RESUMEN
Chirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA. Spectroscopic analysis reveals chiral transfer from DOPA enantiomers to porphyrin hetero-aggregates, followed by the disruption of these latter and subsequent generation of chiral melanin structures in solution. Quartz substrates inserted into these solutions spontaneously accumulate homogeneous melanin-like films over days, demonstrating the feasibility of self-assembly. The resulting films exhibit characteristic UV/Vis and CD spectra, with distinct signals indicating successful chiral induction. Interestingly, the AFM characterizations reveal a distinct surface morphology, and in addition, some thermal and mechanical properties have been taken into account. Overall, this study sheds light on the formation, stability, and chiroptical properties of melanin-based films, paving the way for their application in various fields.
RESUMEN
Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.
Asunto(s)
MicroARNs , Porfirinas , Humanos , Porfirinas/química , Zinc , Oligonucleótidos , Dicroismo CircularRESUMEN
Many chronic diseases, including cancer and neurodegeneration, are linked to proteasome dysregulation. Proteasome activity, essential for maintaining proteostasis in a cell, is controlled by the gating mechanism and its underlying conformational transitions. Thus, developing effective methods to detect gate-related specific proteasome conformations could be a significant contribution to rational drug design. Since the structural analysis suggests that gate opening is associated with a decrease in the content of α-helices and ß-sheets and an increase in random coil structures, we decided to explore the application of electronic circular dichroism (ECD) in the UV region to monitor the proteasome gating. A comparison of ECD spectra of wild type yeast 20S proteasome (predominantly closed) and an open-gate mutant (α3ΔN) revealed an increased intensity in the ECD band at 220 nm, which suggests increased contents of random coil and ß-turn structures. This observation was further supported by evaluating ECD spectra of human 20S treated with low concentration of SDS, known as a gate-opening reagent. Next, to evaluate the power of ECD to probe a ligand-induced gate status, we treated the proteasome with H2T4, a tetracationic porphyrin that we showed previously to induce large-scale protein conformational changes upon binding to h20S. H2T4 caused a significant increase in the ECD band at 220 nm, interpreted as an induced opening of the 20S gate. In parallel, we imaged the gate-harboring alpha ring of the 20S with AFM, a technique that we used previously to visualize the predominantly closed gate in latent human or yeast 20S and the open gate in α3ΔN mutant. The results were convergent with the ECD data and showed a marked decrease in the content of closed-gate conformation in the H2T4-treated h20S. Our findings provide compelling support for the use of ECD measurements to conveniently monitor proteasome conformational changes related to gating phenomena. We predict that the observed association of spectroscopic and structural results will help with efficient design and characterization of exogenous proteasome regulators.
Asunto(s)
Complejo de la Endopetidasa Proteasomal , Humanos , Dicroismo Circular , Complejo de la Endopetidasa Proteasomal/química , Conformación Proteica , Saccharomyces cerevisiae/genética , Saccharomyces cerevisiae/metabolismo , Microscopía de Fuerza AtómicaRESUMEN
Protonated achiral H2 TPPS4 spontaneously self-arranges at acids pH and high ionic strength to build mesoscopic J-aggregates that are intrinsically chiral. According to the symmetry rule aggregation leads to a racemate that, however, can be unbalanced by chemical (chiral pollutants) or physical stimuli (as vortexing the solution). Vortexing the title racemate, in principle, might either induce chiral separation or chiral enrichment. Indeed, herein it is shown that vortices enable the resolution of this racemic solution exploiting the tendency to deposit, onto the quartz cuvette walls, of the enantiomer favored by the stirring sense. Simultaneously, over time, it was found that the opposite chiral conformation becomes prevalent in solution realizing a significant enantiomeric resolution. Therefore, after removing all stirring-favored chiral J-aggregate from the solution, the recovering and isolating of the desired enantiomers from the cuvette walls was successfully obtained without complex procedures. In this sense, it has been demonstrated that the stirring forces are executively able to fulfil the chiral separation in H2 TPPS4 J-aggregates, employed as model of a self-assembled system in aqueous solution.
RESUMEN
Cationic porphyrins exhibit an amazing variety of binding modes and inhibition mechanisms of 20S proteasome. Depending on the spatial distribution of their electrostatic charges, they can occupy different sites on α rings of 20S proteasome by exploiting the structural code responsible for the interaction with regulatory proteins. Indeed, they can act as competitive or allosteric inhibitors by binding at the substrate gate or at the grooves between the α subunits, respectively. Moreover, the substitution of a charged moiety in the peripheral arm with a hydrophobic moiety revealed a "new" 20S functional state with higher substrate affinity and catalytic efficiency. In the present study, we expand our structure-activity relationship (SAR) analysis in order to further explore the potential of this versatile class of 20S modulators. Therefore, we have extended the study to additional macrocyclic compounds, displaying different structural features, comparing their interaction behavior on the 20S proteasome with previously investigated compounds. In particular, in order to evaluate how the introduction of a peptidic chain can affect the affinity and the interacting mechanism of porphyrins, we investigate the MTPyApi, a porphyrin derivatized with an Arg-Pro-rich antimicrobial peptide. Moreover, to unveil the role played by the porphyrin core, this was replaced with a corrole scaffold, a "contracted" version of the tetrapyrrolic ring due to the lack of a methine bridge. The analysis has been undertaken by means of integrated kinetic, Nuclear Magnetic Resonance, and computational studies. Finally, in order to assess a potential pharmacological significance of this type of investigation, a preliminary attempt has been performed to evaluate the biological effect of these molecules on MCF7 breast cancer cells in dark conditions, envisaging that porphyrins may indeed represent a powerful tool for the modulation of cellular proteostasis.
Asunto(s)
Porfirinas , Complejo de la Endopetidasa Proteasomal , Cinética , Porfirinas/química , Porfirinas/farmacología , Complejo de la Endopetidasa Proteasomal/metabolismo , Inhibidores de Proteasoma/farmacología , Proteolisis , ProteostasisRESUMEN
The pivotal role played by potassium ions in the noncovalent synthesis of discrete porphyrin-calixarene nanostructures has been examined. The flattened-cone conformation adopted by the two cavities of octa-cationic calix[4]tube C4T was found to prevent the formation of complexes with well-defined stoichiometry between this novel water-soluble calixarene and the tetra-anionic phenylsulfonate porphyrin CuTPPS. Conversely, preorganization of C4T into a C4v-symmetrical scaffold, triggered by potassium ion encapsulation (C4T@K+), allowed us to carry out an efficient hierarchical self-assembly process leading to 2D and 3D nanostructures. The stepwise formation of discrete CuTPPS/C4T@K+ noncovalent assemblies, containing up to 33 molecular elements, was conveniently monitored by UV/vis spectroscopy by following the absorbance of the porphyrin Soret band.
Asunto(s)
Calixarenos/química , Ferroquelatasa/química , Nanoestructuras/química , Porfirinas/química , Complejos de Coordinación/química , Iones/química , Metaloporfirinas/química , Conformación Molecular , Estructura Molecular , Potasio/química , Ésteres del Ácido Sulfúrico/químicaRESUMEN
The present study provides new evidence that cationic porphyrins may be considered as tunable platforms to interfere with the structural "key code" present on the 20S proteasome α-rings and, by consequence, with its catalytic activity. Here, we describe the functional and conformational effects on the 20S proteasome induced by the cooperative binding of the tri-cationic 5-(phenyl)-10,15,20-(tri N-methyl-4-pyridyl) porphyrin (Tris-T4). Our integrated kinetic, NMR, and in silico analysis allowed us to disclose a complex effect on the 20S catalytic activity depending on substrate/porphyrin concentration. The analysis of the kinetic data shows that Tris-T4 shifts the relative populations of the multiple interconverting 20S proteasome conformations leading to an increase in substrate hydrolysis by an allosteric pathway. Based on our Tris-T4/h20S interaction model, Tris-T4 is able to affect gating dynamics and substrate hydrolysis by binding to an array of negatively charged and hydrophobic residues present on the protein surface involved in the 20S molecular activation by the regulatory proteins (RPs). Accordingly, despite the fact that Tris-T4 also binds to the α3ΔN mutant, allosteric modulation is not observed since the molecular mechanism connecting gate dynamics with substrate hydrolysis is impaired. We envisage that the dynamic view of the 20S conformational equilibria, activated through cooperative Tris-T4 binding, may work as a simplified model for a better understanding of the intricate network of 20S conformational/functional states that may be mobilized by exogenous ligands, paving the way for the development of a new generation of proteasome allosteric modulators.
Asunto(s)
Regulación Alostérica/genética , Cationes/metabolismo , Porfirinas/metabolismo , Complejo de la Endopetidasa Proteasomal/metabolismo , Catálisis , Cationes/farmacología , Citoplasma/genética , Humanos , Cinética , Resonancia Magnética Nuclear Biomolecular , Porfirinas/farmacología , Complejo de la Endopetidasa Proteasomal/genética , Unión Proteica/efectos de los fármacosRESUMEN
Gold nanoparticles show important electronic and optical properties, owing to their size, shape, and electronic structures. Indeed, gold nanoparticles containing no more than 30-40 atoms are only luminescent, while nanometer-sized gold nanoparticles only show surface plasmon resonance. Therefore, it appears that gold nanoparticles can alternatively be luminescent or plasmonic and this represents a severe restriction for their use as optical material. The aim of our study was the fabrication of nanoscale assembly of Au nanoparticles with bi-functional porphyrin molecules that work as bridges between different gold nanoparticles. This functional architecture not only exhibits a strong surface plasmon, due to the Au nanoparticles, but also a strong luminescence signal due to porphyrin molecules, thus, behaving as an artificial organized plasmonic and fluorescent network. Mutual Au nanoparticles-porphyrin interactions tune the Au network size whose dimension can easily be read out, being the position of the surface plasmon resonance strongly indicative of this size. The present system can be used for all the applications requiring plasmonic and luminescent emitters.
RESUMEN
In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC)2 in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC)2 . Whilst when the Z form of the poly (dG-dC)2 is induced, a slight intercalation of the porphyrin between the basis has been detected.
Asunto(s)
ADN/química , Porfirinas/química , Espermina/química , Dicroismo Circular , Conformación de Ácido Nucleico , Espectrofotometría UltravioletaRESUMEN
Antibiotics represent essential drugs to contrast the insurgence of bacterial infections in humans and animals. Their extensive use in livestock farming, including aquaculture, has improved production performances and food safety. However, their overuse can implicate a risk of water pollution and related antimicrobial resistance. Consequently, innovative strategies for successfully removing antibiotic contaminants have to be advanced to protect human health. Among them, photodegradation TiO2-driven under solar irradiation appears not only as a promising method, but also a sustainable pathway. Hence, we evaluated several composite TiO2 powders with H2TCPP, CuTCPP, ZnTCPP, and SnT4 porphyrin for this scope in order to explore the effect of porphyrins sensitization on titanium dioxide. The synthesis was realized through a fully non-covalent functionalization in water at room conditions. The efficacy of obtained composite materials was also tested in photodegrading oxolinic acid and oxytetracycline in aqueous solution at micromolar concentrations. Under simulated solar irradiation, TiO2 functionalized with CuTCPP has shown encouraging results in the removal of oxytetracycline from water, by opening the way as new approaches to struggle against antibiotic's pollution and, finally, to represent a new valuable tool of public health.
Asunto(s)
Antibacterianos/química , Farmacorresistencia Bacteriana , Fotólisis , Porfirinas/química , Gestión de Riesgos , Titanio/química , Agua/química , Adsorción , Ácido Oxolínico/química , Oxitetraciclina/química , Espectrofotometría UltravioletaRESUMEN
The hierarchical assembly, in aqueous solution, of a new multi-metalloporphyrin/calixarene aggregate has been accomplished. In this supramolecular system transfer of chirality, from the outermost components to the central porphyrin reporter, takes place as a result of favorable and fully noncovalent long-range electronic communication.
RESUMEN
Chiral porphyrin hetero-aggregates, produced from meso-tetrakis(4-N-methylpyridyl) porphyrin H2T4 and copper(II) meso-tetrakis(4-sulfonatophenyl)porphyrin CuTPPS by an imprinting effect in the presence of L-3,4-dihydroxyphenylalanine (L-DOPA), are shown herein to serve as templates for the generation of chiral structures during the oxidative conversion of the amino acid to melanin. This remarkable phenomenon is suggested to involve the initial role of L-DOPA and related chiral intermediates like dopachrome as templates for the production of chiral porphyrin aggregates. When the entire chiral pool from DOPA is lost, chiral porphyrin hetero-aggregate would elicit axially chiral oligomer formation from 5,6-dihydroxyindole intermediates in the later stages of melanin synthesis. These results, if corroborated by further studies, may open unprecedented perspectives for efficient strategies of asymmetric melanin synthesis with potential biological and technological applications.
RESUMEN
The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water. The functional mats in this study were obtained by two different approaches based on fiber impregnation or doping. In particular, meso-tetraphenyl porphyrin (H2TPP) or zinc(II) meso-tetraphenyl porphyrin (ZnTPP) were immobilized on the surface of PES fiber mats by dip-coating or added to the PES electrospun solution to obtain porphyrin-doped PES mats. The presence of porphyrins on the fiber surfaces was confirmed by UV-Vis spectroscopy, fluorescence measurements, and XPS analysis. p-NA removal from water solutions was spectrophotometrically detected and evaluated.
Asunto(s)
Compuestos de Anilina/química , Nanofibras/química , Polímeros/química , Sulfonas/química , Aguas Residuales/química , Purificación del Agua , Porfirinas/químicaRESUMEN
We report of the interactions between four amino acids lysine (Lys), arginine (Arg), histidine (His), and phenylalanine (Phe) with the J-aggregates of the protonated 5,10,15,20-tetrakis(4-sulfonatophenyl)-porphyrin H4TPPS. Several aspects of these self-assembled systems have been analyzed: (i) the chiral transfer process; (ii) the hierarchical effects leading to the aggregates formation; and, (iii) the influence of the amino acid concentrations on both transferring and storing chiral information. We have demonstrated that the efficient control on the J-aggregates chirality is obtained when all amino acids are tested and that the chirality transfer process is under hierarchical control. Finally, the chiral porphyrin aggregates obtained exhibit strong chiral inertia.
Asunto(s)
Aminoácidos/química , Porfirinas/química , Dicroismo Circular , Punto Isoeléctrico , Espectrofotometría Ultravioleta , EstereoisomerismoRESUMEN
The chirality of (nano)structures is paramount in many phenomena, including biological processes, self-assembly, enantioselective reactions, and light or electron spin polarization. In the quest for new chiral materials, metallo-organic hybrids have been attractive candidates for exploiting the aforementioned scientific fields. Here, we show that chiral carbon nanoparticles, called carbon nanodots, can be readily prepared using hydrothermal microwave-assisted synthesis and easily purified. These particles, with a mean particle size around 3 nm, are highly soluble in water and display mirror-image profile both in the UV-Vis and in the infrared regions, as detected by electronic and vibrational circular dichroism, respectively. Finally, the nanoparticles are used as templates for the formation of chiral supramolecular porphyrin assemblies, showing that it is possible to use and transfer the chiral information. This simple (and effective) methodology opens up exciting opportunities for developing a variety of chiral composite materials and applications.
RESUMEN
Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.
RESUMEN
Hybrid poly(ether sulfones) (PES)-TiO2 electrospun mats are used as selective filters to remove lead and zinc ions from water. Presence of TiO2 is functional to trigger fiber's surface charge that allows for better performances in terms of ionic adsorption with respect to bare PES mats. Temperature increase promotes a speed up of ion removal. Ability of electrospun mats to retain adsorbed ions is proven by washing procedures, which confirm the lack of released Pb2+ in solution, even after sonication. To detect presence of metal ions in aqueous solutions, water-soluble porphyrins are used as chemosensors, which are able to provide fast, in-field, and real-time analysis. In particular, cationic H2T4 metalation, occurring both in solution or at transparent glass surface, allows for a straightforward spectrophotometric (UV-vis) detection of metal ions in solution.
RESUMEN
The importance of allosteric proteasome inhibition in the treatment of cancer is becoming increasingly evident. Motivated by this urgent therapeutic need, we have recently identified cationic porphyrins as a highly versatile class of molecules able to regulate proteasome activity by interfering with gating mechanisms. In the present study, the mapping of electrostatic contacts bridging the regulatory particles with the α-rings of the human 20S proteasome led us to the identification of (meso-tetrakis(4-N-methylphenyl pyridyl)-porphyrin (pTMPyPP4) as a novel non-competitive inhibitor of human 20S proteasome. pTMPyPP4 inhibition mechanism implies a positive cooperative binding to proteasome, which disappears when a permanently open proteasome mutant (α-3ΔN) is used, supporting the hypothesis that the events associated with allosteric proteasome inhibition by pTMPyPP4 interfere with 20S gating and affect its "open-closed" equilibrium. Therefore, we propose that the spatial distribution of the negatively charged residues responsible for the interaction with regulatory particles at the α-ring surface of human 20S may be exploited as a blueprint for the design of allosteric proteasome regulators.
Asunto(s)
Regulación Alostérica/efectos de los fármacos , Porfirinas/farmacología , Complejo de la Endopetidasa Proteasomal/metabolismo , Inhibidores de Proteasoma/farmacología , Sitios de Unión , Microscopía por Crioelectrón , Humanos , Cinética , Simulación del Acoplamiento Molecular , Mutagénesis , Porfirinas/química , Porfirinas/metabolismo , Complejo de la Endopetidasa Proteasomal/química , Complejo de la Endopetidasa Proteasomal/genética , Estructura Cuaternaria de Proteína , Subunidades de Proteína/química , Subunidades de Proteína/genética , Subunidades de Proteína/metabolismo , Electricidad EstáticaRESUMEN
In this work we have designed a new zinc(II) porphyrin with four spermines conjugate in the meso positions, meso-tetrakis-(4-carboxysperminephenyl)porphyrin, ZnTCPPSpm4) with the aim of acting as a chiroptical probe for the Z-form of DNA, a high energy transient conformation of DNA. In addition to monitor by Electronic Circular Dichroism chiroptical response the formation of Z-DNA in the presence of micromolar concentration of spermine, this porphyrin based molecular probe is also able to catalyze and stabilize this important DNA structure. The ZnTCPPSpm4 conjugate represents a perfect example of single molecule, which possesses all these three properties at the same time. The increased stability of Z-DNA in the presence of this derivative opens possibility for further studies on the mechanism of B- to Z-DNA transition, and on the design of new probes with improved efficiency.
Asunto(s)
ADN Forma B/química , ADN de Forma Z/química , Sondas Moleculares/química , Porfirinas/química , Dicroismo Circular , EstereoisomerismoRESUMEN
Herein, we exploit the induction of chirality by chiral Zn(ii) Schiff-base complexes, followed by their spontaneous dissociation in aqueous solution, providing for the first time a possibility of overcoming the template removal steps, to demonstrate memorization of chirality in porphyrin hetero-aggregates.