis. 85:561, 2001. (3) A. U. Tenuta. Crop Pest. 5 (11):8, 2000. (4) J. C. Tu. Can. J. Plant Sci. 66:491, 1986.

Removal of the N-terminal hexapeptide from human beta2-microglobulin facilitates protein aggregation and fibril formation.

The solution structure and stability of N-terminally truncated beta2-microglobulin (deltaN6beta2-m), the major modification in ex vivo fibrils, have been investigated by a variety of biophysical techniques. The results show that deltaN6beta2-m has a free energy of stabilization that is reduced by 2.5 kcal/mol compared to the intact protein. Hydrogen exchange of a mixture of the truncated and full-length proteins at microM concentrations at pH 6.5 monitored by electrospray mass spectrometry reveals that deltaN6beta2-m is significantly less protected than its wild-type counterpart. Analysis of deltaN6beta2-m by NMR shows that this loss of protection occurs in beta strands I, III, and part of II. At mM concentration gel filtration analysis shows that deltaN6beta2-m forms a series of oligomers, including trimers and tetramers, and NMR analysis indicates that strand V is involved in intermolecular interactions that stabilize this association. The truncated species of beta2-microglobulin was found to have a higher tendency to self-associate than the intact molecule, and unlike wild-type protein, is able to form amyloid fibrils at physiological pH. Limited proteolysis experiments and analysis by mass spectrometry support the conformational modifications identified by NMR and suggest that deltaN6beta2-m could be a key intermediate of a proteolytic pathway of beta2-microglobulin. Overall, the data suggest that removal of the six residues from the N-terminus of beta2-microglobulin has a major effect on the stability of the overall fold. Part of the tertiary structure is preserved substantially by the disulfide bridge between Cys25 and Cys80, but the pairing between beta-strands far removed from this constrain is greatly perturbed.

Electrostatic properties of bovine beta-lactoglobulin.

Bovine beta-Lactoglobulin (BLG) has been studied for many decades, but only recently structural data have been obtained, making it possible to simulate its molecular properties. In the present study, electrostatic properties of BLG are investigated theoretically using Poisson-Boltzmann calculations and experimentally following pH titration via NMR. Electrostatic properties are determined for several structural models, including an ensemble of NMR structures obtained at low pH. The changes in electrostatic forces upon changes in ionic strength, solvent dielectric constant, and pH are calculated and compared with experiments. pK(a)s are computed for all titratable sites and compared with NMR titration data. The analysis of theoretical and experimental results suggests that (1) there may be more than one binding sites for negatively charged ligands; (2) at low pH the core of the molecule is more compact than observed in the structures obtained via restrained molecular dynamics from NMR data, but loop and terminal regions must be disordered.