Emergence and spread of Mycobacterium ulcerans at different geographic scales.

The classical lineage of Mycobacterium ulcerans is the most prevalent clonal group associated with Buruli ulcer in humans. Its reservoir is strongly associated with the environment. We analyzed together 1,045 isolates collected from 13 countries on two continents to define the evolutionary history and population dynamics of this lineage. We confirm that this lineage spread over 7,000 years from Australia to Africa with the emergence of outbreaks in distinct waves in the 18th and 19th centuries. In sharp contrast with its global spread over the last century, transmission chains are now mostly local, with little or no dissemination between endemic areas. This study provides new insights into the phylogeography and population dynamics of M. ulcerans, highlighting the importance of comparative genomic analyses to improve our understanding of pathogen transmission. IMPORTANCE: Mycobacterium ulcerans is an environmental mycobacterial pathogen that can cause Buruli ulcer, a severe cutaneous infection, mostly spread in Africa and Australia. We conducted a large genomic study of M. ulcerans, combining genomic and evolutionary approaches to decipher its evolutionary history and pattern of spread at different geographic scales. At the scale of villages in an endemic area of Benin, the circulating genotypes have been introduced in recent decades and are not randomly distributed along the river. On a global scale, M. ulcerans has been spreading for much longer, resulting in distinct and compartmentalized endemic foci across Africa and Australia.

First report of black leaf streak disease in bananas caused by Pseudocercospora fijiensis on Mauritius island.

Pseudocercospora fijiensis, the causal agent of the black leaf streak disease of bananas (plants in the genus Musa) (BLSD), is considered to be the major economic threat to export-banana cultivation (de Bellaire, Fouré, Abadie, & Carlier, 2010). The disease has a worldwide distribution throughout the humid tropical regions and has been previously reported in the Southwestndian Ocean (SWIO) area: in 1993 in Mayotte and Comoros islands (DR Jones & Mourichon, 1993), in 2000 in Madagascar (Jones, 2003; Rivas, Zapater, Abadie, & Carlier, 2004) and in 2018 in Reunion Island (Rieux et al., 2019). In Mauritius, the presence of Pseudocercospora fijiensis was suspected in 1996 (Soomary & Benimadhu, 1998) but has never been confirmed, as symptoms could have been confounded with Pseudocercospora musae or Pseudocercospora eumusae, two causal agents of others leaf spot diseases of banana which were previously described in Mauritius in 1959 (Orieux & Felix, 1968) and 2000 (Carlier, Zapater, Lapeyre, Jones, & Mourichon, 2000), respectively. In March 2022, typical BLSD symptoms were observed at relatively low prevalence in a Cavendish crop located in the "Balance John" area (site S1 on Fig. S1-A) of Mauritius island. Typical early symptoms (stages 2) were 1- to 4-mm long brown streaks at the abaxial leaf surface, and typical older streaks (stages 3 and 4) were also observed (Fig. S1-B). These symptoms were mixed with symptoms of ELSD caused by P. eumusae. Since both species cannot be clearly distinguished only on the description of symptoms, conidial sporulation on stages 2 was checked in the laboratory (Ngando et al., 2015) since P. eumusae does not produce conidia on these young stages. In April 2022, banana leaves bearing symptoms of leaf spot diseases were collected in 7 different sites (Fig. S1-A). All leaf fragments were sent to the CIRAD laboratories where molecular diagnosis was performed following the protocol developed by Arzanlou et al. (2007). In brief, genomic DNA was extracted from ground leaf fragments displaying symptoms using the DNeasy® Plant Mini Kit (Qiagen®, Courtaboeuf, France). At each site, a total of 6 lesions cut from 6 different leaves were pooled. The DNA extracts were added as templates for real-time PCR assay designed to specifically detect the presence of P. fijiensis, P. musae and P. eumusae using MFbf/MFbrtaq/MFbp, MEbf/MEbrtaq/FMep and MMbf/Mmbrtaq/FMep primers and probes, respectively (Arzanlou et al., 2007). Both positive and negative controls were included in the assay and every sample reaction was duplicated. P. fijiensis was detected from 2 out of 7 sites (S2 and S7, see Fig.S2-B). P. eumusae was detected at all sites while P. musae was found in one site only (S6). Interestingly, our results also showed coinfection by P. fijiensis - P. eumusae & P. musae - P. eumusae on several sites. The presence of P. fijiensis was further confirmed by several investigations performed on conidia isolated from S2 samples including i) morphological observations of conidia displaying P. fijiensis type description (Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021), Fig. S2-A), ii) DNA sequencing of 16S ribosomal gene with ITS1 & ITS4 primers (GenBank accessions Nos. OR515818-OR515810) with BLAST results displaying percentages of identity > 99.70% with type strains and iii) Koch's postulates were fulfilled by artificial inoculation of detached leaf pieces as described in Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021) (Fig. S2-D). In brief, for the artificial inoculation, symptoms obtained after inoculation of both a strain isolated in Mauritius (S2-MAU) and a positive control (T+) were compared and shown to be typical of P. fijiensis species for the 3 replicates. To the best of our knowledge, this is the first official report of P. fijiensis and BLSD in Mauritius Island. This revelation holds significant importance for both the agricultural and scientific communities, shedding light on the potential spread and impact of this devastating pathogen in previously unaffected regions. From a global perspective, this discovery underscores the interconnectedness of agricultural ecosystems and the need for vigilance in monitoring and responding to emerging plant diseases in an increasingly interconnected world (Vega et al. 2022). Future investigations will be required to monitor the spread of BLSD on the island, describe the genetic structure of populations and identify routes of invasion at the SWOI scale.

Herbarium specimen sequencing allows precise dating of Xanthomonas citri pv. citri diversification history.

Herbarium collections are an important source of dated, identified and preserved DNA, whose use in comparative genomics and phylogeography can shed light on the emergence and evolutionary history of plant pathogens. Here, we reconstruct 13 historical genomes of the bacterial crop pathogen Xanthomonas citri pv. citri (Xci) from infected Citrus herbarium specimens. Following authentication based on ancient DNA damage patterns, we compare them with a large set of modern genomes to estimate their phylogenetic relationships, pathogenicity-associated gene content and several evolutionary parameters. Our results indicate that Xci originated in Southern Asia ~11,500 years ago (perhaps in relation to Neolithic climate change and the development of agriculture) and diversified during the beginning of the 13th century, after Citrus diversification and before spreading to the rest of the world (probably via human-driven expansion of citriculture through early East-West trade and colonization).

One Health compartment analysis of ESBL-producing Escherichia coli reveals multiple transmission events in a rural area of Madagascar.

BACKGROUND: ESBL-producing Escherichia coli (ESBL-Ec) is considered a key indicator for antimicrobial resistance (AMR) epidemiological surveillance in animal, human and environment compartments. There is likelihood of ESBL-Ec animal-human transmission but proof of cross-compartment transmission is still unclear. OBJECTIVES: To characterize ESBL-Ec genetic similarity in various compartments (humans, animals and environment) from a rural area of Madagascar. METHODS: We collected ESBL-Ec isolates prospectively from humans, animals and the environment (water) between April and October 2018. These isolates were subject to WGS and analysed with cutting-edge phylogenomic methods to characterize population genetic structure and infer putative transmission events among compartments. RESULTS: Of the 1454 samples collected, 512 tested positive for ESBL-Ec. We successfully sequenced 510 samples, and a phylogenomic tree based on 179 365 SNPs was produced. Phylogenetic distances between and amongst compartments were indistinguishable, and 104 clusters of recent transmission events between compartments were highlighted. Amongst a large diversity of ESBL-Ec genotypes, no lineage host specificity was observed, indicating the regular occurrence of ESBL-Ec transfer among compartments in rural Madagascar. CONCLUSIONS: Our findings stress the importance of using a phylogenomic approach on ESBL-Ec samples in various putative compartments to obtain a clear baseline of AMR transmissions in rural settings, where one wants to identify risk factors associated with transmission or to measure the effect of 'One Health' interventions in low- and middle-income countries.

Phylostems: a new graphical tool to investigate temporal signal of heterochronous sequences datasets.

Motivation: Molecular tip-dating of phylogenetic trees is a growing discipline that uses DNA sequences sampled at different points in time to co-estimate the timing of evolutionary events with rates of molecular evolution. Importantly, such inferences should only be performed on datasets displaying sufficient temporal signal, a feature important to test prior to any tip-dating inference. For this purpose, the most popular method considered to-date has been the 'root-to-tip regression' which consist in fitting a linear regression of the number of substitutions accumulated from the root to the tips of a phylogenetic tree as a function of sampling times. The main limitation of the regression method, in its current implementation, relies in the fact that the temporal signal can only be tested at the whole-tree scale (i.e. its root). Results: To overcome this limitation we introduce Phylostems, a new graphical user-friendly tool developed to investigate temporal signal within every clade of a phylogenetic tree. We provide a 'how to' guide by running Phylostems on an empirical dataset and supply guidance for results interpretation. Availability and implementation: Phylostems is freely available at https://pvbmt-apps.cirad.fr/apps/phylostems.

Suspicions of two bridgehead invasions of Xylella fastidiosa subsp. multiplex in France.

Of American origin, a wide diversity of Xylella fastidiosa strains belonging to different subspecies have been reported in Europe since 2013 and its discovery in Italian olive groves. Strains from the subspecies multiplex (ST6 and ST7) were first identified in France in 2015 in urban and natural areas. To trace back the most probable scenario of introduction in France, the molecular evolution rate of this subspecies was estimated at 3.2165 × 10-7 substitutions per site per year, based on heterochronous genome sequences collected worldwide. This rate allowed the dating of the divergence between French and American strains in 1987 for ST6 and in 1971 for ST7. The development of a new VNTR-13 scheme allowed tracing the spread of the bacterium in France, hypothesizing an American origin. Our results suggest that both sequence types were initially introduced and spread in Provence-Alpes-Côte d'Azur (PACA); then they were introduced in Corsica in two waves from the PACA bridgehead populations.

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

Contribution of historical herbarium small RNAs to the reconstruction of a cassava mosaic geminivirus evolutionary history.

Emerging viral diseases of plants are recognised as a growing threat to global food security. However, little is known about the evolutionary processes and ecological factors underlying the emergence and success of viruses that have caused past epidemics. With technological advances in the field of ancient genomics, it is now possible to sequence historical genomes to provide a better understanding of viral plant disease emergence and pathogen evolutionary history. In this context, herbarium specimens represent a valuable source of dated and preserved material. We report here the first historical genome of a crop pathogen DNA virus, a 90-year-old African cassava mosaic virus (ACMV), reconstructed from small RNA sequences bearing hallmarks of small interfering RNAs. Relative to tip-calibrated dating inferences using only modern data, those performed with the historical genome yielded both molecular evolution rate estimates that were significantly lower, and lineage divergence times that were significantly older. Crucially, divergence times estimated without the historical genome appeared in discordance with both historical disease reports and the existence of the historical genome itself. In conclusion, our study reports an updated time-frame for the history and evolution of ACMV and illustrates how the study of crop viral diseases could benefit from natural history collections.

First historical genome of a crop bacterial pathogen from herbarium specimen: Insights into citrus canker emergence.

Over the past decade, ancient genomics has been used in the study of various pathogens. In this context, herbarium specimens provide a precious source of dated and preserved DNA material, enabling a better understanding of plant disease emergences and pathogen evolutionary history. We report here the first historical genome of a crop bacterial pathogen, Xanthomonas citri pv. citri (Xci), obtained from an infected herbarium specimen dating back to 1937. Comparing the 1937 genome within a large set of modern genomes, we reconstructed their phylogenetic relationships and estimated evolutionary parameters using Bayesian tip-calibration inferences. The arrival of Xci in the South West Indian Ocean islands was dated to the 19th century, probably linked to human migrations following slavery abolishment. We also assessed the metagenomic community of the herbarium specimen, showed its authenticity using DNA damage patterns, and investigated its genomic features including functional SNPs and gene content, with a focus on virulence factors.

Draft Genome Sequences of 284 Xanthomonas citri pv. citri Strains Causing Asiatic Citrus Canker.

High-quality Illumina assemblies were produced from 284 Xanthomonas citri pv. citri pathotype A strains mostly originating from the Southwest Indian Ocean region, a subset of which was also sequenced using MinION technology. Some strains hosted chromosomally encoded transcription activator-like effector (TALE) genes, an atypical feature for this bacterium.

Time-calibrated genomic evolution of a monomorphic bacterium during its establishment as an endemic crop pathogen.

Horizontal gene transfer is of major evolutionary importance as it allows for the redistribution of phenotypically important genes among lineages. Such genes with essential functions include those involved in resistance to antimicrobial compounds and virulence factors in pathogenic bacteria. Understanding gene turnover at microevolutionary scales is critical to assess the pace of this evolutionary process. Here, we characterized and quantified gene turnover for the epidemic lineage of a bacterial plant pathogen of major agricultural importance worldwide. Relying on a dense geographic sampling spanning 39 years of evolution, we estimated both the dynamics of single nucleotide polymorphism accumulation and gene content turnover. We identified extensive gene content variation among lineages even at the smallest phylogenetic and geographic scales. Gene turnover rate exceeded nucleotide substitution rate by three orders of magnitude. Accessory genes were found preferentially located on plasmids, but we identified a highly plastic chromosomal region hosting ecologically important genes such as transcription activator-like effectors. Whereas most changes in the gene content are probably transient, the rapid spread of a mobile element conferring resistance to copper compounds widely used for the management of plant bacterial pathogens illustrates how some accessory genes can become ubiquitous within a population over short timeframes.

Discriminating lineages of Batrachochytrium dendrobatidis using quantitative PCR.

The ability to detect and monitor infectious disease in a phylogenetically informative manner is critical for their management. Phylogenetically informative diagnostic tests enable patterns of pathogen introduction or changes in the distribution of genotypes to be measured, enabling research into the ecology of the pathogen. Batrachochytrium dendrobatidis (Bd), a causative agent of chytridiomycosis in amphibian populations, emerged worldwide in the 21st century and is composed of six lineages which are display varying levels of virulence in their hosts. Research into the distribution, ecology and pathogenicity of these lineages has been hampered by an inability to type lineage efficiently. Here, we describe a lineage-specific TaqMan qPCR assay that differentiates the two lineages of Bd most commonly associated with chytridiomycosis: BdGPL and BdCAPE. We demonstrate how this assay can be used for the surveillance of wild populations of amphibians in Southern Africa using skin swabs, tissue samples and cultured isolates.

Contrasting genetic diversity and structure among Malagasy Ralstonia pseudosolanacearum phylotype I populations inferred from an optimized Multilocus Variable Number of Tandem Repeat Analysis scheme.

The Ralstonia solanacearum species complex (RSSC), composed of three species and four phylotypes, are globally distributed soil-borne bacteria with a very broad host range. In 2009, a devastating potato bacterial wilt outbreak was declared in the central highlands of Madagascar, which reduced the production of vegetable crops including potato, eggplant, tomato and pepper. A molecular epidemiology study of Malagasy RSSC strains carried out between 2013 and 2017 identified R. pseudosolanacearum (phylotypes I and III) and R. solanacearum (phylotype II). A previously published population biology analysis of phylotypes II and III using two MultiLocus Variable Number of Tandem Repeats Analysis (MLVA) schemes revealed an emergent epidemic phylotype II (sequevar 1) group and endemic phylotype III isolates. We developed an optimized MLVA scheme (RS1-MLVA14) to characterize phylotype I strains in Madagascar to understand their genetic diversity and structure. The collection included isolates from 16 fields of different Solanaceae species sampled in Analamanga and Itasy regions (highlands) in 2013 (123 strains) and in Atsinanana region (lowlands) in 2006 (25 strains). Thirty-one haplotypes were identified, two of them being particularly prevalent: MT007 (30.14%) and MT004 (16.44%) (sequevar 18). Genetic diversity analysis revealed a significant contrasting level of diversity according to elevation and sampling region. More diverse at low altitude than at high altitude, the Malagasy phylotype I isolates were structured in two clusters, probably resulting from different historical introductions. Interestingly, the most prevalent Malagasy phylotype I isolates were genetically distant from regional and worldwide isolates. In this work, we demonstrated that the RS1-MLVA14 scheme can resolve differences from regional to field scales and is thus suited for deciphering the epidemiology of phylotype I populations.

Development and comparative validation of genomic-driven PCR-based assays to detect Xanthomonas citri pv. citri in citrus plants.

BACKGROUND: Asiatic Citrus Canker, caused by Xanthomonas citri pv. citri, severely impacts citrus production worldwide and hampers international trade. Considerable regulatory procedures have been implemented to prevent the introduction and establishment of X. citri pv. citri into areas where it is not present. The effectiveness of this surveillance largely relies on the availability of specific and sensitive detection protocols. Although several PCR- or real-time PCR-based methods are available, most of them showed analytical specificity issues. Therefore, we developed new conventional and real-time quantitative PCR assays, which target a region identified by comparative genomic analyses, and compared them to existing protocols. RESULTS: Our assays target the X. citri pv. citri XAC1051 gene that encodes for a putative transmembrane protein. The real-time PCR assay includes an internal plant control (5.8S rDNA) for validating the assay in the absence of target amplification. A receiver-operating characteristic approach was used in order to determine a reliable cycle cut-off for providing accurate qualitative results. Repeatability, reproducibility and transferability between real-time devices were demonstrated for this duplex qPCR assay (XAC1051-2qPCR). When challenged with an extensive collection of target and non-target strains, both assays displayed a high analytical sensitivity and specificity performance: LOD95% = 754 CFU ml- 1 (15 cells per reaction), 100% inclusivity, 97.2% exclusivity for XAC1051-2qPCR; LOD95% = 5234 CFU ml- 1 (105 cells per reaction), 100% exclusivity and inclusivity for the conventional PCR. Both assays can detect the target from naturally infected citrus fruit. Interestingly, XAC1051-2qPCR detected X. citri pv. citri from herbarium citrus samples. The new PCR-based assays displayed enhanced analytical sensitivity and specificity when compared with previously published PCR and real-time qPCR assays. CONCLUSIONS: We developed new valuable detection assays useful for routine diagnostics and surveillance of X. citri pv. citri in citrus material. Their reliability was evidenced through numerous trials on a wide range of bacterial strains and plant samples. Successful detection of the pathogen was achieved from both artificially and naturally infected plants, as well as from citrus herbarium samples, suggesting that these assays will have positive impact both for future applied and academic research on this bacterium.

Genomic Acquisitions in Emerging Populations of Xanthomonas vasicola pv. vasculorum Infecting Corn in the United States and Argentina.

Xanthomonas vasicola pv. vasculorum is an emerging bacterial plant pathogen that causes bacterial leaf streak on corn. First described in South Africa in 1949, reports of this pathogen have greatly increased in the past years in South America and in the United States. The rapid spread of this disease in North and South America may be due to more favorable environmental conditions, susceptible hosts and/or genomic changes that favored the spread. To understand whether genetic mechanisms exist behind the recent spread of X. vasicola pv. vasculorum, we used comparative genomics to identify gene acquisitions in X. vasicola pv. vasculorum genomes from the United States and Argentina. We sequenced 41 genomes of X. vasicola pv. vasculorum and the related sorghum-infecting X. vasicola pv. holcicola and performed comparative analyses against all available X. vasicola genomes. Time-measured phylogenetic analyses showed that X. vasicola pv. vasculorum strains from the United States and Argentina are closely related and arose from two introductions to North and South America. Gene content comparisons identified clusters of genes enriched in corn X. vasicola pv. vasculorum that showed evidence of horizontal transfer including one cluster corresponding to a prophage found in all X. vasicola pv. vasculorum strains from the United States and Argentina as well as in X. vasicola pv. holcicola strains. In this work, we explore the genomes of an emerging phytopathogen population as a first step toward identifying genetic changes associated with the emergence. The acquisitions identified may contain virulence determinants or other factors associated with the spread of X. vasicola pv. vasculorum in North and South America and will be the subject of future work.

Plasmodium vivax Malaria Viewed through the Lens of an Eradicated European Strain.

The protozoan Plasmodium vivax is responsible for 42% of all cases of malaria outside Africa. The parasite is currently largely restricted to tropical and subtropical latitudes in Asia, Oceania, and the Americas. Though, it was historically present in most of Europe before being finally eradicated during the second half of the 20th century. The lack of genomic information on the extinct European lineage has prevented a clear understanding of historical population structuring and past migrations of P. vivax. We used medical microscope slides prepared in 1944 from malaria-affected patients from the Ebro Delta in Spain, one of the last footholds of malaria in Europe, to generate a genome of a European P. vivax strain. Population genetics and phylogenetic analyses placed this strain basal to a cluster including samples from the Americas. This genome allowed us to calibrate a genomic mutation rate for P. vivax, and to estimate the mean age of the last common ancestor between European and American strains to the 15th century. This date points to an introduction of the parasite during the European colonization of the Americas. In addition, we found that some known variants for resistance to antimalarial drugs, including Chloroquine and Sulfadoxine, were already present in this European strain, predating their use. Our results shed light on the evolution of an important human pathogen and illustrate the value of antique medical collections as a resource for retrieving genomic information on pathogens from the past.

Population structure, connectivity, and demographic history of an apex marine predator, the bull shark Carcharhinus leucas.

Knowledge of population structure, connectivity, and effective population size remains limited for many marine apex predators, including the bull shark Carcharhinus leucas. This large-bodied coastal shark is distributed worldwide in warm temperate and tropical waters, and uses estuaries and rivers as nurseries. As an apex predator, the bull shark likely plays a vital ecological role within marine food webs, but is at risk due to inshore habitat degradation and various fishing pressures. We investigated the bull shark's global population structure and demographic history by analyzing the genetic diversity of 370 individuals from 11 different locations using 25 microsatellite loci and three mitochondrial genes (CR, nd4, and cytb). Both types of markers revealed clustering between sharks from the Western Atlantic and those from the Western Pacific and the Western Indian Ocean, with no contemporary gene flow. Microsatellite data suggested low differentiation between the Western Indian Ocean and the Western Pacific, but substantial differentiation was found using mitochondrial DNA. Integrating information from both types of markers and using Bayesian computation with a random forest procedure (ABC-RF), this discordance was found to be due to a complete lack of contemporary gene flow. High genetic connectivity was found both within the Western Indian Ocean and within the Western Pacific. In conclusion, these results suggest important structuring of bull shark populations globally with important gene flow occurring along coastlines, highlighting the need for management and conservation plans on regional scales rather than oceanic basin scale.

Genomic Diversity and Recombination among Xylella fastidiosa Subspecies.

Xylella fastidiosa is an economically important bacterial plant pathogen. With insights gained from 72 genomes, this study investigated differences among the three main subspecies, which have allopatric origins: X. fastidiosa subsp. fastidiosa, multiplex, and pauca The origin of recombinogenic X. fastidiosa subsp. morus and sandyi was also assessed. The evolutionary rate of the 622 genes of the species core genome was estimated at the scale of an X. fastidiosa subsp. pauca subclade (7.62 × 10-7 substitutions per site per year), which was subsequently used to estimate divergence time for the subspecies and introduction events. The study characterized genes present in the accessory genome of each of the three subspecies and investigated the core genome to detect genes potentially under positive selection. Recombination is recognized to be the major driver of diversity in X. fastidiosa, potentially facilitating shifts to novel plant hosts. The relative effect of recombination in comparison to point mutation was calculated (r/m = 2.259). Evidence of recombination was uncovered in the core genome alignment; X. fastidiosa subsp. fastidiosa in the United States was less prone to recombination, with an average of 3.22 of the 622 core genes identified as recombining regions, whereas a specific clade of X. fastidiosa subsp. multiplex was found to have on average 9.60 recombining genes, 93.2% of which originated from X. fastidiosa subsp. fastidiosa Interestingly, for X. fastidiosa subsp. morus, which was initially thought to be the outcome of genome-wide recombination between X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. multiplex, intersubspecies homologous recombination levels reached 15.30% in the core genome. Finally, there is evidence of X. fastidiosa subsp. pauca strains from citrus containing genetic elements acquired from strains infecting coffee plants as well as genetic elements from both X. fastidiosa subsp. fastidiosa and X. fastidiosa subsp. multiplex In summary, our data provide new insights into the evolution and epidemiology of this plant pathogen.IMPORTANCEXylella fastidiosa is an important vector-borne plant pathogen. We used a set of 72 genomes that constitutes the largest assembled data set for this bacterial species so far to investigate genetic relationships and the impact of recombination on phylogenetic clades and to compare genome content at the subspecies level, and we used a molecular dating approach to infer the evolutionary rate of X. fastidiosa The results demonstrate that recombination is important in shaping the genomes of X. fastidiosa and that each of the main subspecies is under different selective pressures. We hope insights from this study will improve our understanding of X. fastidiosa evolution and biology.

Recent Asian origin of chytrid fungi causing global amphibian declines.

Globalized infectious diseases are causing species declines worldwide, but their source often remains elusive. We used whole-genome sequencing to solve the spatiotemporal origins of the most devastating panzootic to date, caused by the fungus Batrachochytrium dendrobatidis, a proximate driver of global amphibian declines. We traced the source of B. dendrobatidis to the Korean peninsula, where one lineage, BdASIA-1, exhibits the genetic hallmarks of an ancestral population that seeded the panzootic. We date the emergence of this pathogen to the early 20th century, coinciding with the global expansion of commercial trade in amphibians, and we show that intercontinental transmission is ongoing. Our findings point to East Asia as a geographic hotspot for B. dendrobatidis biodiversity and the original source of these lineages that now parasitize amphibians worldwide.

Coexistence of Multiple Endemic and Pandemic Lineages of the Rice Blast Pathogen.

The rice blast fungus Magnaporthe oryzae (syn., Pyricularia oryzae) is both a threat to global food security and a model for plant pathology. Molecular pathologists need an accurate understanding of the origins and line of descent of M. oryzae populations in order to identify the genetic and functional bases of pathogen adaptation and to guide the development of more effective control strategies. We used a whole-genome sequence analysis of samples from different times and places to infer details about the genetic makeup of M. oryzae from a global collection of isolates. Analyses of population structure identified six lineages within M. oryzae, including two pandemic on japonica and indica rice, respectively, and four lineages with more restricted distributions. Tip-dating calibration indicated that M. oryzae lineages separated about a millennium ago, long after the initial domestication of rice. The major lineage endemic to continental Southeast Asia displayed signatures of sexual recombination and evidence of DNA acquisition from multiple lineages. Tests for weak natural selection revealed that the pandemic spread of clonal lineages entailed an evolutionary "cost," in terms of the accumulation of deleterious mutations. Our findings reveal the coexistence of multiple endemic and pandemic lineages with contrasting population and genetic characteristics within a widely distributed pathogen.IMPORTANCE The rice blast fungus Magnaporthe oryzae (syn., Pyricularia oryzae) is a textbook example of a rapidly adapting pathogen, and it is responsible for one of the most damaging diseases of rice. Improvements in our understanding of Magnaporthe oryzae's diversity and evolution are required to guide the development of more effective control strategies. We used genome sequencing data for samples from around the world to infer the evolutionary history of M. oryzae We found that M. oryzae diversified about 1,000 years ago, separating into six main lineages: two pandemic on japonica and indica rice, respectively, and four with more restricted distributions. We also found that a lineage endemic to continental Southeast Asia displayed signatures of sexual recombination and the acquisition of genetic material from multiple lineages. This work provides a population-level genomic framework for defining molecular markers for the control of rice blast and investigations of the molecular basis of differences in pathogenicity between M. oryzae lineages.