Dynamic and Energetic Signatures of Adenine Tracts in a rA-dT RNA-DNA Hybrid and in Homologous RNA-DNA, RNA-RNA, and DNA-DNA Double Helices.

Nuclear magnetic resonance spectroscopy and proton exchange are being used to characterize the opening reactions of individual base pairs in the RNA-DNA hybrid 5'-rGCGAUAAAAAGGCC-3'/5'-dGGCCTTTTTATCGC-3'. The hybrid contains a central tract of five rA-dT base pairs. The rates and the equilibrium constant of the opening reaction for each base pair are determined from the dependence of the exchange rates of imino protons on ammonia concentration, at 10 °C. The results are compared to those previously obtained by our laboratory for three homologous duplexes of the same base sequence (except for the appropriate T/U substitution), containing tracts of dA-rU, rA-rU, or dA-dT base pairs. The rA-dT tract is distinguished by an enhanced propensity of the base pairs to exist in the extrahelical state. The opening rates of rA-dT base pairs also exhibit a strong dependence on the location of the base pair in the structure; namely, as one advances into the tract, the opening rates of rA-dT base pairs gradually decrease. The local stability of each rA-dT base pair within the tract is the same as that of the corresponding rA-rU base pair in the homologous RNA-only duplex but differs from the stabilities of dA-dT and dA-rU base pairs in the other two duplexes (namely, dA-dT > rA-dT > dA-rU). These results demonstrate that, in nucleic acid double helices with the same base sequence, the opening dynamics and the energetics of individual base pairs are strongly influenced by the nature of the strand and by the structural context of the base pair.

Site-resolved structural energetics of the T7 concatemer junction.

The concatemer junction is a conserved sequence of 8 bp, which is strategically located at the junction between the head-to-tail repeats of genomic DNA in T7 and related bacteriophages. The RNA polymerase pauses at this site to recruit the machinery necessary for cleavage of the concatemer into single genome DNA. During pausing, the transcription bubble collapses and the transcription RNA-DNA hybrid is shortened to only 3 bp. This work addresses the question of the role of the nucleic acid components of the transcription elongation complex in this collapse of the transcription bubble. The nucleic acid structures investigated are the DNA-DNA duplex structure present at the concatemer junction when the DNA is not transcribed and the RNA-DNA hybrid formed when the concatemer junction is transcribed. The structural energetics of each base pair in the two structures is characterized using imino proton exchange and nuclear magnetic resonance spectroscopy. The results show that 5 bp in the DNA-DNA duplex at the concatemer junction site are significantly more stable than the corresponding base pairs in the RNA-DNA hybrid that forms when the site is transcribed. Because of their energetic preference for the DNA-DNA duplex, these 5 bp favor the collapse of the transcription bubble. Four of the 5 bp with enhanced stability in the DNA-DNA duplex are located in the downstream half of the concatemer junction site. This location suggests that only after the entire concatemer junction is transcribed can the RNA-DNA hybrid accumulate sufficient structural destabilization to trigger the dissociation of the RNA and the switch of the DNA template strand from the hybrid structure to the DNA-DNA double-helical structure.

Opening dynamics of 8-oxoguanine in DNA.

8-oxoguanine is a major lesion of genomic DNA that results from oxidation of guanine by reactive oxygen species. The repair of this lesion is initiated by 8-oxoguanine glycosylases, which excise the damaged base by "flipping" it outside the DNA double helix. The molecular mechanisms involved in the specific recognition of the damaged base by the enzyme are not yet fully understood. Several models have proposed that, in DNA, the base pair between 8-oxoguanine and cytosine may possess altered dynamic properties that could help the enzyme locate the lesion and could favor the selective extra-helical flipping of the damaged base. To test this proposal, we have characterized the spontaneous opening of the base pair between 8-oxoguanine and cytosine in a DNA double helix using NMR spectroscopy and proton exchange. The results show that the rate of spontaneous opening of 8-oxoguanine and the lifetime of the base in the extra-helical state are the same as those of a canonical guanine-cytosine base pair, in the same base sequence context. This finding suggests that the opening dynamics of 8-oxoguanine, when paired with cytosine in DNA, does not play a significant role in the recognition of the lesion by glycosylases.

Enhanced base-pair opening in the adenine tract of a RNA double helix.

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the kinetics and energetics of base-pair opening in two nucleic acid double helices. One is the RNA duplex 5'-r(GCGAUAAAAAGGCC)-3'/5'-r(GGCCUUUUUAUCGC)-3', which contains a central tract of five AU base pairs. The other is the homologous DNA duplex with a central tract of five AT base pairs. The rates and the equilibrium constants of the opening reaction of each base pair are measured from the dependence of the exchange rates of imino protons on ammonia concentration, at 10 °C. The results reveal that the tract of AU base pairs in the RNA duplex differs from the homologous tract of AT base pairs in DNA in several ways. The rates of opening of AU base pairs in RNA are high and increase progressively along the tract, reaching their largest values at the 3'-end of the tract. In contrast, the opening rates of AT base pairs in DNA are much lower than those of AU base pairs. Within the tract, the largest opening rate is observed for the AT base pair at the 5'-end of the tract. These differences in opening kinetics are paralleled by differences in the stabilities of individual base pairs. All AU base pairs in the RNA are less stable than the AT base pairs in the DNA. The presence of the tract enhances these differences by increasing the stability of AT base pairs in DNA while decreasing the stability of AU base pairs in RNA. Due to these divergent trends, along the tracts, the AU base pairs become progressively less stable than AT base pairs. These findings demonstrate that tracts of AU base pairs in RNA have specific dynamic and energetic signatures that distinguish them from similar tracts of AT base pairs in DNA.

Structural energetics of the adenine tract from an intrinsic transcription terminator.

Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site.

Dynamics and stability of individual base pairs in two homologous RNA-DNA hybrids.

Nuclear magnetic resonance spectroscopy and proton exchange have been used to characterize two RNA-DNA hybrids from the tR2 intrinsic transcription terminator site of phage lambda. The hybrids have the same base sequence [5'-GGCGCAGGCC(T/U)(T/U)CC-3'/5'-GGAAGGCC(T/U)GCGCC-3'] but differ from each other by an interchange of DNA and RNA strands. The opening of single base pairs in the two hybrids is characterized by measuring the rates of exchange of imino protons with solvent protons as a function of the concentration of a proton acceptor (ammonia base) at 10 degrees C. The free energy change in the opening reaction provides a measure of the stability of the base pair, while the rates of opening and closing define the base pair dynamics. The results demonstrate that, within the same base sequence context, dA-rU base pairs are less stable than dT-rA base pairs. The differences in stability are enhanced when two dA-rU base pairs are located next to each other in the hybrid structure. For the G-C base pairs, the rates of opening and closing and the stability are affected by the base sequence context and by the nature of the sugar moiety attached to the guanine. The dominant feature of the base sequence is the proximity of the dA-rU base pair, which destabilizes the G-C base pair when the guanine is located on the DNA strand. Two G-C base pairs (namely, those in the fourth and 10th positions) exhibit large differences in their opening and closing rates between the two hybrids, while maintaining the same stability. These results provide the first demonstration that, for RNA-DNA hybrid structures with the same base sequence, the opening dynamics and the stability of individual base pairs are strongly influenced by the chemical nature of each strand.

Influence of magnesium ions on spontaneous opening of DNA base pairs.

A large amount of experimental evidence is available for the effects of magnesium ions on the structure and the stability of the DNA double helix. Less is known, however, on how these ions affect the dynamics of the molecule and the stability of each individual base pair. The present work addresses these questions by a study of the DNA duplex [dCGCAGATCTGCG]2, and its interactions with magnesium ions using nuclear magnetic resonance (NMR) spectroscopy and proton exchange. Two-dimensional NMR experiments indicate that binding of magnesium to this DNA duplex does not affect its structure. However, even in the absence of structural changes, magnesium ions specifically affect the exchange properties of imino protons in the four GC/CG base pairs that are located in the interior of the double helix. These specific changes do not result from alterations in the rates of spontaneous opening of these base pairs. Instead, the changes most likely reflect an enhancement in the energetic propensity for spontaneous opening of the GC/CG base pairs that is induced by the binding of magnesium ions.

Probing the role of hydrogen bonds in the stability of base pairs in double-helical DNA.

Aromatic stacking and hydrogen bonding between nucleobases are two of the key interactions responsible for stabilization of DNA double-helical structures. The present work aims at defining the specific contributions of these interactions to the stability of individual base pairs in DNA. The two DNA double helices investigated are formed, respectively, by the palindromic base sequences 5'-dCCAACGTTGG-3' and 5'-dCGCAGATCTGCG-3'. The strength of the N==H...N inter-base hydrogen bond in each base pair is characterized from the measurement of the protium-deuterium fractionation factor of the corresponding imino proton using NMR spectroscopy. The structural stability of each base pair is evaluated from the exchange rate of the imino proton, measured by NMR. The results reveal that the fractionation factors of the imino protons in the two DNA double helices investigated fall within a narrow range of values, between 0.92 and 1.0. In contrast, the free energies of structural stabilization for individual base pairs span 3.5 kcal/mol, from 5.2 to 8.7 kcal/mol (at 15 degrees C). These findings indicate that, in the two DNA double helices investigated, the strength of N==H...N inter-base hydrogen bonds does not change significantly depending on the nature or the sequence context of the base pair. Hence, the variations in structural stability detected by proton exchange do not involve changes in the strength of inter-base hydrogen bonds. Instead, the results suggest that the energetic identity of a base pair is determined by the number of inter-base hydrogen bonds, and by the stacking interactions with neighboring base pairs.

Structural energetics and base-pair opening dynamics in sarcin-ricin domain RNA.

The sarcin-ricin domain is a universal element of the RNA from the large ribosomal subunit. The domain is part of the binding site for elongation factors and is specifically cleaved by the toxins alpha-sarcin and ricin. In this work, we have mapped the energetics and dynamics of individual structural motifs in a 29-mer RNA oligomer containing the sarcin-ricin domain. The stability of individual base pairs in the structure was characterized from measurements of the exchange rates of imino protons using nuclear magnetic resonance spectroscopy at 10 degrees C. The measurements also provided the rates of opening and closing for selected base pairs. The results reveal that the structural stabilization free energies in the sarcin-ricin domain are broadly distributed between 2.9 and 10.6 kcal/mol. One of the least stable sites in the structure is the noncanonical G-A base pair located next to the phosphodiester bond that is cleaved by alpha-sarcin. The low stability of this base pair supports the proposal that cleavage by alpha-sarcin occurs by a base flipping mechanism. The opening dynamics of other base pairs is affected by elements of the structure such as the bulged-G motif and its cross-strand stacking. Participation in these motifs increases the lifetimes of the bases in an open, solvent-accessible conformation.

Specific interactions of divalent metal ions with a DNA duplex containing the d(CA)n/(GT)n tandem repeat.

Divalent metal ions are essential for maintaining functional states of the DNA molecule. Their participation in DNA structure is modulated by the base sequence and varies depending on the nature of the ion. The present investigation addresses the interaction of Ca2+ ions with a tandem repeat of two CA dinucleotides, (CA)2/(TG)2. The binding of Ca2+ to the repeat is monitored by nuclear magnetic resonance (NMR) spectroscopy using chemical shift mapping. Parallel experiments monitor binding of Mg2+ ions to the repeat as well as binding of each ion to a DNA duplex in which the (CA)2/(TG)2 repeat is eliminated. The results reveal that the direction and the magnitude of chemical shift changes induced by Ca2+ ions in the NMR spectra of the repeat are different from those induced by Mg2+ ions. The differences between the two cations are significantly diminished by the elimination of the (CA)2/(TG)2 repeat. These findings suggest a specific interaction of Ca2+ ions with the (CA)2/(TG)2 motif. The specificity of the interaction resides in the two A-T base pairs of the repeat, and it involves the major groove of the first A-T base pair and both grooves of the second A-T base pair.

A nuclear magnetic resonance investigation of the energetics of basepair opening pathways in DNA.

The opening of basepairs plays a key role in DNA replication and transcription, and in the action of DNA repair and modification enzymes. In this article, we have used proton exchange to define the energetics of the pathways for basepair opening in two DNA 17-mer duplexes. The rates of exchange of imino protons with solvent protons were measured by NMR spectroscopy for each DNA duplex, as a function of the concentration of exchange catalyst and of temperature. The measurements provided the rates and the equilibrium constants of the opening reactions for individual basepairs at different temperatures. These temperature dependences were used to calculate the enthalpies and the free energies of the barrier to opening and of the open state for each basepair. The results reveal the existence of three distinct patterns of enthalpy changes in the opening reactions. The patterns differ from each other in the location of the kinetic opening barrier relative to the open state. Neighboring bases, which are one or more positions removed from the opening basepair, influence the enthalpic pattern of the opening pathway. The free energies of the opening barriers are found to be linearly related to the free energies of the open state. This correlation is analyzed in terms of rate-equilibrium free energy relationships previously observed in other systems, and suggests that the transition state in the opening reaction is closer to the native closed state of the basepair than to its open state.

Base pair opening in three DNA-unwinding elements.

DNA-unwinding elements are specific base sequences that are located in the origin of DNA replication where they provide the start point for strand separation and unwinding of the DNA double helix. In the present work we have obtained the first characterization of the opening of individual base pairs in DNA-unwinding elements. The three DNA molecules investigated reproduce the 13-mer DNA-unwinding elements present in the Escherichia coli chromosome. The base sequences of the three 13-mers are conserved in the origins of replication of enteric bacterial chromosomes. The exchange of imino protons with solvent protons was measured for each DNA as a function of the concentration of exchange catalyst using nuclear magnetic resonance spectroscopy. The exchange rates provided the rates and the equilibrium constants for opening of individual base pairs in each DNA at 20 degrees C. The results reveal that the kinetics and energetics of the opening reactions for AT/TA base pairs are different in the three DNA-unwinding elements due to long range effects of the base sequence. These differences encompass the AT/TA base pairs that are conserved in various bacterial genomes. Furthermore, a qualitative correlation is observed between the kinetics and energetics of opening of AT/TA base pairs and the location of the corresponding DNA-unwinding element in the origin of DNA replication.

Sequence-dependence of the energetics of opening of at basepairs in DNA.

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the energetics of opening of AT/TA basepairs in the DNA dodecamer 5'-d(GCTATAAAAGGG)-3'/5'-d(CCCTTTTATAGC)-3'. The dodecamer contains the TATA box of the adenovirus major late promoter. The equilibrium constants for opening of each basepair are measured from the dependence of the exchange rates of imino protons on ammonia concentration. The enthalpy, entropy, and free energy changes in the opening reaction of each basepair are determined from the temperature dependence of the exchange rates. The results reveal that the opening enthalpy changes encompass a wide range of values, namely, from 17 to 29 kcal/mol. The largest values are observed for the AT basepairs in 7th and 8th positions. These values, and the exchange rates of the corresponding imino protons, suggest that these two basepairs open in a single concerted reaction. The enthalpy changes for opening of the central six basepairs are correlated to the opening entropy changes. This enthalpy-entropy compensation minimizes the variations in the opening free energies among these central basepairs. Deviations from the enthalpy-entropy compensation pattern are observed for basepairs located close to the ends of the duplex structure, suggesting a different mode of opening for these basepairs.

Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors.

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.

Allosteric effects of chloride ions at the intradimeric alpha1beta1 and alpha2beta2 interfaces of human hemoglobin.

The structural transition induced by ligand binding in human hemoglobin encompasses quaternary structure changes at the interfaces between the two alphabeta dimers. In contrast, the interfaces between alpha and beta subunits within the same dimer (i.e., alpha1beta1 and alpha2beta2 interfaces) are structurally invariant. Previous work from this laboratory using NMR spectroscopy has identified four sites at the intradimeric alpha1beta1 and alpha2beta2 interfaces that, although structurally invariant, experience significant changes in the rates of proton exchange upon ligand binding. These sites are Hisalpha103(G10) and Hisalpha122(H5) in each alpha subunit of the hemoglobin tetramer. In the present work, we show that the proton exchange at the Hisalpha103(G10) sites is affected by the interactions of hemoglobin with chloride ions. Increasing concentrations of chloride ions at pH 6.45 and at 37 degrees C enhance the exchange rate of the Hisalpha103(G10) N(epsilon 2) proton. The enhancement is greater in deoxygenated than in ligated hemoglobin. In the framework of the local unfolding model for proton exchange, these results suggest that the structural free energy and/or the proton transfer reactions at the Hisalpha103(G10) sites depend on the concentration of chloride ions. Therefore, the ligand-induced changes at the Hisalpha103(G10) sites are modulated by the allosteric effect of chloride ions on hemoglobin.

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy.

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads.

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.