Visual Acuity-Related Outer Retinal Structural Parameters on Swept Source Optical Coherence Tomography and Angiography in XLRS Patients and Carriers.

Purpose: To assess the quantitative differences in vessel density and retinal thickness of X-linked retinoschisis (XLRS) patients and RS1 mutation carriers, and the correlation with best-corrected visual acuity (BCVA) with swept source optical coherence tomography (SS-OCT) and OCT angiography (OCTA). Methods: We analyzed the correlation between the BCVA of XLRS patients and the SS-OCT and OCTA findings including the detailed structural characteristics of XLRS patients. Results: Besides the schitic changes in various retinal layers, the structural disturbance of outer retina was universally found. In 29 eyes included in the quantitative analysis, XLRS patients showed lower vessel density of the superficial capillary plexus, deep capillary plexus and lower thickness of the outer nuclear layer. BCVA was correlated with the thickness of the outer plexiform layer and outer nuclear layer and the thickness from the outer limiting membrane to the retinal pigment epithelium. Carriers showed higher thickness of outer plexiform layer and smaller foveal avascular zone area. Conclusions: SS-OCT and OCTA could identify the pathological alterations of the individual retinal layers and capillaries, which could pinpoint the exact location of the damages related to visual impairment. In the carriers, the subtle alterations that can be detected with SS-OCT, despite their normal visual acuity, may be caused by the lyonization. Translational Relevance: Swept source optical coherence tomography can be used as an efficient technique to expose the retinal damage related to visual impairment for prognosis and follow-up.

Blocking Th2 Signaling Pathway Alleviates the Clinical Symptoms and Inflammation in Allergic Conjunctivitis.

Purpose: To explore the role of Th2 signaling pathway in allergic conjunctivitis (AC). Methods: Serum Th2 cytokines IL-4 or IL-13 of patients with AC were detected using the Meso scale discovery assay to verify the correlation of Th2 immunity and AC pathogenesis. Wistar Han rats were intraperitoneally and subcutaneously injected with ovalbumin (OVA) to establish an experimental AC model and the Th2 signaling pathway was blocked by an investigational neutralizing antibody (CM310). Serum IgE and OVA-specific IgE were detected by ELISA. Conjunctivitis inflammation, infiltration of eosinophils, and mast cell degranulation were detected by histological examination. Immortalized human conjunctival epithelial cells, a conjunctival epithelial cell line, and peripheral blood mononuclear cells of patients with AC were used as the target cells to study the impact of IL-4 or IL-13 on AC progression. Finally, a STAT6 reporter gene system was constructed using immortalized human conjunctival epithelial cells to confirm whether the downstream signaling pathway activated by IL-4 or IL-13. Results: Serum IL-4 or IL-13 were increased in patients with AC versus healthy individuals. In an OVA-induced rat experimental AC model, blocking the Th2 signaling pathway with CM310, an investigational neutralizing antibody, alleviated the conjunctival symptoms, and decreased serum IgE, suppressed infiltration of eosinophils and mast cell degranulation. Further, an in vitro model showed CM310 suppressed the secretion of inflammatory cytokine from both immune cells and epithelial cells in both patients peripheral blood mononuclear cells and cell line. Conclusions: Blocking Th2 signaling pathway alleviates the clinical symptoms and inflammation in AC.

Two AOS genes attributed to familial exudative vitreoretinopathy with microcephaly: Two case reports.

RATIONALE: Familial exudative vitreoretinopathy (FEVR) is an inherited disorder, which is mostly reported to be associated with the mutation of genes involved in the Wnt signaling pathway related to ß-catenin. To the best of our knowledge, the involvement of Adams-Oliver syndrome (AOS) genes in FEVR patients have not been reported before. PATIENT CONCERNS: Two patients with FEVR presented with microcephaly. One of them showed slight scarring of the scalp vertex which is a typical manifestation of AOS. The whole exon sequencing confirmed the diagnosis of AOS with 2 AOS-gene mutations at DOCK6 and ARHGAP31. Further clinical examination revealed that their parents with the same mutations showed FEVR-like vascular anomalies. DIAGNOSIS: Both patients were diagnosed with AOS through whole exon sequencing, and they presented with some FEVR-like retinopathy including retinal detachment. INTERVENTIONS: Both patients received vitrectomy for tractional retinal detachment with proliferative vitreoretinopathy. During the follow-up, 1 patient received additional laser photocoagulation for tractional retinal detachment. OUTCOMES: The 2 patients remained stable in the latest follow up after the treatment. LESSONS: Microcephaly could be associated with some form of retinopathy. We proposed that mutation of DOCK6 and ARHGAP31 genes could be the possible cause of FEVR associated with microcephaly. Our study suggested that these genes may be candidate genes of FEVR.

[Genetic and phenotypic analysis of a patient with phosphogylcerate dehydrogenase deficiency].

OBJECTIVE: To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction. METHODS: The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis. RESULTS: The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic. CONCLUSION: The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.

[Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome].

OBJECTIVE: To explore the genetic basis for three children patients with CHARGE syndrome. METHODS: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing. RESULTS: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo. CONCLUSION: Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Prevalence and risk factors of myopia in Han and Yugur older adults in Gansu, China: a cross-sectional study.

Few studies have investigated the prevalence of myopia in Northwest China. This cross-sectional study aimed to investigate the prevalence and associated factors of myopia and high myopia in adults aged 40-80 years in the Han and Yugur populations living in Gansu Province, Northwest China. A total of 3,845 participants were included. The overall age- and sex-adjusted prevalence of myopia (spherical equivalent (SE) < -0.5 D), high myopia (SE < -6.0 D) and hyperopia (SE > + 0.5 D) were 16.4%, 0.7% and 26.2% in Yugur participants, respectively, and 34.3%, 5.0% and 19.2% in Han participants, respectively. The prevalence of myopia and high myopia in Han participants was significantly higher than that in Yugur participants (both P < 0.001). Yugur population, birth in rural areas, smoking history and outdoor work were found to be negatively associated with myopia. Higher education level and a family history of myopia were found to be positively associated with myopia in the study population. High myopia was negatively associated with Yugur population, aging, birth in rural areas and was positively associated with a family history of myopia. This study provided valuable information regarding the environmental risk factors of myopia and revealed an ethnic disparity in the prevalence of myopia in Gansu Province, Northwest China.

A single-center, prospective, randomized clinical trial to investigate the optimal removal time of the urinary catheter after laparoscopic anterior resection of the rectum: study protocol for a randomized controlled trial.

BACKGROUND: Urinary catheter placement is essential before laparoscopic anterior resection for rectal cancer. Whether early removal of the catheter increases the incidence of urinary retention and urinary tract infection (UTI) is not clear. This study aims to determine the optimal time for removal of the urinary catheter after laparoscopic anterior resection of the rectum. METHODS/DESIGN: A total of 220 participants meeting the inclusion criteria will be randomly assigned to an experimental group or a control group. The experimental group will have their urethral catheters removed on postoperative day 2 and the control group will have their urethral catheters removed on postoperative day 7. In both groups, catheter removal will be performed when the bladder is full. The incidence of urinary retention and UTI in the two groups will be compared to determine the optimal catheter removal time. DISCUSSION: This is a prospective, single-center, randomized controlled trial to determine whether early removal of the urinary catheter after laparoscopic anterior resection of the rectum will help to decrease the incidence of postoperative acute urinary retention and UTI. TRIAL REGISTRATION: ClinicalTrials.gov, NCT03065855 . Registered on 23 February 2017.