Irisin acts through its integrin receptor in a two-step process involving extracellular Hsp90α.

Exercise benefits the human body in many ways. Irisin is secreted by muscle, increased with exercise, and conveys physiological benefits, including improved cognition and resistance to neurodegeneration. Irisin acts via αV integrins; however, a mechanistic understanding of how small polypeptides like irisin can signal through integrins is poorly understood. Using mass spectrometry and cryo-EM, we demonstrate that the extracellular heat shock protein 90α (eHsp90α) is secreted by muscle with exercise and activates integrin αVß5. This allows for high-affinity irisin binding and signaling through an Hsp90α/αV/ß5 complex. By including hydrogen/deuterium exchange data, we generate and experimentally validate a 2.98 Å RMSD irisin/αVß5 complex docking model. Irisin binds very tightly to an alternative interface on αVß5 distinct from that used by known ligands. These data elucidate a non-canonical mechanism by which a small polypeptide hormone like irisin can function through an integrin receptor.

NIN-like protein 7 transcription factor is a plant nitrate sensor.

Nitrate is an essential nutrient and signaling molecule for plant growth. Plants sense intracellular nitrate to adjust their metabolic and growth responses. Here we identify the primary nitrate sensor in plants. We found that mutation of all seven Arabidopsis NIN-like protein (NLP) transcription factors abolished plants' primary nitrate responses and developmental programs. Analyses of NIN-NLP7 chimeras and nitrate binding revealed that NLP7 is derepressed upon nitrate perception via its amino terminus. A genetically encoded fluorescent split biosensor, mCitrine-NLP7, enabled visualization of single-cell nitrate dynamics in planta. The nitrate sensor domain of NLP7 resembles the bacterial nitrate sensor NreA. Substitutions of conserved residues in the ligand-binding pocket impaired the ability of nitrate-triggered NLP7 to control transcription, transport, metabolism, development, and biomass. We propose that NLP7 represents a nitrate sensor in land plants.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

A biphenyl inhibitor of eIF4E targeting an internal binding site enables the design of cell-permeable PROTAC-degraders.

The eukaryotic translation initiation factor 4E (eIF4E) is the master regulator of cap-dependent protein synthesis. Overexpression of eIF4E is implicated in diseases such as cancer, where dysregulation of oncogenic protein translation is frequently observed. eIF4E has been an attractive target for cancer treatment. Here we report a high-resolution X-ray crystal structure of eIF4E in complex with a novel inhibitor (i4EG-BiP) that targets an internal binding site, in contrast to the previously described inhibitor, 4EGI-1, which binds to the surface. We demonstrate that i4EG-BiP is able to displace the scaffold protein eIF4G and inhibit the proliferation of cancer cells. We provide insights into how i4EG-BiP is able to inhibit cap-dependent translation by increasing the eIF4E-4E-BP1 interaction while diminishing the interaction of eIF4E with eIF4G. Leveraging structural details, we designed proteolysis targeted chimeras (PROTACs) derived from 4EGI-1 and i4EG-BiP and characterized these on biochemical and cellular levels. We were able to design PROTACs capable of binding eIF4E and successfully engaging Cereblon, which targets proteins for proteolysis. However, these initial PROTACs did not successfully stimulate degradation of eIF4E, possibly due to competitive effects from 4E-BP1 binding. Our results highlight challenges of targeted proteasomal degradation of eIF4E that must be addressed by future efforts.

Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs.

G-protein-coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of over 30% of currently marketed pharmaceuticals. Although several structures have been solved for GPCR-G protein complexes, few are in a lipid membrane environment. Here, we report cryo-EM structures of complexes of neurotensin, neurotensin receptor 1 and Gαi1ß1γ1 in two conformational states, resolved to resolutions of 4.1 and 4.2 Å. The structures, determined in a lipid bilayer without any stabilizing antibodies or nanobodies, reveal an extended network of protein-protein interactions at the GPCR-G protein interface as compared to structures obtained in detergent micelles. The findings show that the lipid membrane modulates the structure and dynamics of complex formation and provide a molecular explanation for the stronger interaction between GPCRs and G proteins in lipid bilayers. We propose an allosteric mechanism for GDP release, providing new insights into the activation of G proteins for downstream signaling.

A multi-pronged approach targeting SARS-CoV-2 proteins using ultra-large virtual screening.

The unparalleled global effort to combat the continuing severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic over the last year has resulted in promising prophylactic measures. However, a need still exists for cheap, effective therapeutics, and targeting multiple points in the viral life cycle could help tackle the current, as well as future, coronaviruses. Here, we leverage our recently developed, ultra-large-scale in silico screening platform, VirtualFlow, to search for inhibitors that target SARS-CoV-2. In this unprecedented structure-based virtual campaign, we screened roughly 1 billion molecules against each of 40 different target sites on 17 different potential viral and host targets. In addition to targeting the active sites of viral enzymes, we also targeted critical auxiliary sites such as functionally important protein-protein interactions.

A Multi-Pronged Approach Targeting SARS-CoV-2 Proteins Using Ultra-Large Virtual Screening.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), previously known as 2019 novel coronavirus (2019-nCoV), has spread rapidly across the globe, creating an unparalleled global health burden and spurring a deepening economic crisis. As of July 7th, 2020, almost seven months into the outbreak, there are no approved vaccines and few treatments available. Developing drugs that target multiple points in the viral life cycle could serve as a strategy to tackle the current as well as future coronavirus pandemics. Here we leverage the power of our recently developed in silico screening platform, VirtualFlow, to identify inhibitors that target SARS-CoV-2. VirtualFlow is able to efficiently harness the power of computing clusters and cloud-based computing platforms to carry out ultra-large scale virtual screens. In this unprecedented structure-based multi-target virtual screening campaign, we have used VirtualFlow to screen an average of approximately 1 billion molecules against each of 40 different target sites on 17 different potential viral and host targets in the cloud. In addition to targeting the active sites of viral enzymes, we also target critical auxiliary sites such as functionally important protein-protein interaction interfaces. This multi-target approach not only increases the likelihood of finding a potent inhibitor, but could also help identify a collection of anti-coronavirus drugs that would retain efficacy in the face of viral mutation. Drugs belonging to different regimen classes could be combined to develop possible combination therapies, and top hits that bind at highly conserved sites would be potential candidates for further development as coronavirus drugs. Here, we present the top 200 in silico hits for each target site. While in-house experimental validation of some of these compounds is currently underway, we want to make this array of potential inhibitor candidates available to researchers worldwide in consideration of the pressing need for fast-tracked drug development.

An open-source drug discovery platform enables ultra-large virtual screens.

On average, an approved drug currently costs US$2-3 billion and takes more than 10 years to develop1. In part, this is due to expensive and time-consuming wet-laboratory experiments, poor initial hit compounds and the high attrition rates in the (pre-)clinical phases. Structure-based virtual screening has the potential to mitigate these problems. With structure-based virtual screening, the quality of the hits improves with the number of compounds screened2. However, despite the fact that large databases of compounds exist, the ability to carry out large-scale structure-based virtual screening on computer clusters in an accessible, efficient and flexible manner has remained difficult. Here we describe VirtualFlow, a highly automated and versatile open-source platform with perfect scaling behaviour that is able to prepare and efficiently screen ultra-large libraries of compounds. VirtualFlow is able to use a variety of the most powerful docking programs. Using VirtualFlow, we prepared one of the largest and freely available ready-to-dock ligand libraries, with more than 1.4 billion commercially available molecules. To demonstrate the power of VirtualFlow, we screened more than 1 billion compounds and identified a set of structurally diverse molecules that bind to KEAP1 with submicromolar affinity. One of the lead inhibitors (iKeap1) engages KEAP1 with nanomolar affinity (dissociation constant (Kd) = 114 nM) and disrupts the interaction between KEAP1 and the transcription factor NRF2. This illustrates the potential of VirtualFlow to access vast regions of the chemical space and identify molecules that bind with high affinity to target proteins.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

The Hairpin Form of r(G4C2)exp in c9ALS/FTD Is Repeat-Associated Non-ATG Translated and a Target for Bioactive Small Molecules.

The most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) is an expanded G4C2 repeat [(G4C2)exp] in C9ORF72. ALS/FTD-associated toxicity has been traced to the RNA transcribed from the repeat expansion [r(G4C2)exp], which sequesters RNA-binding proteins (RBPs) and undergoes repeat-associated non-ATG (RAN) translation to generate toxic dipeptide repeats. Using in vitro and cell-based assays, we identified a small molecule (4) that selectively bound r(G4C2)exp, prevented sequestration of an RBP, and inhibited RAN translation. Indeed, biophysical characterization showed that 4 selectively bound the hairpin form of r(G4C2)exp, and nuclear magnetic resonance spectroscopy studies and molecular dynamics simulations defined this molecular recognition event. Cellular imaging revealed that 4 localized to r(G4C2)exp cytoplasmic foci, the putative sites of RAN translation. Collectively, these studies highlight that the hairpin structure of r(G4C2)exp is a therapeutically relevant target and small molecules that bind it can ameliorate c9ALS/FTD-associated toxicity.

Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs.

Potential RNA drug targets for small molecules are found throughout the human transcriptome, yet small molecules known to elicit a pharmacological response by directly targeting RNA are limited to antibacterials. Herein, we describe AbsorbArray, a small molecule microarray-based approach that allows for unmodified compounds, including FDA-approved drugs, to be probed for binding to RNA motif libraries in a massively parallel format. Several drug classes bind RNA including kinase and topoisomerase inhibitors. The latter avidly bound the motif found in the Dicer site of oncogenic microRNA (miR)-21 and inhibited its processing both in vitro and in cells. The most potent compound de-repressed a downstream protein target and inhibited a miR-21-mediated invasive phenotype. The compound's activity was ablated upon overexpression of pre-miR-21. Target validation via chemical crosslinking and isolation by pull-down showed direct engagement of pre-miR-21 by the small molecule in cells, demonstrating that RNAs should indeed be considered druggable.

A G-Quadruplex Structure in the Promoter Region of CLIC4 Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of CLIC4 between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of CLIC4. To better understand how this gene is regulated, the promoter region of CLIC4 was analyzed. We found that a high GC content near the transcriptional start site (TSS) might form an alternative G-quadruplex (G4) structure. Nuclear magnetic resonance spectroscopy (NMR) confirmed their formation in vitro. The reporter assay showed that one of the G4 structures exerted a regulatory role in gene transcription. When the G4-forming sequence was mutated to disrupt the G4 structure, the transcription activity dropped. To examine whether this G4 structure actually has an influence on gene transcription in the chromosome, we utilized the CRISPR/Cas9 system to edit the G4-forming sequence within the CLIC4 promoter in the cell genome. The pop-in/pop-out strategy was adopted to isolate the precisely-edited A375 cell clone. In CRISPR-modified A375 cell clones whose G4 was disrupted, there was a decrease in the endogenous CLIC4 messenger RNA (mRNA) expression level. In conclusion, we found that the G4 structure in the CLIC4 promoter might play an important role in regulating the level of transcription.

Using Genome Sequence to Enable the Design of Medicines and Chemical Probes.

Rapid progress in genome sequencing technology has put us firmly into a postgenomic era. A key challenge in biomedical research is harnessing genome sequence to fulfill the promise of personalized medicine. This Review describes how genome sequencing has enabled the identification of disease-causing biomolecules and how these data have been converted into chemical probes of function, preclinical lead modalities, and ultimately U.S. Food and Drug Administration (FDA)-approved drugs. In particular, we focus on the use of oligonucleotide-based modalities to target disease-causing RNAs; small molecules that target DNA, RNA, or protein; the rational repurposing of known therapeutic modalities; and the advantages of pharmacogenetics. Lastly, we discuss the remaining challenges and opportunities in the direct utilization of genome sequence to enable design of medicines.

A Massively Parallel Selection of Small Molecule-RNA Motif Binding Partners Informs Design of an Antiviral from Sequence.

Many RNAs cause disease; however, RNA is rarely exploited as a small-molecule drug target. Our programmatic focus is to define privileged RNA motif small-molecule interactions to enable the rational design of compounds that modulate RNA biology starting from only sequence. We completed a massive, library-versus-library screen that probed over 50 million binding events between RNA motifs and small molecules. The resulting data provide a rich encyclopedia of small-molecule RNA recognition patterns, defining chemotypes and RNA motifs that confer selective, avid binding. The resulting interaction maps were mined against the entire viral genome of hepatitis C virus (HCV). A small molecule was identified that avidly bound RNA motifs present in the HCV 30 UTR and inhibited viral replication while having no effect on host cells. Collectively, this study represents the first whole-genome pattern recognition between small molecules and RNA folds.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (hTERT), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the hTERT gene can down-regulate its expression. However, DNA methylation in the first exon can prevent CTCF binding in most cancers, but the molecular mechanism is unknown. The NMR analysis showed that a stretch of guanine-rich sequence in the first exon of hTERT and located within the CTCF-binding region can form two secondary structures, a hairpin and a quadruplex. A key finding was that the methylation of cytosine at the specific CpG dinucleotides will participate in quartet formation, causing the shift of the equilibrium from the hairpin structure to the quadruplex structure. Of further importance was the finding that the quadruplex formation disrupts CTCF protein binding, which results in an increase in hTERT gene expression. Our results not only identify quadruplex formation in the first exon promoted by CpG dinucleotide methylation as a regulator of hTERT expression but also provide a possible mechanistic insight into the regulation of gene expression via secondary DNA structures.

A novel transition pathway of ligand-induced topological conversion from hybrid forms to parallel forms of human telomeric G-quadruplexes.

The folding topology of DNA G-quadruplexes (G4s) depends not only on their nucleotide sequences but also on environmental factors and/or ligand binding. Here, a G4 ligand, 3,6-bis(1-methyl-4-vinylpyridium iodide)-9-(1-(1-methyl-piperidinium iodide)-3,6,9-trioxaundecane) carbazole (BMVC-8C3O), can induce topological conversion of non-parallel to parallel forms in human telomeric DNA G4s. Nuclear magnetic resonance (NMR) spectroscopy with hydrogen-deuterium exchange (HDX) reveals the presence of persistent imino proton signals corresponding to the central G-quartet during topological conversion of Tel23 and Tel25 G4s from hybrid to parallel forms, implying that the transition pathway mainly involves local rearrangements. In contrast, rapid HDX was observed during the transition of 22-CTA G4 from an anti-parallel form to a parallel form, resulting in complete disappearance of all the imino proton signals, suggesting the involvement of substantial unfolding events associated with the topological transition. Site-specific imino proton NMR assignments of Tel23 G4 enable determination of the interconversion rates of individual guanine bases and detection of the presence of intermediate states. Since the rate of ligand binding is much higher than the rate of ligand-induced topological conversion, a three-state kinetic model was evoked to establish the associated energy diagram for the topological conversion of Tel23 G4 induced by BMVC-8C3O.

Direct evidence of mitochondrial G-quadruplex DNA by using fluorescent anti-cancer agents.

G-quadruplex (G4) is a promising target for anti-cancer treatment. In this paper, we provide the first evidence supporting the presence of G4 in the mitochondrial DNA (mtDNA) of live cells. The molecular engineering of a fluorescent G4 ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide (BMVC), can change its major cellular localization from the nucleus to the mitochondria in cancer cells, while remaining primarily in the cytoplasm of normal cells. A number of BMVC derivatives with sufficient mitochondrial uptake can induce cancer cell death without damaging normal cells. Fluorescence studies of these anti-cancer agents in live cells and in isolated mitochondria from HeLa cells have demonstrated that their major target is mtDNA. In this study, we use fluorescence lifetime imaging microscopy to verify the existence of mtDNA G4s in live cells. Bioactivity studies indicate that interactions between these anti-cancer agents and mtDNA G4 can suppress mitochondrial gene expression. This work underlines the importance of fluorescence in the monitoring of drug-target interactions in cells and illustrates the emerging development of drugs in which mtDNA G4 is the primary target.

Conformational transition of a hairpin structure to G-quadruplex within the WNT1 gene promoter.

The role of G-quadruplexes (G4s) in biological systems has been widely studied. It is found that they have an important function in gene transcription and regulation. In this work, we have identified two topologies of hairpin and G4 structures formed by a native G-rich sequence (WT22: 5'-GGGCCACCGGGCAGGGGGCGGG-3') from the WNT1 promoter region using nuclear magnetic resonance (NMR) spectroscopy. With the help of site-specific isotope labeling, the topologies of these two structures are unambiguously characterized. Circular dichroism and NMR results are analyzed to determine the kinetics associated with the potassium ion-induced hairpin-to-G4 transition, which is very slow-on the time scale of 4800 s-compared to the previously reported folding kinetics of G4 formation. In addition, the free energies of the unfolding of these two structures are obtained using differential scanning calorimetry. Combining the kinetic and thermodynamic data, we have established the free energy landscape of this two-state folding system. Considering that similar conformational change may exist in other native G-rich sequences, this work highlights an important hairpin to G4 conformational transition which can be used in manipulation of gene regulation or ligand modulation in vivo.

The regulatory role of activating transcription factor 2 in inflammation.

Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs.

Inhibition of cancer cell migration and invasion through suppressing the Wnt1-mediating signal pathway by G-quadruplex structure stabilizers.

WNT1 encodes a multifunctional signaling glycoprotein that is highly expressed in several malignant tumors. Patients with Wnt1-positive cancer are usually related to advanced metastasis. Here, we found that a stretch of G-rich sequences located at the WNT1 promoter region is capable of forming G-quadruplex structures. The addition of G-quadruplex structure stabilizers, BMVC and BMVC4, raises the melting temperature of the oligonucleotide formed by the WNT1 promoter G-rich sequences. Significantly, the expression of WNT1 was repressed by BMVC or BMVC4 in a G-quadruplex-dependent manner, suggesting that they can be used to modulate WNT1 expression. The role of G-quadruplex stabilizers on Wnt1-mediated cancer migration and invasion was further analyzed. The protein levels of ß-catenin, a mediator of the Wnt-mediated signaling pathway, and the downstream targets MMP7 and survivin were down-regulated upon BMVC or BMVC4 treatments. Moreover, the migration and invasion activities of cancer cells were inhibited by BMVC and BMVC4, and the inhibitory effects can be reversed by WNT1-overexpression. Thus the Wnt1 expression and its downstream signaling pathways can be regulated through the G-quadruplex sequences located at its promoter region. These findings provide a novel approach for future drug development to inhibit migration and invasion of cancer cells.