RESUMEN
BACKGROUND AND PURPOSE: Malnutrition is associated with poor outcomes in different diseases. Our aim was to investigate whether measures of malnutrition could be used to predict 90-day outcomes in patients with vertebrobasilar artery occlusion (VBAO) undergoing endovascular treatment (EVT). METHODS: We retrospectively analyzed patients with VBAO who received EVT at three comprehensive stroke centers. Malnutrition was assessed using the controlling nutritional status (CONUT) score, geriatric nutritional risk index (GNRI), and prognostic nutritional index (PNI). Primary outcome was good functional outcome defined as modified Rankin Scale (mRS) 0-3 measured at 90 days. RESULTS: A total of 285 patients were enrolled, of which 260 (91.22%) met the requirements. According to the CONUT, GNRI, and PNI scores, the proportions of patients classified as moderately or severely malnourished were 7.3%, 3.08%, and 35%, respectively. In the multivariate regression model after adjusting for potential confounders, malnutrition (severe risk versus normal nutritional status) was significantly associated with an increased risk of poor prognosis for CONUT scores (adjusted odds ratio [OR]14.91, 95%CI, 1.69 - 131.71; Pâ¯=â¯0.015), GNRI scores (adjusted [OR] 10.67, 1.17 - 96.93; P =0.036) and PNI scores (adjusted [OR] 4.61, 2.28 - 9.31; P< 0.001). Similar results were obtained when malnutrition scores were analyzed as continuous variables. Adding the 3 malnutrition measures to the risk reclassification that included traditional risk factors significantly improved the predictive value of 3-month poor prognosis. CONCLUSIONS: Our study showed that malnutrition may be associated with poor prognosis within 3 months of EVT in patients with VBAO.
RESUMEN
Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.
RESUMEN
In recent years, the use of electronic vaping products (also named e-cigarettes) has increased due to their appealing flavors and nicotine delivery without the combustion of tobacco. Although the hazardous substances emitted by e-cigarettes are largely found to be much lower than combustible cigarettes, second-hand exposure to e-cigarette aerosols is not completely benign for bystanders. This work reviewed and synthesized findings on the second-hand exposure of aerosols from e-cigarettes and compared the results with those of the combustible cigarettes. In this review, different results were integrated based upon sampling locations such as residences, vehicles, offices, public places, and experimental exposure chambers. In addition, the factors that influence the second-hand exposure levels were identified by objectively reviewing and integrating the impacts of combustible cigarettes and e-cigarettes on the environment. It is a challenge to compare the literature data directly to assess the effect of smoking/vaping on the indoor environment. The room volume, indoor air exchange rate, puffing duration, and puffing numbers should be considered, which are important factors in determining the degree of pollution. Therefore, it is necessary to calculate the "emission rate" to normalize the concentration of pollutants emitted under various experimental conditions and make the results comparable. This review aims to increase the awareness regarding the harmful effects of the second-hand exposure to aerosols coming from the use of cigarettes and e-cigarettes, identify knowledge gaps, and provide a scientific basis for future policy interventions with regard to the regulation of smoking and vaping.
Asunto(s)
Sistemas Electrónicos de Liberación de Nicotina , Productos de Tabaco , Fumar , Nicotina , AerosolesRESUMEN
The Coronavirus Disease 2019 (COVID-19) has caused massive losses for the global economy. Scholars have used different methods to study the transmission mode and influencing factors of the virus to find effective methods to provide people with a healthy built environment. However, these studies arrived at different or even contradictory conclusions. This review presents the main research methodologies utilized in this field, summarizes the main investigation methods, and critically discusses their related conclusions. Data statistical analysis, sample collection, simulation models, and replication transmission scenarios are the main research methods. The summarized conclusion for prevention from all reviewed papers are: adequate ventilation and proper location of return air vents, proper use of personal protective equipment, as well as the reasonable and strict enforcement of policies are the main methods for reducing the transmission. Recommendations including standardized databases, causation clarification, rigorous experiment design, improved simulation accuracy and verification are provided.
Asunto(s)
Entorno Construido , COVID-19 , SARS-CoV-2 , COVID-19/transmisión , COVID-19/prevención & control , COVID-19/epidemiología , Humanos , Ventilación/métodos , Proyectos de Investigación , Equipo de Protección PersonalRESUMEN
Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25â for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.
RESUMEN
Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2â. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.
RESUMEN
Aroma is one of the decisive factors affecting the quality and consumer acceptance of edible mushrooms. This review summarized the key components and formation pathways of edible mushroom aroma. It also elaborated on the affecting factors and emerging analytical strategies of edible mushroom aroma. A total of 1308 volatile organic compounds identified in edible mushrooms, 61 were key components. The formation of these compounds is closely related to fatty acid metabolism, amino acid metabolism, lentinic acid metabolism, and terpenoid metabolism. The aroma profiles of edible mushrooms were affected by genetic background, preharvest factors, and preservation methods. Molecular sensory science and omics techniques are emerging analytical strategies to reveal aroma information of edible mushrooms. This review would provide valuable data and insights for future research on edible mushroom aroma.
Asunto(s)
Agaricales , Compuestos Orgánicos Volátiles , Agaricales/química , Odorantes , Vías Biosintéticas , Compuestos Orgánicos Volátiles/química , Metabolismo de los LípidosRESUMEN
A high-performance servo control system is the basis for realizing high-precision photoelectric tracking. With high position resolution and power-off self-locking, ultrasonic motors have a wide range of applications for high-precision positioning control. An optoelectronic tracking platform driven by two ultrasonic motors is proposed in this study. The shaft structure of the tracking platform is designed and modeled. The shaft structure is simplified, and a dynamic model is established to analyze the motion characteristics. The parameters of the limit mechanism are optimized based on the analysis. The shaft structure is built to verify the response characteristics of the tracking platform at different velocities. The results show that the proposed design can fully utilize the self-locking of ultrasonic motors for rapid automatic alignment of the axis system. The maximum response time is less than 55 ms. When the operating velocity is less than 70°/s, the positioning error is less than 0.055°, and the lower the speed, the smaller the positioning error.
RESUMEN
Particulate matter (PM2.5, PM10) in urban subway stations can significantly impact passengers' health. The particle concentration in subway stations is influenced by many factors. However, few existing studies have explored the impact of environmental control systems in-depth, especially under different outdoor pollution conditions. To address this research gap, this study focused on measuring and comparing the characteristics of PM2.5 and PM10 at subway stations with three control systems (open, closed, and screen door) under varying pollution conditions in Beijing. Particle concentrations from platforms, carriages, and outdoors were monitored and analyzed using statistical methods. The results showed that the particle concentration in the closed system was generally 20-40 µg/m3 higher than that in the screen system at the platform, which might be attributed to the piston wind, as the air from the tunnel with a lot of dirt. The pollution in the carriage was more severe for the open system than that of the screen system. The PM2.5/PM10 ratio in the carriage was 91%, 90%, and 83.84% for the closed, open, and screen systems, respectively. This indicates that the screen door could reduce the particle concentration in the platform to 10%-50%. The particle concentration varied among subway stations with different environmental control systems, suggesting that the prevention and control strategies for particulate matter pollution should be different for stations with different systems.
RESUMEN
Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage on a worldwide basis. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main producing region of TCM plants in China. Obvious galling symptoms were observed on the root systems of fifteen species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular level. Among the twenty diseased root samples collected, Meloidogyne hapla populations were identified in twelve samples (60%) and Meloidogyne incognita populations were identified in eight samples (40%). Among the fifteen species of diseased TCM plants, eight of them, namely Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants' response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram fresh weight of root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.
RESUMEN
We examined the effects of low temperature on egg hatching and killing rate of the 2nd instars of Meloi-dogyne incognita (J2) in the laboratory. We further evaluated the effects of two soil treatment methods on the survival rate of M. incognita in northern China in a field experiment. The results of laboratory experiment showed that survival rate of J2 was 0 after being subjected to -7 â for 24 hours, and that egg hatching was completely inhibited 24 hours after being subjected to -9 â. The survival rate of J2 was 0 after being subjected to -1, -2, -3, and -4 â for 8, 5, 3, and 1.5 d, respectively. Egg hatching was completely inhibited after being subjected to -2, -3, -4, and -5 â for 9, 6, 4, and 1 d, respectively. Results of the fitting analysis showed that both the relationships between the temperature and the lethal time of J2 as well as the temperature and the non-hatching time of the eggs followed exponential functions. The results of field test showed that death rate of M. incognita in 0-50 cm soil layer after ridging treatment and 0-30 cm soil layer after leveling treatment could reach 100%, while the disease index of the former in 30-40 cm and 40-50 cm was 84.9% and 75.8%, respectively, which was lower than that in the greenhouse. Our results suggest that preventing and controlling M. incognita in greenhouses through low-tempe-rature in winter could achieve a better control effect in Yulin City and the northward region. The proposed technique is convenient and has high potential for popularization.
Asunto(s)
Tylenchoidea , Animales , Temperatura , Frío , China , SueloRESUMEN
Laser spot detection and tracking play a critical role in laser techniques. However, traditional detection and tracking systems tend to be bulky and lack portability. Therefore, there is a growing emphasis on developing high-performance and miniaturized systems based on the field programmable gate array (FPGA). In this paper, a novel parallel multi-target detection and determination algorithm is proposed to address the issue of current FPGA-based systems' ineffective detection of laser spots in complex environments. Our simulation results demonstrate that the algorithm can effectively detect laser spots in complex environments. It can process a frame with an 800 × 480 resolution in only 7.88 ms at a 50 MHz image processing frequency, which means it can process more than 100 f/s and meet the real-time detection requirements. Such excellent detection performance is challenging to achieve with central processing units and advanced RISC machine microprocessors. Then, the algorithm is further deployed on an FPGA to build a prototype laser spot detection and tracking system. Practical tests show that the system can achieve a spot detection accuracy of around 90% under different luminous intensities, indicating excellent robustness of the designed algorithm. Besides, with the use of a piezoelectric actuator, speedy and precise tracking of the laser spot is implemented. The characteristics of speedy response, self-latching in power off, and no electromagnetic interference of the piezoelectric actuator give the system tremendous advantages in developing high-precision wireless communication control technology, which further broadens the application of the proposed system.
RESUMEN
Electronic cigarettes (E-cigarettes) have gained significant popularity in recent years as a substitute for combustible cigarettes. However, there is growing concern regarding the safety of E-cigarette products for both the users and those exposed passively to second-hand emissions, which contain nicotine and other toxic substances. In particular, the characteristics of second-hand PM1 exposure and the transmission of nicotine from E-cigarettes remain unclear. In this study, the untrapped mainstream aerosols from the E-cigarette and smoke from cigarettes were exhausted by the smoking machines which were operated under standardized puffing regimes to simulate second-hand vapor or smoke exposure. The concentrations and components of PM1 released from cigarettes and E-cigarettes were compared under varying environmental conditions and regulated using a heating, ventilation, and air conditioning (HVAC) system. Additionally, the ambient nicotine concentrations and the size distribution of the generated aerosols were determined at different distances from the release source. Results showed that PM1 accounted for the highest proportion (98 %) of the released particulate matter (PM1, PM2.5, and PM10). The mass median aerodynamic diameter (MMAD) of cigarette smoke (0.5 ± 0.01 µm, geometric standard deviation (GSD) 1.97 ± 0.1) was smaller than that of E-cigarette aerosols (1.06 ± 0.14 µm, GSD 1.79 ± 0.19). The PM1 concentrations and chemical components were effectively reduced when the HVAC system was utilized. Nicotine concentrations in E-cigarette aerosols were comparable to those of combustible cigarette emissions when close to the exposure source (0 m), while they declined more rapidly than cigarette smoke emissions with increasing distance from the source. Furthermore, the maximum nicotine concentrations occurred in 1 µm and 0.5 µm particles in E-cigarette and cigarette emissions, respectively. These results provide a scientific basis for the assessment of E-cigarette and cigarette aerosol passive exposure risks, guiding the development of environmental and human health control measures for these products.
Asunto(s)
Sistemas Electrónicos de Liberación de Nicotina , Productos de Tabaco , Humanos , Nicotina , Nicotiana , Gases , AerosolesRESUMEN
Introduction: Noise-induced calcium overload in sensory hair cells has been well documented as an early step in the pathogenesis of noise-induced hearing loss (NIHL). Alterations in cellular calcium homeostasis mediate a series of cellular events, including activation of calcium-dependent protein kinases and phosphatases. Using cell-membrane- and blood-brain-barrier-permeable calpain-1 (µ-calpain) and calpain-2 (m-calpain) inhibitor MDL-28170, we tested the involvement of calpains, a family of calcium-dependent cysteine proteases, and the potential of MDL-28170 in preventing NIHL. Methods: CBA/J mice at the age of 12 weeks were exposed to broadband noise with a frequency spectrum from 2-20 kHz for 2 h at 101 dB sound pressure level to induce permanent hearing loss as measured by auditory brainstem response and distortion product otoacoustic emissions. Morphological damage was assessed by quantification of remaining sensory hair cells and inner hair cell synapses 2 weeks after the exposure. Results: MDL-28170 treatment by intraperitoneal injection significantly attenuated noise-induced functional deficits and cochlear pathologies. MDL-28170 treatment also prevented noise-induced cleavage of alpha-fodrin, a substrate for calpain-1. Furthermore, MDL-28170 treatment prevented reduction of PI3K/Akt signaling after exposure to noise and upregulated p85α and p-Akt (S473) in outer hair cells. Discussion: These results indicate that noise-induced calpain activation negatively regulates PI3K/Akt downstream signaling, and that prevention of NIHL by treatment with MDL-28170 is associated with upregulation of PI3K/Akt survival signaling pathways.
RESUMEN
Edible mushrooms are the highly demanded foods of which production and consumption have been steadily increasing globally. Owing to the quality loss and short shelf-life in harvested mushrooms, it is necessary for the implementation of effective preservation and intelligent evaluation technologies to alleviate this issue. The aim of this review was to analyze the development and innovation thematic lines, topics, and trends by bibliometric analysis and review of the literature methods. The challenges faced in researching these topics were proposed and the mechanisms of quality loss in mushrooms during storage were updated. This review summarized the effects of chemical processing (antioxidants, ozone, and coatings), physical treatments (non-thermal plasma, packaging and latent thermal storage) and other emerging application on the quality of fresh mushrooms while discussing the efficiency in extending the shelf-life. It also discussed the emerging evaluation techniques based on the various chemometric methods and computer vision system in monitoring the freshness and predicting the shelf-life of mushrooms which have been developed. Preservation technology optimization and dynamic quality evaluation are vital for achieving mushroom quality control. This review can provide a comprehensive research reference for reducing mushroom quality loss and extending shelf-life, along with optimizing efficiency of storage and transportation operations.
RESUMEN
To reduce the influence of vibrations generated by the control moment gyroscopes (CMGs), the researchers have put a lot of effort into isolating the vibration between the CMG and the satellite in order to lessen the impact of vibrations produced by the CMGs. The flexibility of the isolator causes the extra degrees of motion for the CMG, which is coupled with the CMG's dynamic behavior and the control performance of the gimbal servo system is therefore changed. However, how the flexible isolator influences the performance of the gimbal controller is uncertain. In this research, the coupling effect on the gimbal closed-loop system is analyzed. Firstly, the dynamic equation of the flexible isolator supported CMG system is established, and a classic controller is used to keep the gimbal speed stable. Secondly, the energy method (the Lagrange equation) is adopted to calculate the deformation of the flexible isolator and the rotation of the gimbal. Based on the dynamic model, the simulation is conducted in the Matlab/Simulink, the frequency and the step response of the gimbal system is employed to better explore the inherent characteristics of the system. Finally, we conduct the experiments on a CMG prototype. The experimental results show that the isolator reduces the response speed of the system. Moreover, the closed-loop system could be unstable due to the coupling relationship between the flywheel and the closed-loop gimbal system. The obtained results would be helpful for the design of the isolator and the optimization of the control system of a CMG.
RESUMEN
Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.
RESUMEN
To address the problems of the large positioning error and long positioning time of the traditional positioning strategy, namely, the two-phase simultaneous power-off method (TPSPM), a new positioning strategy, called the first single-phase then two-phase power-off method (FSPTTPPM), based on the ultrasonic friction reduction theory, has been proposed in this work. This method realizes zero sliding displacement between the friction material and the stator during the torsional oscillation of the shaft by controlling the driving circle frequency and the duration of the single-phase power-off period, which reduces the deviation of the displacement reservation value. In order to verify the correctness of the driving mechanism, a test platform has been built, and two positioning strategies have been used for experimental verification. The following experimental results have been obtained: compared to TPSPM, FSPTTPPM has the advantages of higher positioning accuracy and short positioning time. In terms of the positioning accuracy, the relative errors of the displacement reservation values of FSPTTPPM and TPSPM vary with the initial angular velocity (0.24 to 1.18 rad/s) in the range of -0.4 to 0.1 and -0.8 to 0.8, respectively. In addition, the relative error of the displacement reservation value is closer to zero than that of TPSPM at the same initial angular velocity. In terms of the positioning time, when the initial angular velocity is greater than 0.7 rad/s, the positioning time of the FSPTTPPM is approximately 10 ms smaller than that of the TPSPM.
RESUMEN
As an advanced technology, simultaneous wireless information and power transfer (SWIPT), combined with the internet of things (IoT) devices, can effectively extend the online cycle of the terminal. To cope with the fluctuation of energy harvesting by the hybrid access points (H-AP), the energy cooperation base station is introduced to realize the sharing of renewable energy. In this paper, we study the SWIPT-enabled IoT networks with cooperation. Our goal is to maximize the energy efficiency of the system, and at the same time, we need to meet the energy harvesting constraints, user quality of service (QoS) constraints and transmission power constraints. We jointly solve the power allocation, time switching and energy cooperation problems. Because this problem is a nonlinear programming problem, it is difficult to solve directly, so we use the alternating variable method, the iterative algorithm is used to solve the power allocation and time switching problem, and the matching algorithm is used to solve the energy cooperation problem. Simulation results show that the proposed algorithm has obvious advantages in energy efficiency performance compared with the comparison algorithm. At the same time, it is also proved that the introduction of energy cooperation technology can effectively reduce system energy consumption and improve system energy efficiency.
RESUMEN
OBJECTIVE: Fear aura has traditionally been considered relevant to epileptic discharges from mesial temporal areas, and few studies have investigated its effect on surgical outcome in drug-resistant epilepsy. We aim to assess the localizing and lateralizing value as well as prognostic significance of fear aura in patients with focal epilepsy. METHODS: The occurrence of fear aura in relation to epileptogenic origin and its association with postoperative outcome were analyzed in 146 consecutive patients undergoing resective surgery for intractable epilepsy. RESULTS: Ninety-four (64.4%) patients reported auras, and 31 (21.2%) reported fear aura in their seizures. One hundred ten (75.3%) patients had an Engel class I outcome until last follow-up, of whom 24 experienced fear aura preoperatively. Fear aura appeared more frequently during temporal and frontal lobe seizures, but did not lateralize the seizure onset zone. There were no significant baseline differences between patients with and without fear aura. No correlation was found between postoperative outcome and the presence of auras. Occurrence of fear aura failed to show predictive value in surgical outcome whether in pooled or subgroup analysis. INTERPRETATION: This study advances our understanding of the origin of fear aura, and is helpful for presurgical evaluation and outcome prediction. Without lateralizing value, fear aura is more commonly seen with temporal or frontal origin. When taken as a whole, auras do not have a significant impact on seizure outcome in focal epilepsy. Patients with fear aura are no more likely to become seizure-free than those without fear aura.