Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 79
Filtrar
Más filtros












Base de datos
Intervalo de año de publicación
1.
Int J Biol Macromol ; 268(Pt 2): 131801, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38670185

RESUMEN

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.


Asunto(s)
G-Cuádruplex , Porfirinas , Porfirinas/química , Ligandos , ADN/química , Modelos Moleculares , Dicroismo Circular
2.
Heliyon ; 10(3): e24599, 2024 Feb 15.
Artículo en Inglés | MEDLINE | ID: mdl-38317891

RESUMEN

Peptide Nucleic Acids (PNAs) represent a promising tool for gene modulation in anticancer treatment. The uncharged peptidyl backbone and the resistance to chemical and enzymatic degradation make PNAs highly advantageous to form stable hybrid complexes with complementary DNA and RNA strands, providing higher stability than the corresponding natural analogues. Our and other groups' research has successfully shown that tailored PNA sequences can effectively downregulate the expression of human oncogenes using antigene, antisense, or anti-miRNA approaches. Specifically, we identified a seven bases-long PNA sequence, complementary to the longer loop of the main G-quadruplex structure formed by the bcl2midG4 promoter sequence, capable of downregulating the expression of the antiapoptotic Bcl-2 protein and enhancing the anticancer activity of an oncolytic adenovirus. Here, we extended the length of the PNA probe with the aim of including the double-stranded Bcl-2 promoter among the targets of the PNA probe. Our investigation primarily focused on the structural aspects of the resulting DNA2-PNA heterotriplex that were determined by employing conventional and accelerated microsecond-scale molecular dynamics simulations and chemical-physical analysis. Additionally, we conducted preliminary biological experiments using cytotoxicity assays on human A549 and MDA-MB-436 adenocarcinoma cell lines, employing the oncolytic adenovirus delivery strategy.

3.
J Colloid Interface Sci ; 663: 9-20, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38387188

RESUMEN

Peptide nucleic acid (PNA) is a DNA mimic that shows good stability against nucleases and proteases, forming strongly recognized complementary strands of DNA and RNA. However, due to its feeble ability to cross the cellular membrane, PNA activity and its targeting gene action is limited. Halloysite nanotubes (HNTs) are a natural and low-cost aluminosilicate clay. Because of their peculiar ability to cross cellular membrane, HNTs represent a valuable candidate for delivering genetic materials into cells. Herein, two differently charged 12-mer PNAs capable of recognizing as molecular target a 12-mer DNA molecule mimicking a purine-rich tract of neuroglobin were synthetized and loaded onto HNTs by electrostatic attraction interactions. After characterization, the kinetic release was also assessed in media mimicking physiological conditions. Resonance light scattering measurements assessed their ability to bind complementary single-stranded DNA. Furthermore, their intracellular delivery was assessed by confocal laser scanning microscopy on living MCF-7 cells incubated with fluorescence isothiocyanate (FITC)-PNA and HNTs labeled with a probe. The nanomaterials were found to cross cellular membrane and cell nuclei efficiently. Finally, it is worth mentioning that the HNTs/PNA can reduce the level of neuroglobin gene expression, as shown by reverse transcription-quantitative polymerase chain reaction and western blotting analysis.


Asunto(s)
ADN , Nanotubos , Arcilla , Neuroglobina , ARN Mensajero/genética , Nanotubos/química
4.
Int J Biol Macromol ; 253(Pt 4): 127062, 2023 Dec 31.
Artículo en Inglés | MEDLINE | ID: mdl-37748594

RESUMEN

G-wires are supramolecular DNA structures based on the G-quadruplex (G4) structural motif obtained by the self-assembly of interlocked slipped G-rich oligonucleotide (ON) strands, or by end-to-end stacking of G4 units. Despite the increasing interest towards G-wires due to their potential applications in DNA nanotechnologies, the self-assembly process to obtain G-wires having a predefined length and stability is still neither completely understood nor controlled. In our previous studies, we demonstrated that the d(5'CG2-3'-3'-G2C5') ON, characterized by the presence of a 3'-3'-inversion of polarity site self-assembles into a G-wire structure when annealed in the presence of K+ ions. Herein, by using CD, PAGE, HPLC size exclusion chromatography, and NMR investigations we studied the propensity of shorter analogues having sequences 5'CGn-3'-3'-GmC5' (with n = 1 and 1 ≤ m ≤ 3) to form the corresponding G-quadruplexes and stacked G-wires. The results revealed that the formation of G-wires starting from d(5'CGn-3'-3'-GmC5') ONs is possible only for the sequences having n and m > 1 in which both guanosines flanking the 5'-ending cytosines are not involved into the 3'-3' phosphodiester bond.


Asunto(s)
G-Cuádruplex , Oligonucleótidos/genética , Oligonucleótidos/química , ADN/química , Espectroscopía de Resonancia Magnética , Guanosina
5.
Int J Mol Sci ; 24(5)2023 Feb 23.
Artículo en Inglés | MEDLINE | ID: mdl-36901879

RESUMEN

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications.


Asunto(s)
Técnicas Biosensibles , Nanoestructuras , Óxido de Zinc , Óxido de Zinc/química , Nanoestructuras/química , Biotina/química , Técnicas Biosensibles/métodos
6.
Bioorg Chem ; 131: 106325, 2023 02.
Artículo en Inglés | MEDLINE | ID: mdl-36577221

RESUMEN

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.


Asunto(s)
Antineoplásicos , Complejos de Coordinación , Compuestos de Platino , Antineoplásicos/farmacología , Antineoplásicos/química , Cisplatino/química , Complejos de Coordinación/farmacología , Nucleósidos/farmacología , Nucleótidos , Compuestos de Platino/química , Compuestos de Platino/farmacología
7.
Gels ; 10(1)2023 Dec 22.
Artículo en Inglés | MEDLINE | ID: mdl-38247735

RESUMEN

Fmoc-diphenylalanine (Fmoc-FF) is a low-molecular-weight peptide hydrogelator. This simple all-aromatic peptide can generate self-supporting hydrogel materials, which have been proposed as novel materials for diagnostic and pharmaceutical applications. Our knowledge of the molecular determinants of Fmoc-FF aggregation is used as a guide to design new peptide-based gelators, with features for the development of improved tools. Here, we enlarge the plethora of Fmoc-FF-based hydrogelated matrices by studying the properties of the Fmoc-FFK tripeptide, alone or in combination with Fmoc-FF. For multicomponent matrices, the relative weight ratios between Fmoc-FFK and Fmoc-FF (specifically, 1/1, 1/5, 1/10, and 1/20 w/w) are evaluated. All the systems and their multiscale organization are studied using different experimental techniques, including rheology, circular dichroism, Fourier transform infrared spectroscopy, and scanning electron microscopy (SEM). Preliminary profiles of biocompatibility for the studied systems are also described by testing them in vitro on HaCaT and 3T3-L1 cell lines. Additionally, the lysine (K) residue at the C-terminus of the Fmoc-FF moiety introduces into the supramolecular material chemical functions (amino groups) which may be useful for modification/derivatization with bioactive molecules of interest, including diagnostic probes, chelating agents, active pharmaceutical ingredients, or peptide nucleic acids.

8.
Small ; 18(41): e2204732, 2022 10.
Artículo en Inglés | MEDLINE | ID: mdl-36089668

RESUMEN

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.


Asunto(s)
Antineoplásicos , Nanopartículas , Ácidos Nucleicos de Péptidos , Antineoplásicos/química , Antineoplásicos/farmacología , Antígeno B7-H1 , Línea Celular Tumoral , Tierra de Diatomeas , Disulfuros , Ligandos , Nanopartículas/química , Oxidación-Reducción , Péptidos , Polietilenglicoles/química , Receptor de Muerte Celular Programada 1 , Dióxido de Silicio
9.
Biomolecules ; 12(8)2022 08 03.
Artículo en Inglés | MEDLINE | ID: mdl-36008965

RESUMEN

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δß-turn + Δß-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the ß-structure are consistent with a partial protein destabilization due to the interaction with U2O.


Asunto(s)
Albúmina Sérica Bovina , Albúmina Sérica , Sitios de Unión , Dicroismo Circular , Simulación del Acoplamiento Molecular , Unión Proteica , Albúmina Sérica/química , Albúmina Sérica Bovina/química , Espectrometría de Fluorescencia , Termodinámica
10.
Int J Biol Macromol ; 219: 626-636, 2022 Oct 31.
Artículo en Inglés | MEDLINE | ID: mdl-35952813

RESUMEN

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC4A) and d(C6) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5'-d(C6)2 resulted stable enough to be detected even at near physiological conditions (37 °C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs.


Asunto(s)
Citosina , Oligonucleótidos , Acrilamidas , Dicroismo Circular , Citosina/química , ADN/química , Concentración de Iones de Hidrógeno , Conformación de Ácido Nucleico , Oligonucleótidos/química
11.
PLoS One ; 17(3): e0266090, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35358273

RESUMEN

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL.


Asunto(s)
Leucemia Linfocítica Crónica de Células B , Ácidos Nucleicos de Péptidos , Humanos , Leucemia Linfocítica Crónica de Células B/tratamiento farmacológico , Leucemia Linfocítica Crónica de Células B/genética , Leucocitos Mononucleares , Oligonucleótidos Antisentido/genética , Oligonucleótidos Antisentido/farmacología , Ácidos Nucleicos de Péptidos/química , ARN Mensajero/genética
12.
Cancers (Basel) ; 13(20)2021 Oct 09.
Artículo en Inglés | MEDLINE | ID: mdl-34680207

RESUMEN

Rewiring glucose metabolism toward aerobic glycolysis provides cancer cells with a rapid generation of pyruvate, ATP, and NADH, while pyruvate oxidation to lactate guarantees refueling of oxidized NAD+ to sustain glycolysis. CtPB2, an NADH-dependent transcriptional co-regulator, has been proposed to work as an NADH sensor, linking metabolism to epigenetic transcriptional reprogramming. By integrating metabolomics and transcriptomics in a triple-negative human breast cancer cell line, we show that genetic and pharmacological down-regulation of CtBP2 strongly reduces cell proliferation by modulating the redox balance, nucleotide synthesis, ROS generation, and scavenging. Our data highlight the critical role of NADH in controlling the oncogene-dependent crosstalk between metabolism and the epigenetically mediated transcriptional program that sustains energetic and anabolic demands in cancer cells.

13.
Int J Mol Sci ; 22(5)2021 Mar 02.
Artículo en Inglés | MEDLINE | ID: mdl-33801394

RESUMEN

The evolution of antibacterial resistance has arisen as the main downside in fighting bacterial infections pushing researchers to develop novel, more potent and multimodal alternative drugs.Silver and its complexes have long been used as antimicrobial agents in medicine due to the lack of silver resistance and the effectiveness at low concentration as well as to their low toxicities compared to the most commonly used antibiotics. N-Heterocyclic Carbenes (NHCs) have been extensively employed to coordinate transition metals mainly for catalytic chemistry. However, more recently, NHC ligands have been applied as carrier molecules for metals in anticancer applications. In the present study we selected from literature two NHC-carbene based on acridinescaffoldand detailed nonclassicalpyrazole derived mono NHC-Ag neutral and bis NHC-Ag cationic complexes. Their inhibitor effect on bacterial strains Gram-negative and positivewas evaluated. Imidazolium NHC silver complex containing the acridine chromophore showed effectiveness at extremely low MIC values. Although pyrazole NHC silver complexes are less active than the acridine NHC-silver, they represent the first example of this class of compounds with antimicrobial properties. Moreover all complexesare not toxic and they show not significant activity againstmammalian cells (Hek lines) after 4 and 24 h. Based on our experimental evidence, we are confident that this promising class of complexes could represent a valuable starting point for developing candidates for the treatment of bacterial infections, delivering great effectiveness and avoiding the development of resistance mechanisms.


Asunto(s)
Antibacterianos/farmacología , Bacterias/efectos de los fármacos , Compuestos Heterocíclicos/farmacología , Metano/análogos & derivados , Plata/química , Antibacterianos/química , Catálisis , Células HEK293 , Compuestos Heterocíclicos/química , Humanos , Metano/química , Estructura Molecular
14.
Molecules ; 26(4)2021 Feb 13.
Artículo en Inglés | MEDLINE | ID: mdl-33668428

RESUMEN

Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action.


Asunto(s)
Antivirales , Tratamiento Farmacológico de COVID-19 , Reposicionamiento de Medicamentos , Nucleósidos , SARS-CoV-2/metabolismo , Síndrome Respiratorio Agudo Grave/tratamiento farmacológico , Coronavirus Relacionado al Síndrome Respiratorio Agudo Severo/metabolismo , Animales , Antivirales/química , Antivirales/uso terapéutico , COVID-19/epidemiología , COVID-19/metabolismo , Humanos , Nucleósidos/química , Nucleósidos/uso terapéutico , Síndrome Respiratorio Agudo Grave/epidemiología , Síndrome Respiratorio Agudo Grave/metabolismo
15.
Nanomaterials (Basel) ; 10(11)2020 Nov 10.
Artículo en Inglés | MEDLINE | ID: mdl-33182823

RESUMEN

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS). A functionalization strategy towards the realization of a potential PNA-based device is described. A PNA, able to detect the SCN5A gene associated with the BS, has been properly synthesized and used as a bioprobe for the realization of a proof-of-concept label-free optical PNA-biosensor. PSi reflectance and GO photoluminescence signals were simultaneously exploited for the monitoring of the device functionalization and response.

16.
Pharmaceutics ; 12(7)2020 Jul 04.
Artículo en Inglés | MEDLINE | ID: mdl-32635488

RESUMEN

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium Streptomyces Tubercidicus. In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin. In addition, the cell viability was evaluated against HeLa, A375 and WM266 human cancer cell lines using the MTT test. Lastly, the results of the apoptotic assay (FITC Annexin V) performed on the HeLa cancer cell line are also reported.

17.
Mar Drugs ; 18(1)2020 Jan 11.
Artículo en Inglés | MEDLINE | ID: mdl-31940851

RESUMEN

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.


Asunto(s)
Antineoplásicos/farmacología , Productos Biológicos/farmacología , G-Cuádruplex , Péptidos/farmacología , Organismos Acuáticos/química , Productos Biológicos/química , Humanos , Ligandos , Péptidos/química , Unión Proteica/efectos de los fármacos
19.
Mar Drugs ; 17(8)2019 Aug 17.
Artículo en Inglés | MEDLINE | ID: mdl-31426471

RESUMEN

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the "northern" ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5'-sugar positions. Preliminary Ca2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well.


Asunto(s)
Señalización del Calcio/efectos de los fármacos , Calcio/metabolismo , ADP-Ribosa Cíclica/metabolismo , Canal Liberador de Calcio Receptor de Rianodina/metabolismo , Erizos de Mar/química , Sistemas de Mensajero Secundario/efectos de los fármacos , Animales , Diferenciación Celular/efectos de los fármacos , Huevos , Relación Estructura-Actividad
20.
Molecules ; 24(12)2019 Jun 13.
Artículo en Inglés | MEDLINE | ID: mdl-31200538

RESUMEN

Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors. This review focuses on some recent achievements in the design of advanced label-free optical aptasensors using porous silicon (PSi) as a transducer surface for the detection of pathogenic microorganisms and diagnostic molecules with high sensitivity, reliability and low limit of detection (LoD).


Asunto(s)
Aptámeros de Nucleótidos/química , Técnicas Biosensibles , Porosidad , Reproducibilidad de los Resultados , Técnica SELEX de Producción de Aptámeros , Silicio/química
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA
...