Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 27
Filtrar
Más filtros












Base de datos
Intervalo de año de publicación
1.
Antiviral Res ; 221: 105767, 2024 01.
Artículo en Inglés | MEDLINE | ID: mdl-38040199

RESUMEN

Tick-borne encephalitis virus (TBEV), the causative agent of tick-borne encephalitis (TBE), is a medically important flavivirus endemic to the European-Asian continent. Although more than 12,000 clinical cases are reported annually worldwide, there is no anti-TBEV therapy available to treat patients with TBE. Porphyrins are macrocyclic molecules consisting of a planar tetrapyrrolic ring that can coordinate a metal cation. In this study, we investigated the cytotoxicity and anti-TBEV activity of a large series of alkyl- or (het)aryl-substituted porphyrins, metalloporphyrins, and chlorins and characterized their molecular interactions with the viral envelope in detail. Our structure-activity relationship study showed that the tetrapyrrole ring is an essential structural element for anti-TBEV activity, but that the presence of different structurally distinct side chains with different lengths, charges, and rigidity or metal cation coordination can significantly alter the antiviral potency of porphyrin scaffolds. Porphyrins were demonstrated to interact with the TBEV lipid membrane and envelope protein E, disrupt the TBEV envelope and inhibit the TBEV entry/fusion machinery. The crucial mechanism of the anti-TBEV activity of porphyrins is based on photosensitization and the formation of highly reactive singlet oxygen. In addition to blocking viral entry and fusion, porphyrins were also observed to interact with RNA oligonucleotides derived from TBEV genomic RNA, indicating that these compounds could target multiple viral/cellular structures. Furthermore, immunization of mice with porphyrin-inactivated TBEV resulted in the formation of TBEV-neutralizing antibodies and protected the mice from TBEV infection. Porphyrins can thus be used to inactivate TBEV while retaining the immunogenic properties of the virus and could be useful for producing new inactivated TBEV vaccines.


Asunto(s)
Virus de la Encefalitis Transmitidos por Garrapatas , Encefalitis Transmitida por Garrapatas , Porfirinas , Humanos , Animales , Ratones , Virus de la Encefalitis Transmitidos por Garrapatas/genética , Anticuerpos Antivirales/uso terapéutico , Envoltura Viral , Internalización del Virus , Porfirinas/farmacología , Porfirinas/uso terapéutico , ARN , Antivirales/farmacología , Antivirales/uso terapéutico , Cationes/uso terapéutico
2.
Bioelectrochemistry ; 156: 108611, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-37995502

RESUMEN

G-quadruplexes (G4) are stable alternative secondary structures of nucleic acids. With increasing understanding of their roles in biological processes and their application in bio- and nanotechnology, the exploration of novel methods for the analysis of these structures is becoming important. In this work, N-methyl mesoporphyrin IX (NMM) was used as a voltammetric probe for an easy electrochemical detection of G4s. Cyclic voltammetry on a hanging mercury drop electrode (HMDE) was used to detect NMM with a limit of detection (LOD) of 40 nM. Characteristic reduction signal of NMM was found to be substantially higher in the presence of G4 oligodeoxynucleotides (ODNs) than in the presence of single- or double-stranded ODNs and even ODNs susceptible to form G4s but in their unfolded, single-stranded forms. Gradual transition from unstructured single strand to G4, induced by increasing concentrations of the G4 stabilizing K+ ions, was detected by an electrochemical method for the first time. All obtained results were supported by circular dichroism spectroscopy. This work expands on the concept of electrochemical probes utilization in DNA secondary structure recognition and offers a proof of principle that can be potentially employed in the development of novel electroanalytical methods for nucleic acid structure studies.


Asunto(s)
G-Cuádruplex , Mercurio , ADN/química , Mesoporfirinas/química , Mercurio/análisis
3.
Int J Biol Macromol ; 250: 125905, 2023 Oct 01.
Artículo en Inglés | MEDLINE | ID: mdl-37487990

RESUMEN

In this contribution, we focused on a fundamental study targeting the interaction of water-soluble [6]helicene derivative 1 (1-butyl-3-(2-methyl[6]helicenyl)-imidazolium bromide) with double-stranded (ds) DNA. A synthetic 30-base pair duplex, plasmid, chromosomal calf thymus and salmon DNA were investigated using electrochemistry, electrophoresis and spectroscopic tools supported by molecular dynamics (MD) and quantum mechanical approaches. Both experimental and theoretical work revealed the minor groove binding of 1 to the dsDNA. Both the positively charged imidazole ring and hydrophobic part of the side chain contributed to the accommodation of 1 into the dsDNA structure. Neither intercalation into the duplex DNA nor the stable binding of 1 to single-stranded DNA were found in topoisomerase relaxation experiments with structural components of 1, i.e. [6]helicene (2) and 1-butyl-3-methylimidazolium bromide (3), nor by theoretical calculations. Finally, the binding of optically pure enantiomers (P)-1 and (M)-1 was studied using circular dichroism spectroscopy, isothermal titration calorimetry and UV Resonance Raman (UVRR) methods. Using MD and quantum mechanical methods, minor groove and semi-intercalation were proposed for compound 1 as the predominant binding modes. From the UVRR findings, we also can conclude that 1 tends to preferentially interact with adenine and guanine residues in the structure of dsDNA.

4.
Nucleic Acids Res ; 51(6): 2950-2962, 2023 04 11.
Artículo en Inglés | MEDLINE | ID: mdl-36912102

RESUMEN

Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.


Asunto(s)
ADN , Conformación de Ácido Nucleico , Cinética , Motivos de Nucleótidos , ADN/genética , ADN/química , Concentración de Iones de Hidrógeno
5.
Nucleic Acids Res ; 50(8): 4574-4600, 2022 05 06.
Artículo en Inglés | MEDLINE | ID: mdl-35420134

RESUMEN

We have identified seven putative guanine quadruplexes (G4) in the RNA genome of tick-borne encephalitis virus (TBEV), a flavivirus causing thousands of human infections and numerous deaths every year. The formation of G4s was confirmed by biophysical methods on synthetic oligonucleotides derived from the predicted TBEV sequences. TBEV-5, located at the NS4b/NS5 boundary and conserved among all known flaviviruses, was tested along with its mutated variants for interactions with a panel of known G4 ligands, for the ability to affect RNA synthesis by the flaviviral RNA-dependent RNA polymerase (RdRp) and for effects on TBEV replication fitness in cells. G4-stabilizing TBEV-5 mutations strongly inhibited RdRp RNA synthesis and exhibited substantially reduced replication fitness, different plaque morphology and increased sensitivity to G4-binding ligands in cell-based systems. In contrast, strongly destabilizing TBEV-5 G4 mutations caused rapid reversion to the wild-type genotype. Our results suggest that there is a threshold of stability for G4 sequences in the TBEV genome, with any deviation resulting in either dramatic changes in viral phenotype or a rapid return to this optimal level of G4 stability. The data indicate that G4s are critical elements for efficient TBEV replication and are suitable targets to tackle TBEV infection.


Asunto(s)
Antivirales , Virus de la Encefalitis Transmitidos por Garrapatas , G-Cuádruplex , Antivirales/farmacología , Antivirales/uso terapéutico , Virus de la Encefalitis Transmitidos por Garrapatas/efectos de los fármacos , Virus de la Encefalitis Transmitidos por Garrapatas/genética , Encefalitis Transmitida por Garrapatas/tratamiento farmacológico , Encefalitis Transmitida por Garrapatas/genética , Humanos , Ligandos , ARN Viral/genética , ARN Polimerasa Dependiente del ARN/genética
6.
Chemistry ; 27(47): 12115-12125, 2021 Aug 19.
Artículo en Inglés | MEDLINE | ID: mdl-34145655

RESUMEN

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.


Asunto(s)
G-Cuádruplex , Secuencia de Bases , ADN/genética , Guanina , Regiones Promotoras Genéticas
7.
Int J Mol Sci ; 21(17)2020 Aug 25.
Artículo en Inglés | MEDLINE | ID: mdl-32854410

RESUMEN

Recently, we reported an inhibitory effect of guanine substitutions on the conformational switch from antiparallel to parallel quadruplexes (G4) induced by dehydrating agents. As a possible cause, we proposed a difference in the sensitivity of parallel and antiparallel quadruplexes to the guanine substitutions in the resulting thermodynamic stability. Reports on the influence of guanine substitutions on the biophysical properties of intramolecular parallel quadruplexes are rare. Moreover, such reports are often complicated by the multimerisation tendencies of parallel quadruplexes. To address this incomplete knowledge, we employed circular dichroism spectroscopy (CD), both as stopped-flow-assisted fast kinetics measurements and end-point measurements, accompanied by thermodynamic analyses, based on UV absorption melting profiles, and electrophoretic methods. We showed that parallel quadruplexes are significantly more sensitive towards guanine substitutions than antiparallel ones. Furthermore, guanine-substituted variants, which in principle might correspond to native genomic sequences, distinctly differ in their biophysical properties, indicating that the four guanines in each tetrad of parallel quadruplexes are not equal. In addition, we were able to distinguish by CD an intramolecular G4 from intermolecular ones resulting from multimerisation mediated by terminal tetrad association, but not from intermolecular G4s formed due to inter-strand Hoogsteen hydrogen bond formation. In conclusion, our study indicates significant variability in parallel quadruplex structures, otherwise disregarded without detailed experimental analysis.


Asunto(s)
Sustitución de Aminoácidos , ADN/química , Guanina/química , Dicroismo Circular , ADN/genética , G-Cuádruplex , Enlace de Hidrógeno , Modelos Moleculares , Conformación de Ácido Nucleico , Termodinámica
8.
Chemistry ; 25(58): 13422-13428, 2019 Oct 17.
Artículo en Inglés | MEDLINE | ID: mdl-31453656

RESUMEN

Guanine quadruplexes, recently reported to form in vivo, represent a broad spectrum of non-canonical conformations of nucleic acids. The actual conformation might differ between water solutions and crowding or dehydrating solutions that better reflect the conditions in the cell. Here we show, using spectroscopic techniques, that most guanine substitutions prevent the conformational switch from antiparallel or hybrid forms to parallel ones when induced by dehydrating agents. The inhibitory effect does not depend on the position of the substitution, but, interestingly, on the type of substitution and, to some extent, on its destabilising potential. A parallel form might be induced in some cases by ligands such as N-methyl mesoporphyrin IX and even this ligand-induced switch is inhibited by guanine substitution. The ability or inability to have a conformation switch, based on actual conditions, might significantly influence potential conformation-dependent quadruplex interactions.

9.
Methods Mol Biol ; 2035: 25-44, 2019.
Artículo en Inglés | MEDLINE | ID: mdl-31444742

RESUMEN

Circular Dichroic (CD) spectroscopy is one of the most frequently used methods for guanine quadruplex studies and in general for studies of conformational properties of nucleic acids. The reason is its high sensitivity to even slight changes in mutual orientation of absorbing bases of DNA. CD can reveal formation of particular structural DNA arrangements and can be used to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters, and also to detect formation of higher order structures. CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies due to its sensitivity, easy manipulation of studied samples, and relative inexpensiveness. In this part, we present the protocol for the use of CD spectroscopy in the study of guanine quadruplexes, together with practical advice and cautions about various, particularly interpretation, difficulties.


Asunto(s)
ADN/química , G-Cuádruplex , Dicroismo Circular , Espectroscopía de Resonancia Magnética , Conformación de Ácido Nucleico , Difracción de Rayos X
10.
Molecules ; 24(11)2019 May 31.
Artículo en Inglés | MEDLINE | ID: mdl-31159174

RESUMEN

Expansions of trinucleotide repeats (TNRs) are associated with genetic disorders such as Friedreich's ataxia. The tumor suppressor p53 is a central regulator of cell fate in response to different types of insults. Sequence and structure-selective modes of DNA recognition are among the main attributes of p53 protein. The focus of this work was analysis of the p53 structure-selective recognition of TNRs associated with human neurodegenerative diseases. Here, we studied binding of full length p53 and several deletion variants to TNRs folded into DNA hairpins or loops. We demonstrate that p53 binds to all studied non-B DNA structures, with a preference for non-B DNA structures formed by pyrimidine (Py) rich strands. Using deletion mutants, we determined the C-terminal DNA binding domain of p53 to be crucial for recognition of such non-B DNA structures. We also observed that p53 in vitro prefers binding to the Py-rich strand over the purine (Pu) rich strand in non-B DNA substrates formed by sequence derived from the first intron of the frataxin gene. The binding of p53 to this region was confirmed using chromatin immunoprecipitation in human Friedreich's ataxia fibroblast and adenocarcinoma cells. Altogether these observations provide further evidence that p53 binds to TNRs' non-B DNA structures.


Asunto(s)
ADN/química , ADN/metabolismo , Ataxia de Friedreich/genética , Ataxia de Friedreich/metabolismo , Conformación de Ácido Nucleico , Expansión de Repetición de Trinucleótido , Repeticiones de Trinucleótidos , Proteína p53 Supresora de Tumor/metabolismo , Expresión Génica , Humanos , Unión Proteica , Dominios y Motivos de Interacción de Proteínas , Pirimidinas , Proteínas Recombinantes , Proteína p53 Supresora de Tumor/química
11.
Nucleic Acids Res ; 47(5): 2177-2189, 2019 03 18.
Artículo en Inglés | MEDLINE | ID: mdl-30715498

RESUMEN

The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.


Asunto(s)
ADN/química , Conformación de Ácido Nucleico , Motivos de Nucleótidos , Emparejamiento Base , Secuencia de Bases , Citosina/química , Citosina/metabolismo , ADN/metabolismo , Concentración de Iones de Hidrógeno , Cinética , Termodinámica
12.
Nucleic Acids Res ; 46(4): 1624-1634, 2018 02 28.
Artículo en Inglés | MEDLINE | ID: mdl-29378012

RESUMEN

i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.


Asunto(s)
ADN/química , Telómero/química , Adenina/análogos & derivados , Adenina/química , Citosina/química , Daño del ADN , Humanos , Pentoxil (Uracilo)/análogos & derivados , Pentoxil (Uracilo)/química , Uracilo/química
13.
Biochim Biophys Acta Gen Subj ; 1861(11 Pt A): 2750-2757, 2017 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-28756275

RESUMEN

BACKGROUND: The DNA lesions, resulting from oxidative damage, were shown to destabilize human telomere four-repeat quadruplex and to alter its structure. Long telomere DNA, as a repetitive sequence, offers, however, other mechanisms of dealing with the lesion: extrusion of the damaged repeat into loop or shifting the quadruplex position by one repeat. METHODS: Using circular dichroism and UV absorption spectroscopy and polyacrylamide electrophoresis, we studied consequences of lesions at different positions of the model five-repeat human telomere DNA sequences on the structure and stability of their quadruplexes in sodium and in potassium. RESULTS: The repeats affected by lesion are preferentially positioned as terminal overhangs of the core quadruplex structurally similar to the four-repeat one. Forced affecting of the inner repeats leads to presence of variety of more parallel folds in potassium. In sodium the designed models form mixture of two dominant antiparallel quadruplexes whose population varies with the position of the affected repeat. The shapes of quadruplex CD spectra, namely the height of dominant peaks, significantly correlate with melting temperatures. CONCLUSION: Lesion in one guanine tract of a more than four repeats long human telomere DNA sequence may cause re-positioning of its quadruplex arrangement associated with a shift of the structure to less common quadruplex conformations. The type of the quadruplex depends on the loop position and external conditions. GENERAL SIGNIFICANCE: The telomere DNA quadruplexes are quite resistant to the effect of point mutations due to the telomere DNA repetitive nature, although their structure and, consequently, function might be altered.


Asunto(s)
G-Cuádruplex/efectos de los fármacos , Estrés Oxidativo/genética , Telómero/química , Dicroismo Circular , Guanina/química , Humanos , Conformación de Ácido Nucleico/efectos de los fármacos , Mutación Puntual , Secuencias Repetitivas de Ácidos Nucleicos/genética , Sodio/toxicidad , Espectroscopía Infrarroja Corta , Telómero/efectos de los fármacos , Telómero/genética
14.
Nucleic Acids Res ; 45(8): 4294-4305, 2017 05 05.
Artículo en Inglés | MEDLINE | ID: mdl-28369584

RESUMEN

Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.


Asunto(s)
Adenina/química , ADN/química , Furanos/química , G-Cuádruplex , Acortamiento del Telómero , Telómero/ultraestructura , Dicroismo Circular , ADN/genética , Humanos , Modelos Moleculares , Resonancia Magnética Nuclear Biomolecular , Oligonucleótidos/química , Soluciones , Telómero/genética
15.
Biochim Biophys Acta Gene Regul Mech ; 1860(2): 175-183, 2017 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-27863263

RESUMEN

The Oct4 gene codes for a transcription factor that plays a critical role in the maintenance of pluripotency in embryonic and cancer stem cells. Its expression thus has to be tightly regulated. We performed biophysical characterization of the promoter region using a combination of UV absorption, CD, and NMR spectroscopies, native PAGE and chemical probing, which was followed by functional studies involving luciferase reporter assays performed in osteosarcoma and human embryonic stem cell lines. We have shown that the evolutionarily conserved G-rich region close to the Oct4 transcription start site in the non-template strand forms a parallel G-quadruplex structure. We characterized its structure and stability upon point mutations in its primary structure. Functional studies then revealed that whereas the wild type quadruplex sequence ensures high reporter gene expression, the expression of mutated variants is significantly decreased proportionally to the destabilizing effect of the mutations on the quadruplex. A ligand, N-methyl mesoporphyrin IX that increases the stability of formed quadruplex rescued the reporter expression of single-mutated variants to the level of wild-type, but it has no effect on a mutated variant that cannot form quadruplex. These data indicate that the quadruplex acts as a strong, positive regulator of Oct4 expression and as such it might serve as a potential target for therapeutic intervention.


Asunto(s)
Factor 3 de Transcripción de Unión a Octámeros/genética , Regiones Promotoras Genéticas/genética , Línea Celular Tumoral , Dicroismo Circular/métodos , Células Madre Embrionarias/efectos de los fármacos , Células Madre Embrionarias/metabolismo , G-Cuádruplex/efectos de los fármacos , Genes Reporteros/genética , Humanos , Imagen por Resonancia Magnética/métodos , Mesoporfirinas/farmacología , Mutación/genética , Osteosarcoma/genética , Regiones Promotoras Genéticas/efectos de los fármacos , Sitio de Iniciación de la Transcripción/efectos de los fármacos , Sitio de Iniciación de la Transcripción/fisiología
16.
Biochimie ; 128-129: 83-91, 2016.
Artículo en Inglés | MEDLINE | ID: mdl-27422117

RESUMEN

The tumor suppressor protein p53 is a key factor in genome stability and one of the most studied of DNA binding proteins. This is the first study on the interaction of wild-type p53 with guanine quadruplexes formed by the human telomere sequence. Using electromobility shift assay and ELISA, we show that p53 binding to telomeric G-quadruplexes increases with the number of telomeric repeats. Further, p53 strongly favors G-quadruplexes folded in potassium over those formed in sodium, thus indicating the telomeric G-quadruplex conformational selectivity of p53. The presence of the quadruplex-stabilizing ligand, N-methyl mesoporphyrin IX (NMM), increases p53 recognition of G-quadruplexes in potassium. Using deletion mutants and selective p53 core domain oxidation, both p53 DNA binding domains are shown to be crucial for telomeric G-quadruplex recognition.


Asunto(s)
ADN/química , G-Cuádruplex , Telómero/química , Proteína p53 Supresora de Tumor/química , Secuencia de Bases , Sitios de Unión/genética , Unión Competitiva , Dicroismo Circular , ADN/genética , ADN/metabolismo , Ensayo de Cambio de Movilidad Electroforética , Ensayo de Inmunoadsorción Enzimática , Humanos , Mesoporfirinas/química , Mutación , Oligonucleótidos/química , Oligonucleótidos/genética , Oligonucleótidos/metabolismo , Potasio/química , Unión Proteica , Secuencias Repetidas en Tándem/genética , Telómero/genética , Telómero/metabolismo , Proteína p53 Supresora de Tumor/genética , Proteína p53 Supresora de Tumor/metabolismo
17.
Biochimie ; 118: 15-25, 2015 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-26188111

RESUMEN

Various base lesions continuously form in cellular nucleic acids and the unrepaired lesions are promutagenic and procarcinogenic. Though natural base lesions have been extensively studied in double-stranded DNA models, these studies are only less than a decade old for non-canonical DNA models, such as quadruplexes. Here we present a report on the effects of three frequently occurring natural lesions that can form in the TTA loops on the structure of the human telomere quadruplex d[AG3(TTAG3)3]. We compared the effect of the abasic site and 8-oxoadenine replacing adenine and 5-hydroxymethyluracil substituting for thymine. The results showed that the three lesions impacted the stability and quadruplex folding in markedly different ways. The effects depended on the type of lesion and the position in the sequence. Analogous lesions of guanine in the G-tetrads extensively destabilized the quadruplex and the effects depended more on the position than on the type of lesion. The distinct effects of the loop substitutions as well as comparison of the modifications of the loops and the quadruplex tetrads are discussed in this communication.


Asunto(s)
Daño del ADN/genética , G-Cuádruplex , Modelos Moleculares , Conformación de Ácido Nucleico , Telómero/química , Dicroismo Circular , Humanos , Telómero/genética
18.
Nucleic Acids Res ; 41(21): 9891-900, 2013 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-23963698

RESUMEN

5-Hydroxymethylcytosine (5-hmC) was recently identified as a relatively frequent base in eukaryotic genomes. Its physiological function is still unclear, but it is supposed to serve as an intermediate in DNA de novo demethylation. Using X-ray diffraction, we solved five structures of four variants of the d(CGCGAATTCGCG) dodecamer, containing either 5-hmC or 5-methylcytosine (5-mC) at position 3 or at position 9. The observed resolutions were between 1.42 and 1.99 Å. Cytosine modification in all cases influences neither the whole B-DNA double helix structure nor the modified base pair geometry. The additional hydroxyl group of 5-hmC with rotational freedom along the C5-C5A bond is preferentially oriented in the 3' direction. A comparison of thermodynamic properties of the dodecamers shows no effect of 5-mC modification and a sequence-dependent only slight destabilizing effect of 5-hmC modification. Also taking into account the results of a previous functional study [Münzel et al. (2011) (Improved synthesis and mutagenicity of oligonucleotides containing 5-hydroxymethylcytosine, 5-formylcytosine and 5-carboxylcytosine. Chem. Eur. J., 17, 13782-13788)], we conclude that the 5 position of cytosine is an ideal place to encode epigenetic information. Like this, neither the helical structure nor the thermodynamics are changed, and polymerases cannot distinguish 5-hmC and 5-mC from unmodified cytosine, all these effects are making the former ones non-mutagenic.


Asunto(s)
5-Metilcitosina/química , Citosina/análogos & derivados , ADN Forma B/química , Cationes/química , Cristalografía por Rayos X , Citosina/química , Epigénesis Genética , Modelos Moleculares , Termodinámica , Agua/química
19.
ACS Nano ; 7(7): 5701-10, 2013 Jul 23.
Artículo en Inglés | MEDLINE | ID: mdl-23763613

RESUMEN

Nucleic acids are finding applications in nanotechnology as nanomaterials, mechanical devices, templates, and biosensors. G-quadruplex DNA, formed by π-π stacking of guanine (G) quartets, is an attractive alternative to regular B-DNA because of the kinetic and thermodynamic stability of quadruplexes. However, they suffer from a fatal flaw: the rules of recognition, i.e., the formation of a G-quartet in which four identical bases are paired, prevent the controlled assembly between different strands, leading to complex mixtures. In this report, we present the solution to this recognition problem. The proposed design combines two DNA elements: parallel-stranded duplexes and a quadruplex core. Parallel-stranded duplexes direct controlled assembly of the quadruplex core, and their strands present convenient points of attachments for potential modifiers. The exceptional stability of the quadruplex core provides integrity to the entire structure, which could be used as a building block for nucleic acid-based nanomaterials. As a proof of principle for the design's versatility, we assembled quadruplex-based 1D structures and visualized them using atomic force and transmission electron microscopy. Our findings pave the way to broader utilization of G-quadruplex DNA in structural DNA nanomaterials.


Asunto(s)
Cristalización/métodos , ADN/química , ADN/ultraestructura , G-Cuádruplex , Sustancias Macromoleculares/química , Ensayo de Materiales , Conformación Molecular , Propiedades de Superficie
20.
Chirality ; 24(9): 691-8, 2012 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-22696273

RESUMEN

Nucleic acids bear the genetic information and participate in its expression and evolution during replication, repair, recombination, transcription, and translation. These phenomena are mostly based on recognition of nucleic acids by proteins. The major factor enabling the specific recognition is structure. Circular dichroism (CD) spectroscopy is very useful to study secondary structures of nucleic acids, in general, and DNA, in particular. CD sensitively reflects isomerizations among distinct conformational states. The isomerizations may operate as molecular switches regulating various physiological or pathological processes. Here, we review CD spectra of nucleic acids, beginning with early studies on natural DNA molecules through analyses of synthetic polynucleotides to study of selected genomic fragments.


Asunto(s)
Dicroismo Circular , ADN/química , G-Cuádruplex , Secuencia de Bases , ADN/genética , Humanos , Repeticiones de Trinucleótidos
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA
...