Protective effects of 5-aminolevulinic acid on heat stress in bovine mammary epithelial cells.

OBJECTIVE: Cells have increased susceptibility to activation of apoptosis when suffering heat stress (HS). An effective supplementation strategy to mimic heat-induced apoptosis of bovine mammary epithelial cells (MECs) is necessary to maintain optimal milk production. This study aimed to investigate possible protective effects of the anti-apoptotic activity of 5-aminolevulinic acid (5-ALA) against HS-induced damage of bovine MECs. METHODS: Bovine MECs were pretreated with or without 5-ALA at concentrations of 10, 100, and 500 µM for 24 h followed by HS (42.5°C for 24 h and 48 h). Cell viability was measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays. Real-time quantitative polymerase chain reaction and Western blotting were used to explore the regulation of genes associated with apoptosis, oxidative stress, and endoplasmic reticulum (ER) stress genes. RESULTS: We found that 5-ALA induces cytoprotection via inhibition of apoptosis markers after HS-induced damage. Pretreatment of bovine MECs with 5-ALA resulted in dramatic upregulation of mRNA for nuclear factor erythroid-derived 2-like factor 2, heme oxygenase-1, and NAD(P)H quinone oxidoreductase 1, all of which are antioxidant stress genes. Moreover, 5-ALA pretreatment significantly suppressed HS-induced ER stress-associated markers, glucose-regulated protein 78, and C/EBP homologous protein expression levels. CONCLUSION: 5-ALA can ameliorate the ER stress in heat stressed bovine MEC via enhancing the expression of antioxidant gene.

Highly potent antiobesity effect of a short-length peptide YY analog in mice.

Continuous administration of a 14-amino acid peptide YY (PYY) analog, Ac-[d-Pro24,Pya(4)26,Cha27,36,Aib28,31,Lys30]PYY(23-36) (4), which has a high binding affinity and agonist activity for the neuropeptide Y2 receptor (Y2R), has previously shown an antiobesity effect in a 2-week diet-induced obesity (DIO) study in mice. However, there remained a possibility to obtain more potent analogs by further improving its pharmacokinetic profile. A combination of the N-terminal 4-imidazolecarbonyl moiety and three amino acid substitutions, trans-4-hydroxy-d-proline (d-Hyp)24, isovaline (Iva)25, and γ-methylleucine (γMeLeu)28, not only improved the binding affinity of the peptide for Y2R but also increased its anorectic activity in lean mice. In a 2-week DIO study in mice, continuous administration of 4-imidazolecarbonyl-[d-Hyp24,Iva25,Pya(4)26,Cha27,36,γMeLeu28,Lys30,Aib31]PYY(23-36) (31, PYY-1119) at a dose of 0.03mg/kg/day showed a highly potent antiobesity effect, with more than 10% body weight reduction.

A potent and selective natriuretic peptide receptor-3 blocker 11-mer peptide created by hybridization of musclin and atrial natriuretic peptide.

The natriuretic peptide (NP) system is a critical endocrine, autocrine, and paracrine system and has been investigated for potential use against cardiovascular and metabolic diseases. The clearance of NPs is regulated by the proteolysis of neutral endopeptidase (NEP) and by endocytosis via natriuretic peptide receptor-3 (NPR3). A linear NPR3-selective peptide, [Cha8]-ANP(7-16)-NH2 (1), showed potent binding affinity for NPR3 but poor predicted chemical stability due to its free thiol group. A 12-mer peptide (9) without a thiol group was designed by the hybridization of two NPR3-binding peptides: a linear ANP fragment peptide analog and musclin, a murine member of the bHLH family of transcription factors, possessed high binding affinity and strict selectivity for NPR3. To increase the proteolytic resistance of 9, amino acid substitutions at the cleavage sites led to hydroxyacetyl-[d-Phe5,d-Hyp7,Cha8,d-Ser9,Hyp11,Arg(Me)14]-ANP(5-15)-NHCH3 (23), showing high and selective binding affinity for NPR3 over NPR1 and excellent stability in mouse serum. Compound 23 increased intracellular cGMP concentrations in primary cultured adipocytes, and continuous administration induced substantial plasma cGMP elevation in mice, suggesting its potential to clarify the physiological role of NPR3 and its therapeutic application.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy.

Sugar chain abnormalities in glycolipids and glycoproteins are associated with various diseases. Here, we report an adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes. The transgenic hearts at the end-stage, at around 7 months old, were enlarged, with enlarged cavities and thin, low-tensile walls, typical of dilated cardiomyopathy. Although no apparent change was found in heart gangliosides, glycosylation of heart proteins was altered. Interestingly, sugar moieties not directly related to the ST3Gal-II catalytic reaction were also changed. Significant increases in calreticulin and calnexin were observed in hearts of the transgenic mice. These results suggest that expression of ST3Gal-II transgenes induces abnormal protein glycosylation, which disorganizes the endoplasmic/sarcoplasmic reticulum quality control system and elevates the calreticulin/calnexin level, resulting in suppression of cardiac function. The transgenic mice showed 100% incidence of adult onset cardiac dilatation, suggesting great potential as a new model for dilated cardiomyopathy.

Use of sample mixtures for standard curve creation in quantitative western blots.

For accurate protein quantification when using quantitative western blot analysis with chemiluminescence reagents, standard curves are needed because of the narrow quantifiable ranges. However, they are often difficult to obtain because authentic proteins are not always available. Here we present our original and convenient method using a sample mixture as a scale to create standard curves. This method allowed us to determine the quantifiable range of target and loading control proteins, making quantitative comparisons among independent blots more reproducible. Our results indicate that using a sample mixture to create standard curves is a practical method that guarantees the accuracy and reproducibility of quantitative western blot analysis.

Increased globotriaosylceramide levels in a transgenic mouse expressing human alpha1,4-galactosyltransferase and a mouse model for treating Fabry disease.

Fabry disease is a lysosomal storage disorder caused by an α-galactosidase A (α-Gal A) deficiency and resulting in the accumulation of glycosphingolipids, predominantly globotriaosylceramide (Gb3). A transgenic mouse expressing the human α-Gal A R301Q mutant in an α-Gal A-knockout background (TgM/KO) should be useful for studying active-site-specific chaperone (ASSC) therapy for Fabry disease. However, the Gb3 content in the heart tissue of this mouse was too low to detect an ASSC-induced effect. To increase the Gb3 levels in mouse organs, we created transgenic mice (TgG3S) expressing human α1,4-galactosyltransferase (Gb3 synthase). High levels of Gb3 were observed in all major organs of the TgG3S mouse. A TgG3S (+/-)M(+/-)/KO mouse was prepared by cross-breeding the TgG3S and TgM/KO mice and the Gb3 content in the heart of the TgG3S(+/-)M(+/-)/KO mouse was 1.4 µg/mg protein, higher than in the TgM(+/-)/KO (<0.1 µg/mg protein). Treatment with an ASSC, 1-deoxygalactonojirimycin, caused a marked induction of α-Gal A activity and a concomitant reduction of the Gb3 content in the TgG3S(+/-) M(+/-)/KO mouse organs. These data indicated that the TgG3S(+/-) M(+/-)/KO mouse was suitable for studying ASSC therapy for Fabry disease, and that the TgG3S mouse would be useful for studying the effect of high Gb3 levels in mouse organs.

Chemical chaperone therapy: clinical effect in murine G(M1)-gangliosidosis.

Certain low-molecular-weight substrate analogs act both as in vitro competitive inhibitors of lysosomal hydrolases and as intracellular enhancers (chemical chaperones) by stabilization of mutant proteins. In this study, we performed oral administration of a chaperone compound N-octyl-4-epi-beta-valienamine to G(M1)-gangliosidosis model mice expressing R201C mutant human beta-galactosidase. A newly developed neurological scoring system was used for clinical assessment. N-Octyl-4-epi-beta-valienamine was delivered rapidly to the brain, increased beta-galactosidase activity, decreased ganglioside G(M1), and prevented neurological deterioration within a few months. No adverse effect was observed during this experiment. N-Octyl-4-epi-beta-valienamine will be useful for chemical chaperone therapy of human G(M1)-gangliosidosis.

Analyses of the cDNA and genomic DNA sequences encoding the luteinizing hormone beta-subunit precursor protein in the rabbit.

To examine the molecular basis for efficient induction of superovulation in the rabbit, we determined the cDNA sequences of the luteinizing hormone beta-subunit (LHB) from Japanese White (JW), New Zealand White (NZW), and Dutch-Belted (Dutch) rabbits, and we compared these LHB sequences with those of other mammals. Using 5'- and 3'-rapid amplification of cDNA ends (RACE) with pituitary cDNA libraries, we found that the LHB cDNAs of all three breeds are the same length (523 bp from the 5'-end to the polyA site) and have putative AATAAA polyadenylation signal sequences at nucleotides 504 to 509. Northern blot analysis indicated that the approximately 600-nt mRNA encoding JW LHB is slightly longer than the LHB mRNAs of the other two breeds. The NZW and Dutch rabbit LHB coding sequences are 426 bp long, and their G+C contents are higher (>73%) than those of other mammalian LHBs (<70%). The predicted 141-amino-acid sequences of the JW and NZW LHB proteins are identical, and the Dutch LHB and JW/NZW sequences differ at only two residues. The exon-intron configuration of the NZW LHB gene (three exons and two introns) is similar to that of other mammalian LHB genes, and the sequences of NZW rabbit and other mammalian LHB promoter regions are highly conserved. Phylogenetic analysis of the deduced amino acid sequences of the three rabbit LHB proteins indicated that the rabbit occupies a phylogenetic position between rodents and domestic animals, and is far from humans. The results suggest that LH prepared from rodents or domestic animals, if available, would be a better inducer for superovulation in rabbits than human LH/CG.

Transgene insertion pattern analysis using genomic walking in a transgenic mouse line.

A transgene mapping technique (Noguchi et al., Exp. Anim. 53:103-111, 2004) is described that can be used to analyze transgene integration patterns in transgenic mice. The technique was used to reveal that a transgenic mouse line (GM1-sy#116) harbored inverted and direct tandem repeats of both intact and partial pCAGGS-based transgenes in the G2 region of chromosome 1. This complicated concatenation of transgenes may have been caused by simple end-joining of DNA constructs fragmented by exposure to UV transillumination during gel-purification, and by nuclease digestion inside zygote pronuclei. The results suggest that care should be taken to avoid unwanted fragmentation during the preparation of vector constructs.

Sequence analysis of cDNA encoding rabbit follicle-stimulating hormone beta-subunit precursor protein.

To understand the molecular basis of the rabbit's efficient superovulation, we determined the cDNA sequence of the follicle-stimulating hormone (FSH) beta-subunit precursor protein using a combination of 5'- and 3'-rapid amplification of cDNA ends (RACE) with pituitary cDNA libraries of the Japanese White rabbit and compared it with those of other mammals. RACE experiments detected at least three transcripts for the FSHbeta precursor protein in the libraries. The transcripts had lengths of 457, 1,621, and 1,767 bp, from the 5'-end to the poly(A) site. The shortest and mid-length transcripts had the putative polyadenylation signal sequence AATAAA at nucleotides 436 and 1,601, respectively, whereas the longest form had an ATTAAA sequence at nucleotide 1,745 of the cDNA sequence. These transcripts are likely to be polyadenylation variants of one large transcript because they share the same coding sequence for the precursor protein (130 amino acid residues in length). However, only a few shortest variants seem to be formed because the shortest variants were not detected by Northern blot analysis. Phylogenetic analysis of the deduced amino acid sequence indicates that the rabbit is phylogenetically closer to humans than to the other mammals, suggesting that an FSH preparation from human sources would be superior as a follicle stimulant for the induction of superovulation.

Birth of offspring after transfer of Mongolian gerbil (Meriones unguiculatus) embryos cryopreserved by vitrification.

The Mongolian gerbil (Meriones unguiculatus) has been used as a laboratory species in many fields of research, including neurology, oncology, and parasitology. Although the cryopreservation of embryos has become a useful means to protect valuable genetic resources, its application to the Mongolian gerbil has not yet been reported. In this study, we investigated the in vitro and in vivo developmental competence of Mongolian gerbil embryos cryopreserved by vitrification. In vivo-fertilized embryos were vitrified on the day of collection using the ethylene glycol (EG)-based solutions EFS20 and EFS40, which contained 20% and 40% EG, respectively, in PB1 containing 30% (w/v) Ficoll 70 and 0.5 M sucrose. First, we compared one-step and two-step vitrification protocols. In the one-step method, the embryos were directly transferred into the vitrification solution (EFS40), whereas in the two-step method, the embryos were exposed serially to EFS20 and EFS40 and then vitrified. After liquefying (thawing), late two-cell embryos (collected on day 3) vitrified by the two-step method showed significantly better rates of in vitro development to the morula stage compared to those vitrified by the one-step method (65% vs. 5%, P < 0.0001). We then examined whether the same two-step method could be applied to early two-cell embryos (collected on day 2), four-cell embryos (day 4), morulae (day 5), and blastocysts (day 6). After liquefying, 87%-100% of the embryos were morphologically normal in all groups, and 23% and 96% developed to the compacted morula stage from early two- and four-cell embryos, respectively. After transfer into recipient females, 3% (4/123), 1% (1/102), 5% (4/73), and 10% (15/155) developed to full-term offspring from vitrified and liquefied early two-cell embryos, late two-cell embryos, morulae, and blastocysts, respectively. This demonstrates that Mongolian gerbil embryos can be safely cryopreserved using EG-based vitrification solutions.

Sequence analysis of cDNA encoding follicle-stimulating hormone and luteinizing hormone beta-subunits in the Mastomys (Praomys coucha).

To examine the molecular basis of efficient superovulation in the Mastomys (Praomys coucha), the cDNA sequences of the follicle-stimulating hormone (FSH) and luteinizing hormone (LH) beta-subunits were determined and compared with those of other mammals. FSHbeta and LHbeta cDNAs were 1606 and 513 bp long, respectively, from the 5'-ends to the putative polyA sites. The deduced sequences of the FSHbeta and LHbeta precursor proteins were 130 and 141 amino acids in length, respectively. The amino acid sequences of both mastomys hormone subunits showed overall similarity to those of other rodents. In particular, the N-terminus of the FSHbeta precursor protein is of the MM-type, like those of mice and rats, which suggests that the MM-type is characteristic of the subfamily Murinae. As we reported earlier for the Mongolian gerbil, the use of hCG for superovulation of mastomys might need to be re-evaluated, due to the low homology between hCG and rodent LH sequences.

Chromosomal mapping and zygosity check of transgenes based on flanking genome sequences determined by genomic walking.

Transgenes can affect transgenic mice via transgene expression or via the so-called positional effect. DNA sequences can be localized in chromosomes using recently established mouse genomic databases. In this study, we describe a chromosomal mapping method that uses the genomic walking technique to analyze genomic sequences that flank transgenes, in combination with mouse genome database searches. Genomic DNA was collected from two transgenic mouse lines harboring pCAGGS-based transgenes, and adaptor-ligated, enzyme restricted genomic libraries for each mouse line were constructed. Flanking sequences were determined by sequencing amplicons obtained by PCR amplification of genomic libraries with transgene-specific and adaptor primers. The insertion positions of the transgenes were located by BLAST searches of the Ensembl genome database using the flanking sequences of the transgenes, and the transgenes of the two transgenic mouse lines were mapped onto chromosomes 11 and 3. In addition, flanking sequence information was used to construct flanking primers for a zygosity check. The zygosity (homozygous transgenic, hemizygous transgenic and non-transgenic) of animals could be identified by differential band formation in PCR analyses with the flanking primers. These methods should prove useful for genetic quality control of transgenic animals, even though the mode of transgene integration and the specificity of flanking sequences needs to be taken into account.

Sequence analysis of cDNA encoding follicle-stimulating hormone and luteinizing hormone beta-subunits in the Mongolian gerbil (Meriones unguiculatus).

To examine the molecular basis for efficient superovulation in the Mongolian gerbil, the cDNA sequences of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) beta-subunits were determined and compared with those of other mammals. FSHbeta and LHbeta cDNAs were 1637 and 507bp long, respectively, from the 5'-end to putative polyA sites. The deduced sequences of the FSHbeta and LHbeta precursor proteins were 129 and 141 amino acids in length, respectively. The amino acid sequences of both Mongolian gerbil hormone subunits showed overall similarity to those of other rodents, confirming that the combination of equine chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG) should be effective for induction of superovulation in Mongolian gerbils, as in mice and rats. However, the use of hCG might need to be re-evaluated owing to its low homology to rodent LH.

Microinsemination with first-wave round spermatids from immature male mice.

In several mammalian species, including mice, round spermatids have been used to produce normal offspring by means of microinsemination techniques. In this study, we examined whether mouse round spermatids retrieved from immature testes undergoing the first wave of spermatogenesis had acquired fertilizing ability comparable to cells from mature adults. Microinsemination with round spermatids was performed by direct injection into preactivated oocytes, as previously reported. About 60-85% of the successfully injected oocytes developed to the morula/blastocyst stage after 72 h in culture, irrespective of the age of the males (17-25 days old). After embryo transfer, normal pups were obtained from all age groups, including the day-17 group, the stage at which the first round spermatids appeared. A high correlation (r=0.90) was found between the birth rate and male age (P<0.01, Spearman rank correlation), indicating that the efficiency of producing offspring was dependent on the age of the donor males. Imprinted genes (H19, Igf2, Meg3, and Igf2r) were expressed from the correct parental alleles (maternal, paternal, maternal, and maternal, respectively) in all (n=12) day-9.5 fetuses derived from day-20 spermatids. These results clearly indicate that at least some first-wave spermatogenic cells have a normal haploid genome with the correct paternal imprint and are capable of supporting full-term embryo development, as do mature spermatozoa from adults. The use of male germ cells from immature animals may save time in the production of inbred/congenic strains and rescue male-factor infertility of early onset.

Optimization of superovulation induction by human menopausal gonadotropin in guinea pigs based on follicular waves and FSH-receptor homologies.

The guinea pig represents an excellent animal model for the study of reproduction in humans and most domestic animals because unlike the mouse and rat, it undergoes a complete estrous cycle. In this study, we investigated the availability of ovarian oocytes during the estrous cycle, and the follicle stimulating hormone (FSH) receptor (FSH-R) homologies between guinea pigs and other species, in order to identify an effective gonadotropin and optimal time-of-application for the induction of superovulation in the guinea pig. The number of collectable ovarian oocytes showed biphasic changes with peaks at the midluteal and pre-ovulatory stages. On the other hand, the number of oocytes that matured in vitro remained constant ( approximately 10 oocytes) until day 14 post-ovulation and increased thereafter. The deduced amino acid sequence of the guinea pig FSH-R showed greater similarity to the primate FSH-R than to the rodent FSH-R, which suggests that commercially available human menopausal gonadotropin (hMG) may be a better inducer of superovulation in guinea pigs. Indeed, significantly more oocytes (5.4 +/- 1.6, range 0-17, n = 10) were obtained from hMG-treated guinea pigs at the pre-ovulatory stage than during spontaneous ovulation (3.6 +/- 0.1, n = 96; P < 0.05), whereas guinea pigs that received hMG at the midluteal stage (n = 3) did not ovulate. These results indicate that hMG is an effective, albeit stage-dependent, inducer of superovulation in the guinea pig, and that FSH-R homologies should be taken into account when choosing hormones for superovulation.

Physicochemical and biological properties of an extracellular serine protease of Aeromonas sobria.

Previously, we cloned a protease gene of Aeromonas sobria, determined its nucleotide sequence and established a method of purifying its product. In this study, we examined the properties of the purified protease. The protease was temperature-labile and had an optimal pH of 7.5. Metallo-protease inhibitors and a cysteine protease inhibitor did not block the proteolytic activity of the enzyme. The treatment with reagents to modify sulfhydryl group did not reduce the activity. But, serine protease inhibitors did, showing that it was a serine protease. Subsequently, we examined the ability of the protease to enhance vascular permeability in dorsal skin. The protease showed activity and the reaction was inhibited by a simultaneously injected antihistaminic agent. Histopathological examination showed that mast cells appeared around the site where the protease was injected. These findings show that the vascular permeability-enhancing effect of the protease is due to histamine released at the site. Furthermore, we found that a soybean trypsin inhibitor (Kunitz) did not block the proteolytic action of the protease in vitro, but inhibited its vascular permeability-enhancing activity in skin. This suggests that a trypsin-like protease from skin mediates the activity of the protease to enhance its vascular permeability.

Comparison of glycoprotein hormone alpha-subunits of laboratory animals.

The common alpha-subunit of glycoprotein hormones (CGalpha) is a core protein shared by follicle-stimulating hormone (FSH), luteinizing hormone (LH), and thyroid-stimulating hormone (TSH). In order to obtain a molecular basis for an efficient superovulation technique applicable to a wide range of animal species and to discuss the phylogenetic aspect based on molecules related to the reproductive system, we determined cDNA sequences of CGalpha in seven laboratory animals: the guinea pig, Mongolian gerbil, golden hamster, mastomys, Japanese field vole, the JF1 strain of Mus musculus molossinus, and rabbit. Comparison of the inferred CGalpha amino acid sequences of these animals and other mammals (human, mouse, rat, cow, pig, and sheep) showed that the signal peptides and the first ten residues at the N-terminus of the apoprotein were variable, while the rest of the apoproteins were highly conserved. In particular, all rodents had a leucine residue at the apoprotein N-terminus, except the guinea pig, which had a phenylalanine residue, as in the cow, pig, sheep, and rabbit. Phylogenetic trees constructed from amino acid sequences suggest a closer relationship between the guinea pig and artiodactyls than to rodents, confirming the taxonomic peculiarity of the guinea pig.

Early death of mice cloned from somatic cells.

Here we report that the lifespan of mice cloned from somatic cells is significantly shorter than that of genotype- and sex-matched controls, most likely due to severe pneumonia and hepatic failure. This finding demonstrates the possibility of long-term deleterious effects of somatic-cell cloning, even after normal birth.