RESUMEN
Circular mRNA (cmRNA) is particular useful due to its high resistance to degradation by exonucleases, resulting in greater stability and protein expression compared to linear mRNA. T cell receptor (TCR)-engineered T cells (TCR-T) represent a promising means of treating viral infections and cancer. This study aimed to evaluate the feasibility and efficacy of cmRNA in antigen-specific-TCR discovery and TCR-T therapy. Using human cytomegalovirus (CMV) pp65 antigen as a model, we found that the expansion of pp65-responsive T cells was induced more effectively by monocyte-derived dendritic cells transfected with pp65-encoding cmRNA compared with linear mRNA. Subsequently, we developed cmRNA-transduced pp65-TCR-T (cm-pp65-TCR-T) that specifically targets the CMV-pp65 epitope. Our results showed that pp65-TCR could be expressed on primary T cells for more than 7 days. Moreover, both in vitro killing and in vivo CDX models demonstrated that cm-pp65-TCR-T cells specifically and persistently kill pp65-and HLA-expressing tumor cells, significantly prolonging the survival of mice. Collectively, our results demonstrated that cmRNA can be used as a more effective technical approach for antigen-specific TCR isolation and identification, and cm-pp65-TCR-T may provide a safe, non-viral, non-integrated therapeutic approach for controlling CMV infection, particularly in patients who have undergone allogeneic hematopoietic stem cell transplantation.
Asunto(s)
Infecciones por Citomegalovirus , Trasplante de Células Madre Hematopoyéticas , Humanos , Animales , Ratones , Infecciones por Citomegalovirus/genética , Infecciones por Citomegalovirus/terapia , Citomegalovirus/genética , Linfocitos T , Receptores de Antígenos de Linfocitos T/genética , Proteínas de la Matriz Viral/genéticaRESUMEN
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Asunto(s)
Neoplasias de la Mama , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Femenino , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Neoplasias de la Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Empalme Alternativo , Exones/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Supresoras de Tumor/metabolismoRESUMEN
Steroid receptor RNA activator 1 (SRA1) has been described as a novel transcriptional co-activator that affects the migration of cancer cells. Through RT-PCR, we identified that skipping exon 3 of SRA1 produces two isoforms, including the truncated short isoform, SRA1-S, and the long isoform, SRA1-L. However, the effect of these two isomers on the migration of HCC cells, as well as the specific mechanism of exon 3 skipping remain unclear. In this study, we found up regulated expression of SRSF1 and SRA1-L in highly metastatic HCCLM3, as well as in HCCs with SRSF1 demonstrating the strongest correlation with SRA1-L. In contrast, we observed a constitutively low expression of SRA1-S and SRSF1 in lowly metastatic HepG2 cells. Overexpression of SRSF1 or SRA1-L promoted migration and invasion by increasing the expression of CD44, while SRA1-S reversed the effect of SRSF1 and SRA1-L in vitro. In addition, lung metastasis in mice revealed that, knockdown of SRSF1 or SRA1-L inhibited the migration of HCC cells, while SRA1-L overexpression abolished the effect of SRSF1 knockout and instead promoted HCC cells migration in vivo. More importantly, RNA immunoprecipitation and Cross-link immunoprecipitation analyses showed that SRSF1 interacts with exon 3 of SRA1 to up regulate the expression of SRA1-L in HCC cells. RNA pull-down results indicated that SRSF1 could also bind to exon 3 of SRA1 in vitro. Finally, minigene -MS2 mutation experiments showed that mutation of the SRA1 exon 3 binding site for SRSF1 prevented the binding of SRA1 pre-mRNA. In summary, our results provide experimental evidence that SRA1 exon 3 inclusion is up regulated by SRSF1 to promote tumor invasion and metastasis in hepatocellular carcinoma.
RESUMEN
The Axl gene is known to encode for a receptor tyrosine kinase involved in the metastasis process of cancer. In this study, we investigated the underlying molecular mechanism of Axl alternative splicing. Methods: The expression levels of PTBP1 in hepatocellular carcinoma (HCC) tissues were obtained from TCGA samples and cell lines. The effect of Axl-L, Axl-S, and PTBP1 on cell growth, migration, invasion tumor formation, and metastasis of liver cancer cells were measured by cell proliferation, wound-healing, invasion, xenograft tumor formation, and metastasis. Interaction between PTBP1 and Axl was explored using cross-link immunoprecipitation, RNA pull-down assays and RNA immunoprecipitation assays. Results: Knockdown of the PTBP1 and exon 10 skipping isoform of Axl (Axl-S), led to impaired invasion and metastasis in hepatoma cells. Immunoprecipitation results indicated that Axl-S protein binds more robustly with Gas6 ligand than Axl-L (exon 10 including) and is more capable of promoting phosphorylation of ERK and AKT proteins. Furthermore, cross-link immunoprecipitation and RNA-pulldown assays revealed that PTBP1 binds to the polypyrimidine sequence(TCCTCTCTGTCCTTTCTTC) on Axl-Intron 9. MS2-GFP-IP experiments demonstrated that PTBP1 competes with U2AF2 for binding to the aforementioned polypyrimidine sequence, thereby inhibiting alternative splicing and ultimately promoting Axl-S production. Conclusion: Our results highlight the biological significance of Axl-S and PTBP1 in tumor metastasis, and show that PTBP1 affects the invasion and metastasis of hepatoma cells by modulating the alternative splicing of Axl exon 10.
Asunto(s)
Ribonucleoproteínas Nucleares Heterogéneas/metabolismo , Neoplasias Hepáticas/genética , Proteína de Unión al Tracto de Polipirimidina/metabolismo , Proteínas Proto-Oncogénicas/genética , Proteínas Tirosina Quinasas Receptoras/genética , Empalme Alternativo/genética , Animales , Carcinoma Hepatocelular/genética , Línea Celular Tumoral , Movimiento Celular/genética , Proliferación Celular/genética , Exones/genética , Regulación Neoplásica de la Expresión Génica/genética , Ribonucleoproteínas Nucleares Heterogéneas/genética , Humanos , Hígado/patología , Neoplasias Hepáticas/metabolismo , Masculino , Ratones , Ratones Endogámicos BALB C , Ratones Desnudos , Invasividad Neoplásica/genética , Metástasis de la Neoplasia/genética , Proteína de Unión al Tracto de Polipirimidina/genética , Proteínas Proto-Oncogénicas/metabolismo , Precursores del ARN/genética , Empalme del ARN/genética , ARN Mensajero/genética , Proteínas Tirosina Quinasas Receptoras/metabolismo , Factor de Empalme U2AF/genética , Factor de Empalme U2AF/metabolismo , Ensayos Antitumor por Modelo de Xenoinjerto , Tirosina Quinasa del Receptor AxlRESUMEN
Alternative splicing (AS) events occur in the majority of human genes. AS in a single gene can give rise to different functions among multiple isoforms. Human ortholog of mammalian enabled (Mena) is a conserved regulator of actin dynamics that plays an important role in metastasis. Mena has been shown to have multiple splice variants in human tumor cells due to AS. However, the mechanism mediated Mena AS has not been elucidated. Here we showed that polypyrimidine tract-binding protein 1 (PTBP1) could modulate Mena AS. First, PTBP1 levels were elevated in metastatic lung cancer cells as well as during epithelial-mesenchymal transition (EMT) process. Then, knockdown of PTBP1 using shRNA inhibited migration and invasion of lung carcinoma cells and decreased the Mena exon11a skipping, whereas overexpression of PTBP1 had the opposite effects. The results of RNA pull-down assays and mutation analyses demonstrated that PTBP1 functionally targeted and physically interacted with polypyrimidine sequences on both upstream intron11 (TTTTCCCCTT) and downstream intron11a (TTTTTTTTTCTTT). In addition, the results of migration and invasion assays as well as detection of filopodia revealed that the effect of PTBP1 was reversed by knockdown of Mena but not Mena11a+. Overexpressed MenaΔ11a also rescued the PTBP1-induced migration and invasion. Taken together, our study provides a novel mechanism that PTBP1 modulates Mena exon11a skipping, and indicates that PTBP1 depends on the level of Mena11a- to promote lung cancer cells migration and invasion. The regulation of Mena AS may be a potential prognostic marker and a promising target for treatment of lung carcinoma.
Asunto(s)
Empalme Alternativo , Ribonucleoproteínas Nucleares Heterogéneas/genética , Neoplasias Pulmonares/genética , Proteínas de Microfilamentos/genética , Proteína de Unión al Tracto de Polipirimidina/genética , Células A549 , Movimiento Celular , Transición Epitelial-Mesenquimal , Exones , Regulación Neoplásica de la Expresión Génica , Ribonucleoproteínas Nucleares Heterogéneas/metabolismo , Humanos , Neoplasias Pulmonares/metabolismo , Invasividad Neoplásica , Proteína de Unión al Tracto de Polipirimidina/metabolismo , Regulación hacia ArribaRESUMEN
Idiopathic pulmonary fibrosis (IPF) is a disease with a poor prognosis and high mortality, posing a major threat to human health. Increased levels of inflammatory cytokines, reactive oxygen species and coagulation cascade have been extensively reported in IPF. We previously fused Hirudin and human manganese superoxide dismutase (hSOD2) to generate a dual-feature fusion protein, denoted as rhSOD2-Hirudin fusion protein. In this study, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) and Hydroxyproline (HYP) assays were used to investigate the effects of rhSOD2-Hirudin protein on thrombin-induced fibroblast proliferation and collagen accumulation in vitro. Subsequently, the mice model of pulmonary fibrosis induced by bleomycin was used for evaluating the anti-inflammatory and anti-fibrotic effects of rhSOD2-Hirudin protein in vivo. Results showed that rhSOD2-Hirudin protein could inhibit the proliferation of fibroblasts and reduce the HYP production in vitro by inhibiting the activity of thrombin. In vivo experiments showed that lung inflammation and fibrosis were significantly decreased in rhSOD2-Hirudin protein-treated mice. Furthermore, rhSOD2-Hirudin protein treatment reduced profibrotic protein and gene expression while reducing the number of inflammatory cells in the lung. In conclusion, rhSOD2-Hirudin protein can effectively attenuate pulmonary fibrosis in vitro and in vivo, mainly by inhibiting the activity of thrombin meanwhile increasing SOD2 levels prevent cells from being damaged by reactive oxygen species, thereby mitigating IPF progression. This study provided important information on the feasibility and efficacy of rhSOD2-Hirudin protein as a novel therapeutic agent for IPF.
Asunto(s)
Bleomicina/farmacología , Hirudinas/genética , Fibrosis Pulmonar/inducido químicamente , Fibrosis Pulmonar/tratamiento farmacológico , Proteínas Recombinantes de Fusión/farmacología , Superóxido Dismutasa/farmacología , Actinas/metabolismo , Animales , Proliferación Celular/efectos de los fármacos , Femenino , Fibroblastos/efectos de los fármacos , Fibroblastos/patología , Regulación de la Expresión Génica/efectos de los fármacos , Humanos , Hidroxiprolina/biosíntesis , Ratones , Células 3T3 NIH , Fibrosis Pulmonar/metabolismo , Fibrosis Pulmonar/patología , Proteínas Recombinantes de Fusión/uso terapéutico , Factor de Crecimiento Transformador beta1/metabolismoRESUMEN
Olfactory dysfunction is an early event in Alzheimer's disease (AD). However, the mechanism underlying the AD-related changes in the olfactory bulb (OB) remains unknown. Granule cells (GCs) in the OB regulate the activity of mitral cells (MCs) through reciprocal dendrodendritic synapses, which is crucial for olfactory signal processing and odor discrimination. Nevertheless, the relationships between the morphological and functional changes of dendrodendritic synapses, particularly the local field potentials (LFPs) as a consequence of olfactory disorders in patients with AD have not been investigated. Here, we studied the morphological and functional changes induced by dendrodendritic inhibition in GCs onto MCs in the OB of amyloid precursor protein (APP)/PS1 mice and age-matched control mice during aging, particular, we focused on the effects of olfactory disorder in the dendrodendritic synaptic structures and the LFPs. We found that olfactory disorder was associated with increased amyloid-ß (Aß) deposits in the OB of APP/PS1 mice, and those mice also exhibited abnormal changes in the morphology of GCs and MCs, a decreased density of GC dendritic spines and impairments in the synaptic interface of dendrodendritic synapses between GCs and MCs. In addition, the aberrant enhancements in the γ oscillations and firing rates of MCs in the OB of APP/PS1 mice were recorded by multi-electrode arrays (MEAs). The local application of a GABAAR agonist nearly abolished the aberrant increase in γ oscillations in the external plexiform layer (EPL) at advanced stages of AD, whereas a GABAAR antagonist aggravated the γ oscillations. Based on our findings, we concluded that the altered morphologies of the synaptic structures of GCs, the dysfunction of reciprocal dendrodendritic synapses between MCs and GCs, and the abnormal γ oscillations in the EPL might contribute to olfactory dysfunction in AD.
RESUMEN
Lung cancer is a serious threat to human health. Studies have revealed that human manganese superoxide dismutase (hSOD2) and miRNAs play an essential role in the metastasis process of lung cancer. However, the miRNAs that associated with hSOD2 and involved in metastasis, remain elusive. After databases analysis and dual luciferase reporter validation, we demonstrated that miR-330-3p expression inversely correlated with hSOD2b expression level, and that miR-330-3p directly targeted the 3'untranslated region (3'UTR) of hSOD2b. Furthermore, overexpression of miR-330-3p promoted whereas knockdown of miR-330-3p inhibited invasion/migration and the epithelial-mesenchymal transition (EMT) process of lung cancer cells in vitro. Knockdown of miR-330-3p inhibited metastasis of lung cancer cells in vivo. Moreover, miR-330-3p-mediated enhancement of invasion/migration in 95-D cells could be rescued by over-expression of hSOD2. In conclusion, we demonstrated that miR-330-3p promoted metastasis of lung cancer cells by suppressing hSOD2b expression and unveiled a new clinical application of miR-330-3p in the therapy of lung cancer.
Asunto(s)
Movimiento Celular , Neoplasias Pulmonares/metabolismo , MicroARNs/metabolismo , Proteínas de Neoplasias/metabolismo , ARN Neoplásico/metabolismo , Superóxido Dismutasa/metabolismo , Células A549 , Transición Epitelial-Mesenquimal , Células HeLa , Células Hep G2 , Humanos , Células K562 , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/patología , Células MCF-7 , MicroARNs/genética , Invasividad Neoplásica , Metástasis de la Neoplasia , Proteínas de Neoplasias/genética , ARN Neoplásico/genética , Superóxido Dismutasa/genéticaRESUMEN
Growing evidences have demonstrated alternative splicing makes great contribution to tumor metastasis since multiple protein isoforms from a single gene that often display different functions in the cell. Human manganese superoxide dismutase (hMnSOD) was revealed dysregulation in progress of tumor metastasis, while the effect of hMnSOD isoforms on metastasis remained unclear. In this study, we showed a novel truncated hMnSOD isoform hMnSOD183, which lacked 39 amino acids compared with hMnSOD222. We expressed two hMnSOD protein isoforms in Escherichia coli, respectively, and found that the MnSOD activity of truncated hMnSOD isoform was especially weaker. In 95-D cells, mRNA levels of hMnSOD variants and MnSOD activity were significantly increased than that in A549 cells. Furthermore, the hMnSODc exhibited lower mRNA level than hMnSODa/b in A549 and 95-D cells. Additionally, the effects of two isoforms were assessed about cell invasion, overexpression of hMnSOD222 but not hMnSOD183 promoted 95-D cells metastasis, and hMnSOD knockdown significantly reduced cells invasive behavior. Overexpression of hMnSOD isoforms also caused changes of metastasis associated proteins, such as up-regulation of MMPs, VEGF and Vimentin and down-regulation of E-cadherin. Moreover, overexpression of hMnSOD183 had weaker effect on metastasis related signaling proteins, such as Akt, JNK and IKKß, compared to hMnSOD222. In conclusion, our study identified that hMnSOD isoforms induced lung cancer cells invasion through Akt-JNK-IKKß signaling pathways and the hMnSOD183 isoform played a weaker role than hMnSOD222. Characterization of hMnSOD isoforms is useful for future investigation on metastasis of lung cancer cells.