RESUMEN
Some viruses are known to be associated with the onset of specific cancers. These microorganisms, oncogenic viruses or oncoviruses, can convert normal cells into cancer cells by modulating the central metabolic pathways or hampering genomic integrity mechanisms, consequently inhibiting the apoptotic machinery and/or enhancing cell proliferation. Seven oncogenic viruses are known to promote tumorigenesis in humans: human papillomavirus (HPV), hepatitis B and C viruses (HBV, HCV), Epstein-Barr virus (EBV), human T-cell leukemia virus 1 (HTLV-1), Kaposi sarcoma-associated herpesvirus (KSHV), and Merkel cell polyomavirus (MCPyV). Recent research indicates that SARS-CoV-2 infection and COVID-19 progression may predispose recovered patients to cancer onset and accelerate cancer development. This hypothesis is based on the growing evidence regarding the ability of SARS-CoV-2 to modulate oncogenic pathways, promoting chronic low-grade inflammation and causing tissue damage. Herein, we summarize the main relationships known to date between virus infection and cancer, providing a summary of the proposed biochemical mechanisms behind the cellular transformation. Mechanistically, DNA viruses (such as HPV, HBV, EBV, and MCPyV) encode their virus oncogenes. In contrast, RNA viruses (like HCV, HTLV-1) may encode oncogenes or trigger host oncogenes through cis-/-trans activation leading to different types of cancer. As for SARS-CoV-2, its role as an oncogenic virus seems to occur through the inhibition of oncosuppressors or controlling the metabolic and autophagy pathways in the infected cells. However, these effects could be significant in particular scenarios like those linked to severe COVID-19 or long COVID. On the other hand, looking at the SARS-CoV-2âcancer relationship from an opposite perspective, oncolytic effects and anti-tumor immune response were triggered by SARS-CoV-2 infection in some cases. In summary, our work aims to recall comprehensive attention from the scientific community to elucidate the effects of SARS-CoV-2 and, more in general, ß-coronavirus infection on cancer susceptibility for cancer prevention or supporting therapeutic approaches.
Asunto(s)
COVID-19 , Infecciones por Virus de Epstein-Barr , Hepatitis C , Neoplasias , Infecciones por Papillomavirus , Humanos , SARS-CoV-2 , Infecciones por Virus de Epstein-Barr/complicaciones , Infecciones por Papillomavirus/complicaciones , Síndrome Post Agudo de COVID-19 , Herpesvirus Humano 4 , COVID-19/complicaciones , Neoplasias/patología , Virus Oncogénicos/genética , Transformación Celular Neoplásica , Hepatitis C/complicacionesRESUMEN
1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δß-turn + Δß-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the ß-structure are consistent with a partial protein destabilization due to the interaction with U2O.
Asunto(s)
Albúmina Sérica Bovina , Albúmina Sérica , Sitios de Unión , Dicroismo Circular , Simulación del Acoplamiento Molecular , Unión Proteica , Albúmina Sérica/química , Albúmina Sérica Bovina/química , Espectrometría de Fluorescencia , TermodinámicaRESUMEN
i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC4A) and d(C6) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5'-d(C6)2 resulted stable enough to be detected even at near physiological conditions (37 °C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs.
Asunto(s)
Citosina , Oligonucleótidos , Acrilamidas , Dicroismo Circular , Citosina/química , ADN/química , Concentración de Iones de Hidrógeno , Conformación de Ácido Nucleico , Oligonucleótidos/químicaRESUMEN
Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
Asunto(s)
G-Cuádruplex , Ácidos Nucleicos , ADN/química , Genes myc , Glucósidos/farmacología , Simulación del Acoplamiento Molecular , Fitoquímicos , Proteínas Proto-Oncogénicas c-myc/metabolismo , Análisis Espectral , EstilbenosRESUMEN
The aim of this review article is to summarize the knowledge available to date on prophylaxis achievements in the frame of the fight against Coronaviruses. This work will give an overview of what is reported in the recent literature on vaccines (under investigation or already developed like BNT162b2, mRNA-1273, and ChAdOx1-S) effective against the most pathogenic Coronaviruses (SARS-CoV-1, MERS-CoV-1, and SARS-CoV-2), with of course particular attention paid to those under development or already in use to combat the current COVID-19 (CoronaVIrus Disease 19) pandemic. Our main objective is to make a contribution to the comprehension, even at a molecular level, of what is currently ready for anti-SARS-CoV-2 prophylactic intervention, as well as to provide the reader with an overall picture of the most innovative approaches for the development of vaccines that could be of general utility in the fight against the most pathogenic Coronaviruses.
Asunto(s)
COVID-19 , Coronavirus del Síndrome Respiratorio de Oriente Medio , Vacuna nCoV-2019 mRNA-1273 , Vacuna BNT162 , Vacunas contra la COVID-19 , Humanos , Coronavirus del Síndrome Respiratorio de Oriente Medio/genética , SARS-CoV-2RESUMEN
Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2â³S,3â³R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.
Asunto(s)
Calcio/metabolismo , ADP-Ribosa Cíclica/análogos & derivados , ADP-Ribosa Cíclica/farmacología , Neuronas/efectos de los fármacos , Animales , Células Cultivadas , Neuronas/metabolismo , Ratas , Ratas WistarRESUMEN
Peptides and their synthetic analogs are a class of molecules with enormous relevance as therapeutics for their ability to interact with biomacromolecules like nucleic acids and proteins, potentially interfering with biological pathways often involved in the onset and progression of pathologies of high social impact. Nucleobase-bearing peptides (nucleopeptides) and pseudopeptides (PNAs) offer further interesting possibilities related to their nucleobase-decorated nature for diagnostic and therapeutic applications, thanks to their reported ability to target complementary DNA and RNA strands. In addition, these chimeric compounds are endowed with intriguing self-assembling properties, which are at the heart of their investigation as self-replicating materials in prebiotic chemistry, as well as their application as constituents of innovative drug delivery systems and, more generally, as novel nanomaterials to be employed in biomedicine. Herein we describe the properties of nucleopeptides, PNAs and related supramolecular systems, and summarize some of the most relevant applications of these systems.
Asunto(s)
Nanoestructuras/química , Ácidos Nucleicos de Péptidos/química , Péptidos/química , ADN/química , ARN/químicaRESUMEN
Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action.
Asunto(s)
Antivirales , Tratamiento Farmacológico de COVID-19 , Reposicionamiento de Medicamentos , Nucleósidos , SARS-CoV-2/metabolismo , Síndrome Respiratorio Agudo Grave/tratamiento farmacológico , Coronavirus Relacionado al Síndrome Respiratorio Agudo Severo/metabolismo , Animales , Antivirales/química , Antivirales/uso terapéutico , COVID-19/epidemiología , COVID-19/metabolismo , Humanos , Nucleósidos/química , Nucleósidos/uso terapéutico , Síndrome Respiratorio Agudo Grave/epidemiología , Síndrome Respiratorio Agudo Grave/metabolismoRESUMEN
Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium Streptomyces Tubercidicus. In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin. In addition, the cell viability was evaluated against HeLa, A375 and WM266 human cancer cell lines using the MTT test. Lastly, the results of the apoptotic assay (FITC Annexin V) performed on the HeLa cancer cell line are also reported.
RESUMEN
Here we report on the most recent updates on experimental drugs successfully employed in the treatment of the disease caused by SARS-CoV-2 coronavirus, also referred to as COVID-19 (COronaVIrus Disease-19). In particular, several cases of recovered patients have been reported after being treated with lopinavir/ritonavir [which is widely used to treat Human Immunodeficiency Virus (HIV) infection] in combination with the anti-flu drug oseltamivir. In addition, remdesivir, which has been previously administered to Ebola virus patients, has also proven effective in the U.S. against coronavirus, while antimalarial chloroquine and hydroxychloroquine, favipiravir and co-administered darunavir and umifenovir (in patient therapies) were also recently recorded as having anti-SARS-CoV-2 effects. Since the recoveries/deaths ratio in the last weeks significantly increased, especially in China, it is clear that the experimental antiviral therapy, together with the availability of intensive care unit beds in hospitals and rigorous government control measures, all play an important role in dealing with this virus. This also stresses the urgent need for the scientific community to devote its efforts to the development of other more specific antiviral strategies.
Asunto(s)
Antivirales/uso terapéutico , Infecciones por Coronavirus/tratamiento farmacológico , Neumonía Viral/tratamiento farmacológico , Adenosina Monofosfato/análogos & derivados , Alanina/análogos & derivados , Amidas , Betacoronavirus , COVID-19 , China , Darunavir , Combinación de Medicamentos , Humanos , Hidroxicloroquina , Indoles , Lopinavir , Pandemias , Pirazinas , Ritonavir , SARS-CoV-2 , Tratamiento Farmacológico de COVID-19RESUMEN
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.
Asunto(s)
Antineoplásicos/farmacología , Productos Biológicos/farmacología , G-Cuádruplex , Péptidos/farmacología , Organismos Acuáticos/química , Productos Biológicos/química , Humanos , Ligandos , Péptidos/química , Unión Proteica/efectos de los fármacosRESUMEN
Breast cancer remains the most frequent cancer in women with different patterns of disease progression and response to treatments. The identification of specific biomarkers for different breast cancer subtypes has allowed the development of novel targeting agents for imaging and therapy. To date, patient management depends on immunohistochemistry analysis of receptor status on bioptic samples. This approach is too invasive, and in some cases, not entirely representative of the disease. Nuclear imaging using receptor tracers may provide whole-body information and detect any changes of receptor expression during disease progression. Therefore, imaging is useful to guide clinicians to select the best treatments for each patient and to evaluate early response thus reducing unnecessary therapies. In this review, we focused on the development of novel tracers that are ongoing in preclinical and/or clinical studies as promising tools to lead treatment decisions for breast cancer management.
RESUMEN
G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG4T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG4T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLCâ»size-exclusion chromatography (HPLCâ»SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG4T)4. The structural characterization of DEL-ODNs confirmed the formation of stable, bimolecular DEL-G4s for all DEL-ODNs, as well as of additional DEL-G4 multimers with higher molecular weights, thus suggesting a way towards the obtainment of thermally stable DNA nanostructures based on reticulated DEL-G4s.