Components in SLPE Alleviate AD Model Nematodes by Up-Regulating Gene gst-5.

Salvia leucantha is a perennial herb of the genus Salvia in the family Labiatae, which has a wide range of biological activities, mainly including inhibition of acetylcholinesterase, antibacterial, and anti-inflammatory activity. To explore the protective effects and mechanism of action of S. leucantha on Alzheimer's disease (AD), the anti-AD activity of SLE (extracts of S. leucantha) was determined by using a transgenic Caenorhabditis elegans (C. elegans) model (CL4176). Analyses included paralysis assay, phenotypic experiments, transcriptome sequencing, RNA interference (RNAi), heat shock assays, and gas chromatography-mass spectrometry (GC-MS). SLPE (S. leucantha petroleum ether extract) could significantly delay CL4176 paralysis and extend the longevity of C. elegans N2 without harmful effects. A total of 927 genes were significantly changed by SLPE treatment in C. elegans, mainly involving longevity regulatory pathways-nematodes, drug metabolism-cytochrome P450, and glutathione metabolic pathways. RNAi showed that SLPE exerted its anti-AD activity through up-regulation of the gene gst-5; the most abundant compound in SLPE analyzed by GC-MS was 2,4-Di-tert-butylphenol (2,4-DTBP), and the compound delayed nematode paralysis. The present study suggests that active components in S. leucantha may serve as new-type anti-AD candidates and provide some insights into their biological functions.

Dual biomass-derived porous carbon heterogeneous functionalized mesoporous CuCo2O4 nanocomposite combined with molecularly imprinted polymers as an electrochemical sensing platform for hypersensitive and selective determination of dimetridazole contaminants.

In this study, an original molecularly imprinted electrochemical sensor (MIECS) is prepared using layer-by-layer modification of sensitization nanomaterials (CuCo2O4/BPC-E) coupled with molecularly imprinted polymers (MIPs) for the ultrasensitive and rapid determination of dimetridazole (DMZ) contaminants. The biomass waste of eggshell (ES) powders subtly introduced in situ in the carbonization process of psyllium husk (PSH) substantially promotes the physicochemical properties of the resulting biomass-derived porous carbon (BPC-E). The large specific surface area and abundant pores provide a favourable surface for loading mesoporous CuCo2O4 with a spinel structure. The assembly of CuCo2O4/BPC-E on the gold electrode (GE) surface enhances the electrochemical sensing signal. The MIPs constructed using DMZ and o-phenylenediamine (oPD) as templates and functional monomers boost the targeted recognition performance of the analyte. The combined DMZ targets then undergo an electrochemical reduction reaction in situ with the transfer of four electrons and four protons. Under optimum conditions, the current response of differential pulse voltammetry (DPV) exhibits two linear ranges for DMZ detection, 0.01-10 µM and 10-200 µM. The limit of detection (LOD) is 1.8 nM (S/N = 3) with a sensitivity of 5.724 µA µM-1 cm-2. The obtained MIECS exhibits excellent selectivity, reproducibility, repeatability and stability. This electrochemical sensing system is applied to the detection of real samples (tap water, coarse fodder and swine urine), yielding satisfactory recoveries (90.6%-98.1 %), which are consistent with those obtained via HPLC. This finding verifies that the utility of MIECS for monitoring pharmaceutical and environmental contaminants and ensuring food safety.

Irisin acts through its integrin receptor in a two-step process involving extracellular Hsp90α.

Exercise benefits the human body in many ways. Irisin is secreted by muscle, increased with exercise, and conveys physiological benefits, including improved cognition and resistance to neurodegeneration. Irisin acts via αV integrins; however, a mechanistic understanding of how small polypeptides like irisin can signal through integrins is poorly understood. Using mass spectrometry and cryo-EM, we demonstrate that the extracellular heat shock protein 90α (eHsp90α) is secreted by muscle with exercise and activates integrin αVß5. This allows for high-affinity irisin binding and signaling through an Hsp90α/αV/ß5 complex. By including hydrogen/deuterium exchange data, we generate and experimentally validate a 2.98 Å RMSD irisin/αVß5 complex docking model. Irisin binds very tightly to an alternative interface on αVß5 distinct from that used by known ligands. These data elucidate a non-canonical mechanism by which a small polypeptide hormone like irisin can function through an integrin receptor.

[Clinical application of Flow-through bridge anterolateral thigh flap in repair of complex calf soft tissue defects].

Objective: To investigate the effectiveness of Flow-through bridge anterolateral thigh flap transplantation in the treatment of complex calf soft tissue defects. Methods: The clinical data of the patients with complicated calf soft tissue defects, who were treated with Flow-through bridge anterolateral thigh flap (study group, 23 cases) or bridge anterolateral thigh flap (control group, 23 cases) between January 2008 and January 2022, were retrospectively analyzed. All complex calf soft tissue defects in the two groups were caused by trauma or osteomyelitis, and there was only one major blood vessel in the calf or no blood vessel anastomosed with the grafted skin flap. There was no significant difference between the two groups in general data such as gender, age, etiology, size of leg soft tissue defect, and time from injury to operation ( P>0.05). The lower extremity functional scale (LEFS) was used to evaluate the sufferred lower extremity function of the both groups after operation, and the peripheral blood circulation score of the healthy side was evaluated according to the Chinese Medical Association Hand Surgery Society's functional evaluation standard for replantation of amputated limbs. Weber's quantitative method was used to detect static 2-point discrimination (S2PD) to evaluate peripheral sensation of the healthy side, and the popliteal artery flow velocity, toenail capillary filling time, foot temperature, toe blood oxygen saturation of the healthy side, and the incidence of complications were compared between the two groups. Results: No vascular or nerve injury occurred during operation. All flaps survived, and 1 case of partial flap necrosis occurred in both groups, which healed after free skin grafting. All patients were followed up 6 months to 8 years, with a median time of 26 months. The function of the sufferred limb of the two groups recovered satisfactorily, the blood supply of the flap was good, the texture was soft, and the appearance was fair. The incision in the donor site healed well with a linear scar, and the color of the skin graft area was similar. Only a rectangular scar could be seen in the skin donor area where have a satisfactory appearance. The blood supply of the distal limb of the healthy limb was good, and there was no obvious abnormality in color and skin temperature, and the blood supply of the limb was normal during activity. The popliteal artery flow velocity in the study group was significantly faster than that in the control group at 1 month after the pedicle was cut, and the foot temperature, toe blood oxygen saturation, S2PD, toenail capillary filling time, and peripheral blood circulation score were significantly better than those in the control group ( P<0.05). There were 8 cases of cold feet and 2 cases of numbness on the healthy side in the control group, while only 3 cases of cold feet occurred in the study group. The incidence of complications in the study group (13.04%) was significantly lower than that in the control group (43.47%) ( χ 2=3.860, P=0.049). There was no significant difference in LEFS score between the two groups at 6 months after operation ( P>0.05). Conclusion: Flow-through bridge anterolateral thigh flap can reduce postoperative complications of healthy feet and reduce the impact of surgery on blood supply and sensation of healthy feet. It is an effective method for repairing complex calf soft tissue defects.

Public Opinions on COVID-19 Vaccines-A Spatiotemporal Perspective on Races and Topics Using a Bayesian-Based Method.

The COVID-19 pandemic has been sweeping across the United States of America since early 2020. The whole world was waiting for vaccination to end this pandemic. Since the approval of the first vaccine by the U.S. CDC on 9 November 2020, nearly 67.5% of the US population have been fully vaccinated by 10 July 2022. While quite successful in controlling the spreading of COVID-19, there were voices against vaccines. Therefore, this research utilizes geo-tweets and Bayesian-based method to investigate public opinions towards vaccines based on (1) the spatiotemporal changes in public engagement and public sentiment; (2) how the public engagement and sentiment react to different vaccine-related topics; (3) how various races behave differently. We connected the phenomenon observed to real-time and historical events. We found that in general the public is positive towards COVID-19 vaccines. Public sentiment positivity went up as more people were vaccinated. Public sentiment on specific topics varied in different periods. African Americans' sentiment toward vaccines was relatively lower than other races.

NIN-like protein 7 transcription factor is a plant nitrate sensor.

Nitrate is an essential nutrient and signaling molecule for plant growth. Plants sense intracellular nitrate to adjust their metabolic and growth responses. Here we identify the primary nitrate sensor in plants. We found that mutation of all seven Arabidopsis NIN-like protein (NLP) transcription factors abolished plants' primary nitrate responses and developmental programs. Analyses of NIN-NLP7 chimeras and nitrate binding revealed that NLP7 is derepressed upon nitrate perception via its amino terminus. A genetically encoded fluorescent split biosensor, mCitrine-NLP7, enabled visualization of single-cell nitrate dynamics in planta. The nitrate sensor domain of NLP7 resembles the bacterial nitrate sensor NreA. Substitutions of conserved residues in the ligand-binding pocket impaired the ability of nitrate-triggered NLP7 to control transcription, transport, metabolism, development, and biomass. We propose that NLP7 represents a nitrate sensor in land plants.

[Application of anterolateral thigh bridge flap with free skin graft wrapping vascular bridge in complex calf soft tissue defects].

Objective: To explore the effectiveness of anterolateral thigh bridge flap with free skin graft wrapping vascular bridge in repairing complex calf soft tissue defects. Methods: The clinical data of 11 patients with complex calf soft tissue defects between April 2018 and October 2021 were retrospectively analyzed, including 9 males and 2 females, aged 11-60 years, with a median age of 39 years. There were 8 cases of calf soft tissue defect caused by traffic accident, and 3 cases of calf skin infection caused by chronic osteomyelitis. The skin and soft tissue defects ranged from 10 cm×8 cm to 35 cm×10 cm after thorough debridement and accompanied with bone and tendon exposure. There was only one main vessel in calf of 9 cases and no blood vessel that could be anastomosed with the flap vessel could be found in the recipient site of 2 cases. The anterolateral thigh skin flap (the flap size ranged from 12 cm×10 cm to 37 cm×12 cm) was taken to repair the soft tissue defect. The donor site of the flap was treated with direct suture (8 cases) or partial suture followed by skin grafting (3 cases), and the vascular bridge was wrapped with medium-thickness skin graft. Results: The flaps of 11 patients survived completely without necrosis, infection, and vascular crisis. The blood supply of the vascular bridge was unobstructed and the pulse was good. The color of the medium-thickness skin graft were ruddy. All 11 patients were followed up 2-40 months, with an average of 19.4 months. The flaps healed well with the surrounding tissues without obvious exudation and color difference. The flaps had normal color and temperature, good blood supply, and soft texture. The shape of the flap and calf contour were satisfactory and the function of the limb recovered well. The donor area of thigh flap healed by first intention without obvious scar formation. The donor area of skin healed well with a longitudinal oblong scar only and the appearance was satisfactory. Conclusion: The anterolateral thigh bridge flap transplantation with free skin wrapping vascular bridge is an effective method for the treatment of complex calf soft tissue defects.

COVID-Scraper: An Open-Source Toolset for Automatically Scraping and Processing Global Multi-Scale Spatiotemporal COVID-19 Records.

In 2019, COVID-19 quickly spread across the world, infecting billions of people and disrupting the normal lives of citizens in every country. Governments, organizations, and research institutions all over the world are dedicating vast resources to research effective strategies to fight this rapidly propagating virus. With virus testing, most countries publish the number of confirmed cases, dead cases, recovered cases, and locations routinely through various channels and forms. This important data source has enabled researchers worldwide to perform different COVID-19 scientific studies, such as modeling this virus's spreading patterns, developing prevention strategies, and studying the impact of COVID-19 on other aspects of society. However, one major challenge is that there is no standardized, updated, and high-quality data product that covers COVID-19 cases data internationally. This is because different countries may publish their data in unique channels, formats, and time intervals, which hinders researchers from fetching necessary COVID-19 datasets effectively, especially for fine-scale studies. Although existing solutions such as John's Hopkins COVID-19 Dashboard and 1point3acres COVID-19 tracker are widely used, it is difficult for users to access their original dataset and customize those data to meet specific requirements in categories, data structure, and data source selection. To address this challenge, we developed a toolset using cloud-based web scraping to extract, refine, unify, and store COVID-19 cases data at multiple scales for all available countries around the world automatically. The toolset then publishes the data for public access in an effective manner, which could offer users a real time COVID-19 dynamic dataset with a global view. Two case studies are presented about how to utilize the datasets. This toolset can also be easily extended to fulfill other purposes with its open-source nature.

New Metrics for Assessing the State Performance in Combating the COVID-19 Pandemic.

Previous research has noted that many factors greatly influence the spread of COVID-19. Contrary to explicit factors that are measurable, such as population density, number of medical staff, and the daily test rate, many factors are not directly observable, for instance, culture differences and attitudes toward the disease, which may introduce unobserved heterogeneity. Most contemporary COVID-19 related research has focused on modeling the relationship between explicitly measurable factors and the response variable of interest (such as the infection rate or the death rate). The infection rate is a commonly used metric for evaluating disease progression and a state's mitigation efforts. Because unobservable sources of heterogeneity cannot be measured directly, it is hard to incorporate them into the quantitative assessment and decision-making process. In this study, we propose new metrics to study a state's performance by adjusting the measurable county-level covariates and unobservable state-level heterogeneity through random effects. A hierarchical linear model (HLM) is postulated, and we calculate two model-based metrics-the standardized infection ratio (SDIR) and the adjusted infection rate (AIR). This analysis highlights certain time periods when the infection rate for a state was high while their SDIR was low and vice versa. We show that trends in these metrics can give insight into certain aspects of a state's performance. As each state continues to develop their individualized COVID-19 mitigation strategy and ultimately works to improve their performance, the SDIR and AIR may help supplement the crude infection rate metric to provide a more thorough understanding of a state's performance.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

A biphenyl inhibitor of eIF4E targeting an internal binding site enables the design of cell-permeable PROTAC-degraders.

The eukaryotic translation initiation factor 4E (eIF4E) is the master regulator of cap-dependent protein synthesis. Overexpression of eIF4E is implicated in diseases such as cancer, where dysregulation of oncogenic protein translation is frequently observed. eIF4E has been an attractive target for cancer treatment. Here we report a high-resolution X-ray crystal structure of eIF4E in complex with a novel inhibitor (i4EG-BiP) that targets an internal binding site, in contrast to the previously described inhibitor, 4EGI-1, which binds to the surface. We demonstrate that i4EG-BiP is able to displace the scaffold protein eIF4G and inhibit the proliferation of cancer cells. We provide insights into how i4EG-BiP is able to inhibit cap-dependent translation by increasing the eIF4E-4E-BP1 interaction while diminishing the interaction of eIF4E with eIF4G. Leveraging structural details, we designed proteolysis targeted chimeras (PROTACs) derived from 4EGI-1 and i4EG-BiP and characterized these on biochemical and cellular levels. We were able to design PROTACs capable of binding eIF4E and successfully engaging Cereblon, which targets proteins for proteolysis. However, these initial PROTACs did not successfully stimulate degradation of eIF4E, possibly due to competitive effects from 4E-BP1 binding. Our results highlight challenges of targeted proteasomal degradation of eIF4E that must be addressed by future efforts.

Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs.

G-protein-coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of over 30% of currently marketed pharmaceuticals. Although several structures have been solved for GPCR-G protein complexes, few are in a lipid membrane environment. Here, we report cryo-EM structures of complexes of neurotensin, neurotensin receptor 1 and Gαi1ß1γ1 in two conformational states, resolved to resolutions of 4.1 and 4.2 Å. The structures, determined in a lipid bilayer without any stabilizing antibodies or nanobodies, reveal an extended network of protein-protein interactions at the GPCR-G protein interface as compared to structures obtained in detergent micelles. The findings show that the lipid membrane modulates the structure and dynamics of complex formation and provide a molecular explanation for the stronger interaction between GPCRs and G proteins in lipid bilayers. We propose an allosteric mechanism for GDP release, providing new insights into the activation of G proteins for downstream signaling.

A multi-pronged approach targeting SARS-CoV-2 proteins using ultra-large virtual screening.

The unparalleled global effort to combat the continuing severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic over the last year has resulted in promising prophylactic measures. However, a need still exists for cheap, effective therapeutics, and targeting multiple points in the viral life cycle could help tackle the current, as well as future, coronaviruses. Here, we leverage our recently developed, ultra-large-scale in silico screening platform, VirtualFlow, to search for inhibitors that target SARS-CoV-2. In this unprecedented structure-based virtual campaign, we screened roughly 1 billion molecules against each of 40 different target sites on 17 different potential viral and host targets. In addition to targeting the active sites of viral enzymes, we also targeted critical auxiliary sites such as functionally important protein-protein interactions.

An Optimization Method of Precision Assembly Process Based on the Relative Entropy Evaluation of the Stress Distribution.

The entropy evaluation method of assembly stress has become a hot topic in recent years. However, the current research can only evaluate the maximum stress magnitude and stress magnitude uniformity, and it cannot evaluate the stress position distribution. In this paper, an evaluation method of stress distribution characterized by strain energy density distribution is proposed. In this method, the relative entropy is used as the evaluation index of the stress distribution difference between the error model and the ideal model. It can evaluate not only the stress magnitude, but also the stress position. On this basis, an optimization method of the precise assembly process which takes the relative entropy as the optimization objective is proposed. The stress distributions of the optical lens are evaluated, and the assembly angle of the spacer in the process of the optical lens system assembly is optimized. By comparing the stress distribution of the optimized model and the ideal model, the validity of this method is proved.

A Multi-Pronged Approach Targeting SARS-CoV-2 Proteins Using Ultra-Large Virtual Screening.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), previously known as 2019 novel coronavirus (2019-nCoV), has spread rapidly across the globe, creating an unparalleled global health burden and spurring a deepening economic crisis. As of July 7th, 2020, almost seven months into the outbreak, there are no approved vaccines and few treatments available. Developing drugs that target multiple points in the viral life cycle could serve as a strategy to tackle the current as well as future coronavirus pandemics. Here we leverage the power of our recently developed in silico screening platform, VirtualFlow, to identify inhibitors that target SARS-CoV-2. VirtualFlow is able to efficiently harness the power of computing clusters and cloud-based computing platforms to carry out ultra-large scale virtual screens. In this unprecedented structure-based multi-target virtual screening campaign, we have used VirtualFlow to screen an average of approximately 1 billion molecules against each of 40 different target sites on 17 different potential viral and host targets in the cloud. In addition to targeting the active sites of viral enzymes, we also target critical auxiliary sites such as functionally important protein-protein interaction interfaces. This multi-target approach not only increases the likelihood of finding a potent inhibitor, but could also help identify a collection of anti-coronavirus drugs that would retain efficacy in the face of viral mutation. Drugs belonging to different regimen classes could be combined to develop possible combination therapies, and top hits that bind at highly conserved sites would be potential candidates for further development as coronavirus drugs. Here, we present the top 200 in silico hits for each target site. While in-house experimental validation of some of these compounds is currently underway, we want to make this array of potential inhibitor candidates available to researchers worldwide in consideration of the pressing need for fast-tracked drug development.

An open-source drug discovery platform enables ultra-large virtual screens.

On average, an approved drug currently costs US$2-3 billion and takes more than 10 years to develop1. In part, this is due to expensive and time-consuming wet-laboratory experiments, poor initial hit compounds and the high attrition rates in the (pre-)clinical phases. Structure-based virtual screening has the potential to mitigate these problems. With structure-based virtual screening, the quality of the hits improves with the number of compounds screened2. However, despite the fact that large databases of compounds exist, the ability to carry out large-scale structure-based virtual screening on computer clusters in an accessible, efficient and flexible manner has remained difficult. Here we describe VirtualFlow, a highly automated and versatile open-source platform with perfect scaling behaviour that is able to prepare and efficiently screen ultra-large libraries of compounds. VirtualFlow is able to use a variety of the most powerful docking programs. Using VirtualFlow, we prepared one of the largest and freely available ready-to-dock ligand libraries, with more than 1.4 billion commercially available molecules. To demonstrate the power of VirtualFlow, we screened more than 1 billion compounds and identified a set of structurally diverse molecules that bind to KEAP1 with submicromolar affinity. One of the lead inhibitors (iKeap1) engages KEAP1 with nanomolar affinity (dissociation constant (Kd) = 114 nM) and disrupts the interaction between KEAP1 and the transcription factor NRF2. This illustrates the potential of VirtualFlow to access vast regions of the chemical space and identify molecules that bind with high affinity to target proteins.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

The Hairpin Form of r(G4C2)exp in c9ALS/FTD Is Repeat-Associated Non-ATG Translated and a Target for Bioactive Small Molecules.

The most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) is an expanded G4C2 repeat [(G4C2)exp] in C9ORF72. ALS/FTD-associated toxicity has been traced to the RNA transcribed from the repeat expansion [r(G4C2)exp], which sequesters RNA-binding proteins (RBPs) and undergoes repeat-associated non-ATG (RAN) translation to generate toxic dipeptide repeats. Using in vitro and cell-based assays, we identified a small molecule (4) that selectively bound r(G4C2)exp, prevented sequestration of an RBP, and inhibited RAN translation. Indeed, biophysical characterization showed that 4 selectively bound the hairpin form of r(G4C2)exp, and nuclear magnetic resonance spectroscopy studies and molecular dynamics simulations defined this molecular recognition event. Cellular imaging revealed that 4 localized to r(G4C2)exp cytoplasmic foci, the putative sites of RAN translation. Collectively, these studies highlight that the hairpin structure of r(G4C2)exp is a therapeutically relevant target and small molecules that bind it can ameliorate c9ALS/FTD-associated toxicity.

A G-Quadruplex Structure in the Promoter Region of CLIC4 Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of CLIC4 between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of CLIC4. To better understand how this gene is regulated, the promoter region of CLIC4 was analyzed. We found that a high GC content near the transcriptional start site (TSS) might form an alternative G-quadruplex (G4) structure. Nuclear magnetic resonance spectroscopy (NMR) confirmed their formation in vitro. The reporter assay showed that one of the G4 structures exerted a regulatory role in gene transcription. When the G4-forming sequence was mutated to disrupt the G4 structure, the transcription activity dropped. To examine whether this G4 structure actually has an influence on gene transcription in the chromosome, we utilized the CRISPR/Cas9 system to edit the G4-forming sequence within the CLIC4 promoter in the cell genome. The pop-in/pop-out strategy was adopted to isolate the precisely-edited A375 cell clone. In CRISPR-modified A375 cell clones whose G4 was disrupted, there was a decrease in the endogenous CLIC4 messenger RNA (mRNA) expression level. In conclusion, we found that the G4 structure in the CLIC4 promoter might play an important role in regulating the level of transcription.

Using Genome Sequence to Enable the Design of Medicines and Chemical Probes.

Rapid progress in genome sequencing technology has put us firmly into a postgenomic era. A key challenge in biomedical research is harnessing genome sequence to fulfill the promise of personalized medicine. This Review describes how genome sequencing has enabled the identification of disease-causing biomolecules and how these data have been converted into chemical probes of function, preclinical lead modalities, and ultimately U.S. Food and Drug Administration (FDA)-approved drugs. In particular, we focus on the use of oligonucleotide-based modalities to target disease-causing RNAs; small molecules that target DNA, RNA, or protein; the rational repurposing of known therapeutic modalities; and the advantages of pharmacogenetics. Lastly, we discuss the remaining challenges and opportunities in the direct utilization of genome sequence to enable design of medicines.