Antimicrobial Activity of Hydrogen Peroxide for Application in Food Safety and COVID-19 Mitigation: An Updated Review.

Hydrogen peroxide (H2O2) is a well-known agent with a broad-spectrum antimicrobial activity against pathogenic bacteria, fungi, and viruses. It is a colorless liquid and commercially available in aqueous solution over a wide concentration range. It has been extensively used in the food industry by virtue of its strong oxidizing property and its ability to cause cellular oxidative damage in microbial cells. This review comprehensively documents recent research on the antimicrobial activity of H2O2 against organisms of concern for the food industry, as well as its effect against SARS-CoV-2 responsible for the COVID-19 pandemic. In addition, factors affecting the antimicrobial effectiveness of H2O2, different applications of H2O2 as a sanitizer or disinfectant in the food industry as well as safety concerns associated with H2O2 are discussed. Finally, recent efforts in enhancing the antimicrobial efficacy of H2O2 are also outlined.

A study on the occurrence of human enteric viruses in salad vegetables and seafood and associated health risks for consumers in Mauritius.

Norovirus (NOV) and hepatitis A virus (HAV) are human enteric viruses of major concern worldwide. Salad vegetables and molluscan shellfish are highly susceptible to contamination by NOV and HAV and can pose a health threat when consumed raw. The objective of this study was to determine the occurrence of NOV and HAV in lettuce, watercress, tomatoes, and oysters using the enzyme-linked immunosorbent assay and assess the health risks associated with the consumption of these commodities by semiquantitative risk assessment. The occurrence of NOV in vegetables ranked in the following decreasing order: lettuce (36%) > watercress (16%) > tomatoes (4%). However, HAV was more frequently detected in watercress (56%), compared to lettuce or tomatoes (12%). Additionally, NOV was detected in oysters (60%). The risk assessment exercise pointed to a medium-risk score of contracting a foodborne illness of viral origin for consumers eating fresh watercress or oysters. Future research will ascertain the presence of these enteric viruses in a broader range of food commodities.

Prevalence, Genomic Characterization, and Risk Assessment of Human Pathogenic Vibrio Species in Seafood.

ABSTRACT: Pathogenic Vibrio species are largely responsible for human diseases associated with consumption of contaminated seafood. The aim of this study was to determine the prevalence, population densities, species diversity, and molecular characteristics of pathogenic Vibrio in various seafood commodities and the health risks associated with consumption of these contaminated commodities. Samples of finfish and shellfish (oysters and sea urchins) were collected from various regions and analyzed for Vibrio with the most-probable-number (MPN) technique. Genomic DNA of putative Vibrio isolates was analyzed by whole genome sequencing for taxonomic identification and identification of virulence and antimicrobial resistance genes. The risk of Vibrio-related illnesses due to the consumption of contaminated seafood was assessed with Risk Ranger. Populations of presumptive Vibrio were 2.6 to 4.4 log MPN/g and correlated with season; Vibrio levels were significantly higher (P < 0.05) in the summer. Fifteen Vibrio isolates were identified as Vibrio alginolyticus (five isolates), Vibrio parahaemolyticus (six isolates), Vibrio harveyi (two isolates), and Vibrio diabolicus (two isolates). Two of the six V. parahaemolyticus isolates (ST 2504 and ST 2505) from oysters harbored either the tdh gene for thermostable direct hemolysin or the trh gene for thermostable direct hemolysin-related hemolysin. In addition to virulence genes, the shellfish isolates also harbored genes encoding resistance to multiple antibiotics, including tetracycline, penicillin, quinolone, and ß-lactams, thus arousing concern. The risk assessment predicted that an estimated 21 cases of V. parahaemolyticus-associated gastroenteritis could occur in the general population annually due to consumption of contaminated oysters. This study highlights both the wide prevalence and diversity of Vibrio in seafood and the potential for certain strains to threaten public health.

Climate Change and Emerging Food Safety Issues: A Review.

ABSTRACT: Throughout the past decades, climate change has been one of the most complex global issues. Characterized by worldwide alterations in weather patterns, along with a concomitant increase in the temperature of the Earth, climate change will undoubtedly have significant effects on food security and food safety. Climate change engenders climate variability: significant variations in weather variables and their frequency. Both climate variability and climate change are thought to threaten the safety of the food supply chain through different pathways. One such pathway is the ability to exacerbate foodborne diseases by influencing the occurrence, persistence, virulence and, in some cases, toxicity of certain groups of disease-causing microorganisms. Food safety can also be compromised by various chemical hazards, such as pesticides, mycotoxins, and heavy metals. With changes in weather patterns, such as lower rainfall, higher air temperature, and higher frequency of extreme weather events among others, this translates to emerging food safety concerns. These include the shortage of safe water for irrigation of agricultural produce, greater use of pesticides due to pest resistance, increased difficulty in achieving a well-controlled cold chain resulting in temperature abuse, or the occurrence of flash floods, which cause runoff of chemical contaminants in natural water courses. Together, these can result in foodborne infection, intoxication, antimicrobial resistance, and long-term bioaccumulation of chemicals and heavy metals in the human body. Furthermore, severe climate variability can result in extreme weather events and natural calamities, which directly or indirectly impair food safety. This review discusses the causes and impacts of climate change and variability on existing and emerging food safety risks and also considers mitigation and adaptation strategies to address the global warming and climate change problem.

First report of charcoal rot caused by Macrophomina phaseolina on potato tubers in Mauritius.

Charcoal rot, caused by Macrophomina phaseolina, is an important disease in tropical and subtropical regions which affects a broad range of host plants, including potato (Solanum tuberosum L.). In this crop, charcoal rot can reduce the marketable quality of tubers (Arora 2012) and cause yield losses up to 88% (Somani 2007). During a survey of a potato field of 'Spunta' cultivar in Goodlands, Mauritius (20°02'28.2"S 57°39'30.4"E) approximately 10% of tubers with grey pigmentation around the lenticels and small water-soaked spots with white dots were observed. These symptoms later advanced to dark brown to black patches on the skin surface, all conforming to typical symptoms of charcoal rot (Arora and Khurana 2004). Fragments of infected and adjacent healthy tissue were cut, thoroughly washed with tap water, surface sterilized for 30 s with 1% sodium hypochlorite (25% bleach), placed on chloramphenicol-amended Potato Dextrose Agar (PDA), and incubated for 5 days in the dark at 25±2oC. From all the inoculated plates, only fast-growing, dark brown, grey to black Macrophomina-like colonies grew and several mono-sclerotial isolates were obtained with uniform morphological features. Following staining with cotton lactophenol dye using the clean slide technique, the isolate 449G-19/M exhibiting typical characteristics of M. phaseolina (Arora and Dhurwe 2019) and forming flattened, globose, black sclerotia with an average diameter of 180 µm (n= 50), was selected and used for further characterization. Identification was confirmed by sequencing of the ITS region of rDNA. Total DNA was extracted directly from the mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions, while PCR amplification and sequencing were performed with primers ITS1-F (Gardes and Bruns 1993) and ITS-4 (White et al. 1990). The nucleotide sequence of the isolate 449G-19/M (Accession No. MW301138) shared 98.28 to 99.80% similarity with over 70 M. phaseolina isolates in GenBank (99.18% with isolate from Zea mays, Accession No. KF531825 (Phillips et al. 2013)). Pathogenicity was tested on 20 healthy tubers which were initially disinfected with 2% sodium hypochlorite for 1 min and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7-day-old cultures of the isolate 449G-19/M near each tuber. Similarly, 10 tubers inoculated with sterile PDA served as a negative control. The plants were maintained in greenhouse conditions, watered daily, and assessed for the presence of symptoms 8 weeks post emergence. All inoculated tubers exhibited charcoal rot on progeny tubers while control plants remained symptomless. Koch's postulates were fulfilled successfully and the fungus recovered from the inoculated plants. Although M. phaseolina was previously observed in Mauritius on groundnut resulting in pre-emergence rot and collar rot (Anonymous 1962), to our knowledge, this is the first report demonstrating charcoal rot on potato tubers caused by M. phaseolina in Mauritius. As the sclerotia can remain in the soil for long periods of time (Arora and Khurana 2004) and with prevailing conditions of global warming, charcoal rot may be a threat for potatoes and other local crops (Somani et al. 2013). This study will sensitize agricultural extension officers on this new disease and calls for routine surveillance to safeguard this crop.

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 µm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

A study on the effectiveness of a defined microbial consortium to enhance the microbiological safety of cattle manure.

BACKGROUND: Animal manure frequently harbors pathogenic microorganisms such as Salmonella spp. and diarrheagenic Escherichia coli. A defined microbial consortium such as effective microorganisms (EM) can potentially be used as a biocontrol against manure-borne human pathogens such as Salmonella and pathogenic E. coli. The objective of the study was to investigate the efficacy of EM to decontaminate cattle manure. RESULTS: EM was first characterized by enumeration and identification of lactic acid bacteria (LAB), yeasts, actinomycetes and phototrophic bacteria (PB). The population density of LAB, yeasts, actinomycetes and presumptive PB was 6.9, 5.2, 5.9 and 3.9 log CFU g-1 respectively. LAB and yeast isolates were molecularly confirmed as Lactobacillus plantarum and L. casei (LAB) and Yarrowia lipolytica, Rhodotorula mucilaginosa and Picha manshurica (yeasts) respectively. Culture-independent molecular analysis revealed the presence of additional species including L. parabuchneri and Enterococcus faecium (LAB) and bacterial spore-formers Bacillus cereus and Clostridium spp. Application of EM to fresh cattle manure, inoculated with ~5-6 log CFU g-1 of antibiotic-resistant strain of indicator organism E. coli ATCC 25922, resulted in complete elimination of the organism in 20 days, while survivors were still detected in the untreated counterpart. CONCLUSION: EM can potentially be used for sustainable pathogen control in cattle manure for enhanced food safety and environmental health. © 2020 Society of Chemical Industry.

First report of Black Scurf caused by Rhizoctonia solani AG-3 on potato tubers in Mauritius.

Potato (Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

First Report of Target Spot on Tomato Caused by Corynespora cassiicola in Mauritius.

Tomatoes (Solanum lycopersicum) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 µm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena, Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.

Assessment of the microbiological quality of popular food items on sale in secondary school canteens of Mauritius.

This study was carried out to assess the microbiological status of three hot meals served in eight selected school canteens of Mauritius, with two schools randomly selected from each of the four school zones of the island. Three individual samples of farata, panini, or fried noodles were collected at each school during two independent visits. The three individual samples of each food type collected during each visit were then pooled before being subjected to microbiological analyses. A total of 48 composite samples were analyzed. The parameters tested were Total Viable Count (TVC), Escherichia coli, Salmonella spp., Clostridium perfringens, Staphylococcus aureus, and Listeria spp. The microbiological analyses revealed that paninis were deemed as generally acceptable with TVC falling in the range of 3.0-5.7 Log CFU/g and undetectable levels of S. aureus and E. coli. In contrast, fried noodles and faratas harboured a moderately high level of TVC (4.4-6.7 Log CFU/g) and objectionably high levels S. aureus (3.1 to 5.0 Log CFU/g) and E. coli (3.1-5.1 Log CFU/g) for seven out of the eight schools.

Antilisterial activity of Cymbopogon citratus on crabsticks.

Listeria monocytogenes is a gram positive, psychrotrophic, facultative anaerobic bacterium and it is the etiological agent of listeriosis, a severe foodborne disease of major public health concern. There is a rising concern about the cross-contamination of surimi-based products with L. monocytogenes during handling and storage. Lemon grass (Cymbopogon citratus) is known to exhibit strong antimicrobial activity against bacteria due to the presence of citral. The objectives of this research were: (i) to develop a water-based extraction procedure for the antimicrobial component(s) in lemon grass and (ii) to evaluate the antimicrobial effect of a concentrated water-based extract and commercial essential oil (EO) of lemon grass against L. innocua (ATCC 33090), a surrogate strain of L. monocytogenes, in vitro and on crabsticks. Briefly, antilisterial activity of concentrated extract and commercial EO of lemon grass was tested using the agar well diffusion technique. Crabsticks were subsequently inoculated with L. innocua to a final density of ca. 4 log cfu/g and then coated with 500 µl of either concentrated extract or 0.5% commercial EO and stored at 4 °C for up to 15 days. Samples were then subjected to microbiological analysis every 5 days to enumerate counts of Listeria. Following the agar well diffusion assay, inhibition zones with mean diameters of 18.3 and 21.0 mm were obtained with the concentrated extract and commercial EO respectively. The population of L. innocua in WBE-coated (4.2 log cfu/g) and 0.5% EO-coated (2.7 log cfu/g) samples were significantly lower (P < 0.05) after 15 days than their untreated control counterpart (5.2 log cfu/g). Lemon grass extract and essential oil have the potential to control growth of L. monocytogenes in seafood surimi products with minimal adverse effect on the organoleptic characteristics of the product and thus can possibly be used as a natural food preservative.

A study on the potential of ants to act as vectors of foodborne pathogens.

Ants (Technomyrmex difficilis and Solenopsis geminata) are insects often found in domestic kitchens of Mauritius. Unfortunately, they harbour disease-causing organisms and can potentially transfer these pathogens to food. This study was carried out to (i) investigate the knowledge, perception and behaviors of consumers in relation to the problem of ant infestation of domestic kitchens; (ii) identify the pathogenic microorganisms carried by ants; and (iii) determine the potential for ants to transfer these pathogenic microorganisms to food. A survey based on a stratified sampling design was carried out with 100 consumers using a questionnaire. To identify the pathogenic microorganism(s) harbored by ants, bait traps were set up using sterile sugar as a non-toxic attractant. Captured ants were then subjected to microbiological analyses. Most respondents (72%) agreed that ants constitute a hygienic issue but they did not perceive ants as a serious threat to human health. However microbiological analyses of ants (n = 50) confirmed the presence of various pathogenic microorganisms as well as fecal contaminants. Ants were found to harbor yeasts and molds systematically (100%), coliforms frequently (52%), Bacillus spp. and Escherichia coli occasionally (26% and 18% respectively) and Salmonella and Listeria monocytogenes sporadically (8 and 6 % respectively). Ants were also found to transfer E. coli to food surfaces at a moderately high frequency of 70%. This study demonstrated that the majority of consumers acknowledged the problem of ant infestation as a sanitation-related problem rather than a food safety issue. Since ants have the ability to harbor and subsequently transfer pathogenic or toxigenic microorganisms, ants may act as disease vectors and contaminate food, water and food- contact surfaces of kitchens resulting in foodborne illnesses.

High hydrostatic pressure processing: a promising nonthermal technology to inactivate viruses in high-risk foods.

Foodborne outbreaks of viral origin have become increasingly a serious public health concern. High-pressure processing (HPP), a nonthermal technology, has come to the forefront for food processing given its minimal effects on food quality. Recent studies have revealed encouraging results for the inactivation of several human viruses by HPP. This review provides comprehensive information on the use of HPP to eliminate viruses in model systems and foods. We address the influences of various parameters, including pressure level, holding time, pH, temperature, and food matrix on the efficacy of pressure inactivation of viruses, as well as insight into the mechanisms for inactivation of enveloped and nonenveloped viruses. HPP is a promising technology for mitigating virus contamination of foods, thus it is essential to identify the optimal parameters for enhancing virus inactivation while ensuring sensory and nutritional quality retention of foods.

Use of antimicrobial films and edible coatings incorporating chemical and biological preservatives to control growth of Listeria monocytogenes on cold smoked salmon.

The relatively high incidence of Listeria monocytogenes in cold smoked salmon (CSS) is of concern as it is a refrigerated processed food of extended durability (REPFED). The objectives of this study were to compare and optimize the antimicrobial effectiveness of films and coatings incorporating nisin (Nis) and sodium lactate (SL), sodium diacetate (SD), potassium sorbate (PS), and/or sodium benzoate (SB) in binary or ternary combinations on CSS. Surface treatments incorporating Nis (25000 IU/mL) in combination with PS (0.3%) and SB (0.1%) had the highest inhibitory activity, reducing the population of L. monocytogenes by a maximum of 3.3 log CFU/cm(2) (films) and 2.9 log CFU/cm(2) (coatings) relative to control samples after 10 days of storage at 21°C. During refrigerated storage, coatings were more effective in inhibiting growth of L. monocytogenes than their film counterparts. Cellulose-based coatings incorporating Nis, PS, and SB reduced the population of L. monocytogenes, and anaerobic and aerobic spoilage flora by a maximum of 4.2, 4.8, and 4.9 log CFU/cm(2), respectively, after 4 weeks of refrigerated storage. This study highlights the effectiveness of cellulose-based edible coatings incorporating generally regarded as safe (GRAS) natural and chemical antimicrobials to inhibit the development of L. monocytogenes and spoilage microflora thus enhancing the safety and quality of CSS.

Pressure inactivation of Tulane virus, a candidate surrogate for human norovirus and its potential application in food industry.

Human norovirus (HuNoV) is the leading causative agent for foodborne disease. Currently, studies of HuNoV usually rely on surrogates such as murine norovirus (MNV) due to the lack of a suitable cell culture system and a small animal model for HuNoV. Tulane virus (TV), a monkey calicivirus, is a cultivable enteric calicivirus that not only recognizes the same receptors as HuNoV, but is also genetically closely related to HuNoV. In this study, we determined the pH stability of TV and MNV-1, as well as the effect of high hydrostatic pressure (HHP) on inactivating both viruses in aqueous media, blueberries and oysters. We demonstrated that both TV and MNV-1 were very stable under an acidic environment. They were more resistant to pressure at an acidic environment than at neutral pH. Pressure treatment of 600 MPa for 2 min at different temperatures (4, 21 and 35 °C) barely caused any reduction of TV, as well as MNV-1, on un-wetted (dry) blueberries. However, both TV and MNV-1 on blueberries were successfully inactivated by a pressure of ≤400 MPa when blueberries were immersed in phosphate-buffered saline during HHP. Pressure inactivation of both TV and MNV-1 in blueberries and oysters increased as sample temperature decreased in the order of 4>21>35 °C. TV was more sensitive to pressure than MNV-1 for the three matrices tested, culture media, blueberries and oysters. This study provides important information on the use of TV as a surrogate for HuNoV study. Results obtained from this study lay a foundation for designing effective HHP treatments for inactivation of HuNoV in high-risk foods such as berries and oysters.

High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.

Human norovirus (NoV) is the leading cause of nonbacterial acute gastroenteritis epidemics worldwide. High-pressure processing (HPP) has been considered a promising nonthermal processing technology to inactivate food- and waterborne viral pathogens. Due to the lack of an effective cell culture method for human NoV, the effectiveness of HPP in inactivating human NoV remains poorly understood. In this study, we evaluated the effectiveness of HPP in disrupting the capsid of human NoV based on the structural and functional integrity of virus-like particles (VLPs) and histo-blood group antigen (HBGA) receptor binding assays. We found that pressurization at 500 to 600 MPa for 2 min, a pressure level that completely inactivates murine norovirus and feline calicivirus, was not sufficient to disrupt the structure and function of human NoV VLPs, even with a holding time of 60 min. Degradation of VLPs increased commensurate with increasing pressure levels more than increasing time. The times required for complete disruption of human NoV VLPs at 700, 800, and 900 MPa were 45, 15, and 2 min, respectively. Human NoV VLPs were more resistant to HPP in their ability to bind type A than type B and O HBGAs. Additionally, the 23-nm VLPs appeared to be much more stable than the 38-nm VLPs. Taken together, our results demonstrated that the human NoV capsid is highly resistant to HPP. While human NoV VLPs may not be fully representative of viable human NoV, destruction of the VLP capsid is highly suggestive of a typical response for viable human NoV.

High pressure inactivation of Salmonella on Jalapeño and Serrano peppers destined for direct consumption or as ingredients in Mexican salsa and guacamole.

In summer of 2008, the United States witnessed one of the largest multi-state salmonellosis outbreak linked to the consumption of Jalapeño and Serrano peppers tainted with Salmonella enterica serovar Saintpaul. The first objective of this study was to assess the application of high hydrostatic pressure (HHP) to decontaminate Jalapeño and Serrano peppers from this pathogen. Jalapeño and Serrano peppers were inoculated with a five-strain cocktail of Salmonella to a final level of ca. ~6 log CFU/g and subsequently pressure-treated in the un-wetted, wetted (briefly dipped in water) or soaked (immersed in water for 30 min) state at 300-500 MPa for 2 min at 20°C. The extent of pressure inactivation increased as a function of the pressure level and in the order of soaked>wetted>un-wetted state achieving population reductions ranging from 1.1 to 6.6 log CFU/g. Overall, pressure treatment at 400-450 MPa (soaked) or 450-500 MPa (wetted) for 2 min at 20°C rendered Salmonella undetectable. Since salsa and guacamole are two examples of widely consumed Mexican dishes that incorporate raw Jalapeño and Serrano peppers, we subsequently investigated the pressure-inactivation of Salmonella in salsa and guacamole, originating from contaminated peppers used as ingredients. The storage time (0, 12 or 24 h) of the condiments prior to HHP as well as the pH (3.8-5.3) and the type of acidulants (vinegar and lemon juice) used all influenced the extent of Salmonella inactivation by HHP. This study demonstrates the dual efficacy of HHP to decontaminate fresh chile peppers destined for direct consumption and minimally process condiments possibly contaminated with raw peppers to enhance their microbiological safety.

Use of high hydrostatic pressure to inactivate Escherichia coli O157:H7 and Salmonella enterica internalized within and adhered to preharvest contaminated green onions.

Green onions grown in soil and hydroponic medium contaminated with Escherichia coli O157:H7 and Salmonella were found to take up the pathogens in their roots, bulbs, stems, and leaves. Pressure treatment at 400 to 500 MPa for 2 min at 20 to 40°C eliminated both pathogens that were internalized within green onions during plant growth.

Influence of prior growth conditions, pressure treatment parameters, and recovery conditions on the inactivation and recovery of Listeria monocytogenes, Escherichia coli, and Salmonella Typhimurium in turkey meat.

The relatively high prevalence of Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella enterica serovar Typhimurium in various food products is of great concern to the food industry. The objective of this study was to determine the pressure-inactivation of the pathogens in a representative food model as affected by prior growth temperature, physiological age of the culture, pressure level and treatment temperature. The effect of post-treatment conditions (incubation temperature and gas atmosphere) on the bacterial recovery was also determined. The pathogens being studied were inoculated into sterile turkey breast meat to a final level of ca. 3 logCFU/g and then grown to two stages, the early stage (representative of exponential phase) and late stage (representative of stationary phase), at 15, 25, 35, and 40 °C. Turkey meat samples were pressure-treated at 400 and 600 MPa for 2 min at initial sample temperatures of 4, 20 and 40 °C. Following treatment, bacterial counts in the samples were determined aerobically or anaerobically at incubation temperatures of 15, 25, 35, and 40 °C. Pressure inactivation of the bacterial pathogens increased as a function of the pressure levels and treatment temperatures. Generally speaking, early stage cells were more resistant than late stage cells (P<0.05). The incubation gas atmosphere did not affect bacterial recovery. Bacteria grown at 15-35 °C underwent higher population reductions than those grown at 40 °C. With regard to recovery temperatures, low temperatures promoted greater recovery of injured early and late stage cells than higher temperatures (P<0.05). This study indicates the importance of environmental conditions to which bacteria are exposed prior to pressure treatment and recovery conditions of the bacteria after pressure treatment when considering the adequacy of pressure treatments to enhance the microbiological safety of foods.

Lack of correlation between virus barosensitivity and the presence of a viral envelope during inactivation of human rotavirus, vesicular stomatitis virus, and avian metapneumovirus by high-pressure processing.

High-pressure processing (HPP) is a nonthermal technology that has been shown to effectively inactivate a wide range of microorganisms. However, the effectiveness of HPP on inactivation of viruses is relatively less well understood. We systematically investigated the effects of intrinsic (pH) and processing (pressure, time, and temperature) parameters on the pressure inactivation of a nonenveloped virus (human rotavirus [HRV]) and two enveloped viruses (vesicular stomatitis virus [VSV] and avian metapneumovirus [aMPV]). We demonstrated that HPP can efficiently inactivate all tested viruses under optimal conditions, although the pressure susceptibilities and the roles of temperature and pH substantially varied among these viruses regardless of the presence of a viral envelope. We found that VSV was much more stable than most food-borne viruses, whereas aMPV was highly susceptible to HPP. When viruses were held for 2 min under 350 MPa at 4°C, 1.1-log, 3.9-log, and 5.0-log virus reductions were achieved for VSV, HRV, and aMPV, respectively. Both VSV and aMPV were more susceptible to HPP at higher temperature and lower pH. In contrast, HRV was more easily inactivated at higher pH, although temperature did not have a significant impact on inactivation. Furthermore, we demonstrated that the damage of virion structure by disruption of the viral envelope and/or capsid is the primary mechanism underlying HPP-induced viral inactivation. In addition, VSV glycoprotein remained antigenic although VSV was completely inactivated. Taken together, our findings suggest that HPP is a promising technology to eliminate viral contaminants in high-risk foods, water, and other fomites.