First Report of Stemphylium vesicarium Causing Onion Stemphylium Leaf Blight in Mauritius.

In August 2021, severe leaf blight symptoms were observed on onion (Allium cepa L. cvs Francia and Askari F1 hybrid) in commercial fields located in Mauritius, namely La Forêt (20°19'56.1"S57°30'04.9"E), St Aubin (20°29'47.0"S57°32'29.4"E) and Chapiron (20°20'46.8"S 57°29'12.8"E). Infected leaves displayed small circular to oblong yellow-pale-brown and spindle shaped lesions which later coalesced and formed necrotic areas with black sporulation. Three fields were selected from each region, and along a W-pattern across the fields a disease incidence ranging 53-93% and a severity of 9-28% were recorded. Ten symptomatic leaves were collected in each region and small pieces of infected tissue were surface disinfected using 1% NaOCl for 2 min, rinsed with sterile distilled water, air-dried, transferred to potato dextrose agar (PDA) and incubated for 7 days at 20°C under a 12-h light/dark cycle. Fungal cultures with uniform appearance forming multi-septated conidia typical of the genus Stemphylium (Simmons 1969) were consistently isolated. Monosporic colony of isolates SVCWLF24/3, SVSSA23/1 and SVCWLMC26/1 developed similar olivaceous green to light and dark grey mycelium with an average daily growth rate of 6.5 mm at 25°C in the dark. Conidiophores were straight, light brown with a distinct swollen apex on which olive brown to dark brown, oblong to ovoid, septate conidia formed with dimensions 16.2-44.7 × 8.0-22.9 µm (av. 29.5 x 14.7 µm; n = 50) typical of Stemphylium vesicarium (Wallr) E.G. Simmons 1969 (Woudenberg et al. 2017). Genomic DNA of the three isolates was extracted from fungal mycelium (Ranghoo and Hyde 2000).. The ITS, cmdA and gapdh genes of the isolates were amplified with primers ITS4/ITS5 (White et al. 1990), CALDF1/CALDR1 (Lawrence et al. 2013) and Gpd1/Gpd2 (Beerbee et al. 1999) and sequenced. Sequences were submitted to GenBank under accession numbers OR131271, ON620213, OR188702 (ITS), OR350623, OR350622, OR166368 (cmdA) and OR684516, OR684517, OR684518 (Gapdh). The BLAST search of the sequences showed 100% similarity with S. vesicarium strain CBS 155.24 under accession numbers KU850555 (ITS), KU850702 (Gapdh) and KU850845 (cmdA) (Woudenberg et al. 2017). Phylogenetic trees inferred from the ITS, cmdA and Gapdh concatenated datasets with the maximum-likelihood algorithm allowed clustering of the isolates within S. vesicarium clade, confirming the morphological identification. Pathogenicity tests were performed using all three isolates, cultured on PDA at 25°C in a 12-h dark/light cycle. Ten 60-day-old onion plants (cv. Francia) were spray inoculated each with 10 ml of conidial suspension (1 × 104/ml) of each isolate while 10 healthy plants sprayed with sterile distilled water served as control. They were incubated in a greenhouse at 25°C with a 12-h photoperiod and > 80% humidity. Necrotic circular lesions appeared on leaves after 7-10 days while control plants remained symptomless. Re-isolations made from symptomatic leaf tissues on PDA consistently yielded cultures with similar morphology as the original isolates, thus fulfilling Koch's postulates. This is the first report of S. vesicarium as the causal agent of leaf blight of onion in Mauritius. It is a re-emerging fungal disease (Hay et al. 2021) with a wide host range threatening local onion production. This finding will contribute to early detection of leaf blight, implementation of surveillance and integrated disease management in affected regions.

First report of black leaf streak disease in bananas caused by Pseudocercospora fijiensis on Mauritius island.

Pseudocercospora fijiensis, the causal agent of the black leaf streak disease of bananas (plants in the genus Musa) (BLSD), is considered to be the major economic threat to export-banana cultivation (de Bellaire, Fouré, Abadie, & Carlier, 2010). The disease has a worldwide distribution throughout the humid tropical regions and has been previously reported in the Southwestndian Ocean (SWIO) area: in 1993 in Mayotte and Comoros islands (DR Jones & Mourichon, 1993), in 2000 in Madagascar (Jones, 2003; Rivas, Zapater, Abadie, & Carlier, 2004) and in 2018 in Reunion Island (Rieux et al., 2019). In Mauritius, the presence of Pseudocercospora fijiensis was suspected in 1996 (Soomary & Benimadhu, 1998) but has never been confirmed, as symptoms could have been confounded with Pseudocercospora musae or Pseudocercospora eumusae, two causal agents of others leaf spot diseases of banana which were previously described in Mauritius in 1959 (Orieux & Felix, 1968) and 2000 (Carlier, Zapater, Lapeyre, Jones, & Mourichon, 2000), respectively. In March 2022, typical BLSD symptoms were observed at relatively low prevalence in a Cavendish crop located in the "Balance John" area (site S1 on Fig. S1-A) of Mauritius island. Typical early symptoms (stages 2) were 1- to 4-mm long brown streaks at the abaxial leaf surface, and typical older streaks (stages 3 and 4) were also observed (Fig. S1-B). These symptoms were mixed with symptoms of ELSD caused by P. eumusae. Since both species cannot be clearly distinguished only on the description of symptoms, conidial sporulation on stages 2 was checked in the laboratory (Ngando et al., 2015) since P. eumusae does not produce conidia on these young stages. In April 2022, banana leaves bearing symptoms of leaf spot diseases were collected in 7 different sites (Fig. S1-A). All leaf fragments were sent to the CIRAD laboratories where molecular diagnosis was performed following the protocol developed by Arzanlou et al. (2007). In brief, genomic DNA was extracted from ground leaf fragments displaying symptoms using the DNeasy® Plant Mini Kit (Qiagen®, Courtaboeuf, France). At each site, a total of 6 lesions cut from 6 different leaves were pooled. The DNA extracts were added as templates for real-time PCR assay designed to specifically detect the presence of P. fijiensis, P. musae and P. eumusae using MFbf/MFbrtaq/MFbp, MEbf/MEbrtaq/FMep and MMbf/Mmbrtaq/FMep primers and probes, respectively (Arzanlou et al., 2007). Both positive and negative controls were included in the assay and every sample reaction was duplicated. P. fijiensis was detected from 2 out of 7 sites (S2 and S7, see Fig.S2-B). P. eumusae was detected at all sites while P. musae was found in one site only (S6). Interestingly, our results also showed coinfection by P. fijiensis - P. eumusae & P. musae - P. eumusae on several sites. The presence of P. fijiensis was further confirmed by several investigations performed on conidia isolated from S2 samples including i) morphological observations of conidia displaying P. fijiensis type description (Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021), Fig. S2-A), ii) DNA sequencing of 16S ribosomal gene with ITS1 & ITS4 primers (GenBank accessions Nos. OR515818-OR515810) with BLAST results displaying percentages of identity > 99.70% with type strains and iii) Koch's postulates were fulfilled by artificial inoculation of detached leaf pieces as described in Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021) (Fig. S2-D). In brief, for the artificial inoculation, symptoms obtained after inoculation of both a strain isolated in Mauritius (S2-MAU) and a positive control (T+) were compared and shown to be typical of P. fijiensis species for the 3 replicates. To the best of our knowledge, this is the first official report of P. fijiensis and BLSD in Mauritius Island. This revelation holds significant importance for both the agricultural and scientific communities, shedding light on the potential spread and impact of this devastating pathogen in previously unaffected regions. From a global perspective, this discovery underscores the interconnectedness of agricultural ecosystems and the need for vigilance in monitoring and responding to emerging plant diseases in an increasingly interconnected world (Vega et al. 2022). Future investigations will be required to monitor the spread of BLSD on the island, describe the genetic structure of populations and identify routes of invasion at the SWOI scale.

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 µm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

First report of Black Scurf caused by Rhizoctonia solani AG-3 on potato tubers in Mauritius.

Potato (Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

First Report of Target Spot on Tomato Caused by Corynespora cassiicola in Mauritius.

Tomatoes (Solanum lycopersicum) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 µm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena, Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.