Rituximab Biosimilar BCD020 Shows Superior Efficacy above Conventional Non-Biologics Treatment in Pediatric Lupus Nephritis: The Data of Retrospective Cohort Study.

BACKGROUND: Pediatric lupus nephritis (LN) is one of the most serious manifestations of systemic lupus erythematosus (SLE) in children, determining the outcomes of the disease. There are no standardized treatment protocols for pediatric LN, and the role of biologics has not yet been conclusively defined. OBJECTIVES: analyze the safety and efficacy of rituximab biosimilar BCD020 in pediatric patients with lupus nephritis. METHODS: in a retrospective cohort study, the data from the case histories of 25 patients with LN (10 boys and 15 girls) with an onset age of 13 (9-16) years, who failed conventional non-biologic treatment or developed corticosteroid dependence/toxicity, were included. The diagnosis was made using Systemic Lupus International Collaborating Clinics (SLICC) classification criteria. Rituximab biosimilar BCD020 was prescribed in a dosage of 375 mg/m2 every week (2-4 infusions) with repeated courses every 6-12 months (2-4 infusions) according to disease activity, B-cell depletion, and IgG levels. The dynamics of clinical and laboratory data, the activity of the disease by SLEDAI, and corticosteroid doses were assessed at the onset and during the rituximab trial. RESULTS: The main patient's characteristics were: Pre-rituximab non-biologic conventional treatment included: cyclophosphamide 15 (60%), MMF 8 (32%), azathioprine 3 (12%), hydroxychloroquine 12 (48%), and pulse therapy of methylprednisolone followed by oral methylprednisolone 25 (100%). The time before rituximab was 7.0 (3.0-24.0) months, and the whole observation period was 7.0 (0; 24) months. The initial pre-rituximab treatment slightly reduced SLEDAI levels and the proportion of patients with LN. A significant reduction of SLEDAI, the anti-dsDNA level, proteinuria, hematuria, C4 complement, ESR, and the median corticosteroid dose by 80% from the initial value, as well as the proportion of patients without corticosteroids, was observed after rituximab administration. Two deaths were observed due to catastrophic SLE with macrophage activation syndrome, accompanied by a severe infection (invasive aspergillosis, n = 2). Three patients developed serious adverse events: pneumonia (n = 2), transient agranulocytosis (n = 1) after the third rituximab infusion, and meningitis, caused by Listeria monocytosis, after the first rituximab infusion. Eight patients received antibacterial treatment for different respiratory infections without hospital admissions. CONCLUSIONS: Rituximab biosimilar BCD020 showed effectiveness in LN, whereas previous non-biologic treatment was insufficiently effective. Randomized controlled trials are required to evaluate the efficacy and safety of rituximab and evaluate the benefits when compared with conventional SLE treatment.

Uveitis Is a Risk Factor for Juvenile Idiopathic Arthritis' Significant Flare in Patients Treated With Biologics.

Objectives: Uveitis is the most frequent extra-articular manifestation of juvenile idiopathic arthritis (JIA). Our study is aimed to evaluate the possible difference in arthritis course depending on uveitis presence in patients with JIA, treated with biologics. Methods: From our database of patients with JIA treated with biologics, we extracted patients to whom the first agent was administrated with or without MTX. The exclusion criteria included treatment with current systemic corticosteroids, infliximab, rituximab, observation period <3 years, and no missing data. After selection, 175 patients were eligible for analysis. We evaluated clinically significant flare with joint involvement (which required change of biologic or non-biologic DMARD) and time to flare. We compared two groups: (i) patients with uveitis (n = 32) and (ii) patients without uveitis (n = 143). For statistical analysis, we used Cox's regression models, the log-Rank test, x 2 test, and the Mann-Whitney test. Results: There was no difference in gender distribution and achievement of arthritis remission between groups. Patients in the non-uveitis group predominantly received etanercept (64.3%). In the uveitis group, the most prescribed biologic agent was adalimumab (71.9%). The presence of uveitis increased the risk of JIA flare, OR = 3.8 (95% CI: 1.7; 8.7), and the cumulative probability of joint flare, RR = 4.5 (95% CI: 1.7; 12.1), p =.003, after adjustment on methotrexate, RR = 3.1 (1.6; 6.), p =.0008. In the subgroup of patients treated with adalimumab, the absence of methotrexate increased the cumulative probability of flare [RR = 6.5 (95% CI: 1.4; 31.1), p = 0.02]. Conclusion: The presence of uveitis proved to be a risk factor in JIA flare. Methotrexate can decrease the cumulative flare probability. Further trials are required.

Heart Involvement in Multisystem Inflammatory Syndrome, Associated With COVID-19 in Children: The Retrospective Multicenter Cohort Data.

Objectives: Heart involvement in multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C) is a new challenging problem, requiring fast and reliable diagnostics and appropriate treatment. The aim of this study is to describe heart involvement in patients with MIS-C. Study Design: In this retrospective, multicenter cohort study, data of 122 patients were included. All patients met WHO and CDC criteria of MIS-C. Results: Various types of heart involvement in MIS-C patients were observed. Patients with solely coronary artery lesions (CAL, n = 10, 8.2%) had typical features of Kawasaki disease: younger age, thrombocytosis and normal ferritin level, without giant CA aneurysms, thrombosis, myocardial infarction, shock, and ICU admission. Patients with solely myocardial involvement (MI, n = 30, 24.6%) had an older onset age, elevated ferritin, LDH, the highest D-dimer, H score, and thrombocytopenia level. The following clinical signs were associated with MI: gastrointestinal and central nervous system disorder, sore throat, swelling face, splenomegaly, shock, and treatment in the intensive care unit required. Patients with a combination of CAL and MI (n = 10, 8.2%) had symptoms similar to patients with solely MI, except for impressive thrombocytopenia. Shock and ICU admission were found in 34.7% of patients without heart involvement (n = 72, 59%). One major criterion [troponin > 32 pg/ml (52 points)] or at least two minor criteria [face swelling (32 points) and D-Dimer > 1,300 ng/ml (29 points)] were associated with MI (>32 points) with a sensitivity of 67.5% and a specificity of 88.9%. Conclusion: The above-suggested criteria can be added to routine diagnostic procedures to confirm MI in MIS-C patients.

The Safety and Efficacy of Tofacitinib in 24 Cases of Pediatric Rheumatic Diseases: Single Centre Experience.

JAK-inhibitors are small molecules blocking the JAK-STAT pathway that have proven effective in the treatment of different immune-mediated diseases in adults and juvenile idiopathic arthritis (JIA). AIM OF STUDY: To evaluate the safety and efficacy of tofacitinib in children with different rheumatic diseases. MATERIAL AND METHODS: We extracted information from 24 children with the following diagnosis: JIA (n = 15), undifferentiated systemic autoinflammatory diseases (SAIDs) (n = 7), and juvenile dermatomyositis (JDM) (n = 2) who have been treated with tofacitinib for a period of longer than 6 months. The treatment outcomes were classified according to the opinion of the attending physicians as having a complete response (CR), i.e., the absence of disease activity, or a partial response (PR)-a significant improvement of symptoms and disease activity, or no response (NR)-no changes in disease activity. RESULTS: CR was achieved in 10/24 patients; 7/15 among JIA patients, 1/2 among JDM patients, 4/7 among SAID patients, and PR in 5/15 of JIA, 1/2 of JDM, and 3/7 of SAID patients. Three non-responders with JIA discontinued tofacitinib. Corticosteroids were successfully tapered off in 11/14 patients and discontinued in 2/14 patients. Four patients had side effects not requiring treatment discontinuation: liver enzyme elevation (n = 2), hypercholesterolemia (n = 1), lymphadenitis (n = 1). CONCLUSION: JAK-inhibitors are effective new therapies for the treatment of multiple immune-mediated diseases. Our experience has shown the best results in patients with JIA and JIA-associated alopecia, and type I interferonopathies. More data from randomized controlled clinical trials are needed to use JAK-inhibitors safely in pediatric rheumatic diseases.

Distinguishing Between Multisystem Inflammatory Syndrome, Associated With COVID-19 in Children and the Kawasaki Disease: Development of Preliminary Criteria Based on the Data of the Retrospective Multicenter Cohort Study.

Objectives: Diagnostic between multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C) and Kawasaki disease (KD) can make difficulties due to many similarities. Our study aimed to create a Kawasaki/MIS-C differentiation score (KMDscore) allowing discrimination of MIS-C and KD. Study design: The retrospective multicenter cohort study included clinical, laboratory, and instrumental information about MIS-C (n = 72) and KD (n = 147). The variables allowed to discriminate both conditions used to construct and validate the diagnostic score called the KMDscore. Results: Patients with MIS-C were older, had earlier admission to the hospital, had a shorter time before fever resolution, two times frequently had signs of GI and CNS involvement observed, and had more impressive thrombocytopenia, higher level of CRP, ferritin, ALT, AST, LDH, creatinine, triglycerides, troponin, and D-dimer compared to KD patients. Respiratory signs in MIS-C were presented with pleuritis, acute respiratory distress syndrome, oxygen dependency, lung infiltration, and ground-glass opacities in CT. The heart involvement with fast progression of myocarditis provided the severity of MIS-C and ICU admission due to 12 times higher arterial hypotension or shock and required cardiotonic. No differences in the frequency of CA lesions were seen in the majority of cases. Five criteria, CRP >11 mg/dl (18 points), D-dimer >607 ng/ml (27 points), age >5 years (30 points), thrombocytopenia (25 points), and GI involvement (28 points), were included in the KMDscore. The summa >55 points allowed to discriminate MIS-C from KD with a sensitivity of 87.5% and specificity of 89.1%. Conclusion: The KMDscore can be used to differentiate the diagnostic of MIS-C from KD.

Reasons for inactive disease and flare in systemic onset juvenile idiopathic arthritis patients during tocilizumab treatment.

OBJECTIVES: The aim of our study was to evaluate disease courses and outcomes of sJIA children undergoing tocilizumab (TCZ) treatment, and to establish the predictors which distinguish inactive disease and disease flares. METHODS: Our retrospective study included 48 active sJIA children who were refractory to different anti-rheumatic drugs and who were then started on TCZ. The effectiveness of TCZ was assessed by the changes of sJIA attributed signs and symptoms and the remission was judged according to the Wallace (2004) criteria. RESULTS: The main demographic parameters (Me; IQR) were shown; mean age: 9.9 (5-12.7) years and mean duration of TCZ administration: 27.0 (5.9-89.7) months. During the TCZ treatment 40 cases (83.3%) achieved remission in 138.5 (56.0; 255.0) days. Patients who achieved remission had milder disease course, and presented less frequent epatosplenomegaly, lung, heart involvement and MAS. They had higher Hb and lower WBC, granulocytes, ESR, CRP, LDH, ferritin. The main predictors of achievement of inactive disease, calculated with Cox-regression models, were CRP≤82.0 mg/l (OR=7.9, HR=1.17), ESR≤32 mm/h (OR=17.0, HR=0.85), ferritin ≤273 ng/ml (OR=56.5, HR=2.6), Hb>113 g/l (OR=17.0, HR=1.33), LDH≤676 U/l (OR=113.6, HR=3.2), PLT>335*109/l (OR=5.0, HR=2.5), and intensive depression of WBC in 2 weeks after the 1st TCZ infusion>11% (OR=13.0, HR=6.0) and granulocytes>12% (OR=14.0, HR=4.7). CONCLUSIONS: sJIA children with milder disease course have more posssibilty of achieving disease remission during TCZ treatment. Male sex, signs of high disease activity, previous CS treatment, the long time needed to achieve inactive disease and treatment protocol deviations increased the risk of sJIA flare.

Successful treatment with tocilizumab every 4 weeks of a low disease activity group who achieve a drug-free remission in patients with systemic-onset juvenile idiopathic arthritis.

BACKGROUND: Systemic juvenile idiopathic arthritis (SoJIA) is the most striking form of juvenile idiopathic arthritis. The aim of our study was to evaluate the clinical responses and outcomes of children with SoJIA to IL-6 blockade using two different tocilizumab (TCZ) treatment protocols designed for milder and more severe SoJIA patient groups, and evaluate the possibility of achieving biologic-free remission. METHODS: Thirty-seven active SoJIA children who have failed treatment with corticosteroids and other DMARDs were included in our retrospective study. TCZ doses were prescribed in two treatment approaches: every 2 weeks TCZ dosing (Q2W) and every 4 weeks TCZ dosing (Q4W). The patients were assigned to these two groups by the study physicians depending on the severity of the SoJIA disease as judged by each clinician. RESULTS: Thirty-three of the 37 children successfully completed the trial. TCZ was discontinued in 11patients during the trial. Seven children achieved inactive disease and were allowed to stop the TCZ and 4 had severe adverse events requiring drug cessation. Currently 7 patients continue to have TCZ-free remission [4/7 remission off-medication, 3/7still on methotrexate (MTX)]. This mixed group had a median treatment duration of 1002 days. The children in remission off of all medications, TCZ and MTX, had a median remission duration of 1162 days (ranged 932-1301 days). Compared to the patients assigned to the Q2W TCZ treatment group, the patients assigned to the Q4W TCZ group had a milder SoJIA course. The patients had higher levels of hemoglobin, total proteins, and serum albumins. They had lower white blood cell counts (WBC), % granulocytes, CRP, ESR, ferritins, and LDH. These children had a lower frequency of internal organ involvement, fewer relapses during TCZ treatment, and no macrophage activation syndrome episodes. CONCLUSIONS: Our experience with TCZ for SoJIA supports the excellent result of other studies. What may be novel is our finding that thisIL-6 blockade with TCZ may be able to be utilized at a less frequent dosing schedule in mild SoJIA compared to severe SoJIA. We discuss other factors that may increase the probability of a patient reaching TCZ-free remission.

Identification of the best cutoff points and clinical signs specific for early recognition of macrophage activation syndrome in active systemic juvenile idiopathic arthritis.

OBJECTIVES: The purpose of our study was to detect early clinical and laboratory signs that help to discriminate macrophage activation syndrome (MAS) from active systemic juvenile idiopathic arthritis (SJIA) without MAS. METHODS: Our retrospective study was based on reviewing the medical charts of the children admitted to the rheumatology department with active SJIA and definite MAS (n = 18) and without MAS (n = 40). We evaluated the data related to SJIA and MAS at the moment of the patient׳s admission. If the patient had signs of MAS since admission or developed definite MAS later during this flare, he was referred to the main group. The children who did not have MAS during the flare episode and did not have MAS in the past medical history were in the control group. We calculated the cutoff points for MAS parameters, performed the analysis of sensitivity and specificity, identified the predictors, and provided the preliminary diagnostic rule through "the-number-of-criteria-present" approach. RESULTS: The clinical signs were relevant to MAS in SJIA: oligoarticular disease course (OR = 5.6), splenomegaly (OR = 67.6), hemorrhages (OR = 33.0), and respiratory failure (OR = 11.3). The involvement of wrist (OR = 0.2), MCP (OR = 0.1), and PIP joints (OR = 0.1) was protective against MAS development. The best cutoffs for laboratory parameters were PLT ≤ 211 × 10(9)/l, WBC ≤ 9.9 × 10(9)/l, AST > 59.7U/l, LDH > 882U/l, albumin ≤ 2.9g/dl, ferritin > 400µg/l, fibrinogen ≤ 1.8g/l, and proteinuria. The laboratory variables were more precise in the discrimination of early MAS than clinical: any 3 or more laboratory criteria provided the highest specificity (1.0) and sensitivity (1.0) and OR = 2997. CONCLUSIONS: We detected clinical and laboratory markers and created preliminary diagnostic (laboratory) guidelines for early discrimination of MAS in active SJIA.

A130: Is the CCR5-delta32 Mutation Protective Against Systemic-Onset Juvenile Idiopathic Arthritis?

BACKGROUND/PURPOSE: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role. METHODS: 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5'CTTCATTACACCTGCAGTC3', CCR5-Δ32-R: 5'TGAAGATAAGCCTCACAGCC3' by following condition: 95°-5'×1; 95°-15″→55°-15″→72°-60″×40; 72°-10'×3→4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus. RESULTS: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10-18% for Northwestern Russia, Kofiady, 2008; 11,8%- for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. [Table: see text] CONCLUSION: The results of the study may be considered rather not supporting the idea of the protective role of the CCR5-delta32 mutation against soJIA, though the revealed associations-most of them related to the signs of the Macrophage Associated Syndrome-can be the basis for a more sophisticated research.